ORFeome Collaboration OCAA plates

Rearray Collection
Plate Number
Vector
5' linker
3' linker
OCAA
1
pENTR201
gtacaaaaaagctggcaCC
GGCGacccagctttcttgtaca
OCAA
2
pENTR201
gtacaaaaaagctggcaCC
GGCGacccagctttcttgtaca
OCAA
3
pENTR201
gtacaaaaaagctggcaCC
GGCGacccagctttcttgtaca
OCAA
4
pENTR201
gtacaaaaaagctggcaCC
GGCGacccagctttcttgtaca
OCAA
5
pENTR201
gtacaaaaaagctggcaCC
GGCGacccagctttcttgtaca
OCAA
6
pENTR201
gtacaaaaaagctggcaCC
GGCGacccagctttcttgtaca
OCAA
7
pENTR201
gtacaaaaaagctggcaCC
GGCGacccagctttcttgtaca
OCAA
8
pENTR201
gtacaaaaaagctggcaCC
GGCGacccagctttcttgtaca
OCAA
9
pENTR201
gtacaaaaaagctggcaCC
GGCGacccagctttcttgtaca
OCAA
10
pENTR201
gtacaaaaaagctggcaCC
GGCGacccagctttcttgtaca
OCAA
11
pENTR201
gtacaaaaaagctggcaCC
GGCGacccagctttcttgtaca
OCAA
12
pENTR221
gtacaaaaaagcaggctCCACC
AAGCTTGacccagctttcttgtaca
OCAA
13
pENTR221
gtacaaaaaagcaggctCCACC
AAGCTTGacccagctttcttgtaca
OCAA
14
pENTR221
gtacaaaaaagcaggctCCACC
TGGATCCacccagctttcttgtaca
OCAA
15
pENTR221
gtacaaaaaagcaggctCCACC
TGTATTCacccagctttcttgtaca
OCAA
16
pENTR221
gtacaaaaaagctggcaCC
GGCGacccagctttcttgtaca
OCAA
17
pENTR221
gtacaaaaaagcaggctCCACC
TAGCTTGacccagctttcttgtaca
OCAA
18
pENTR221
gtacaaaaaagcaggctCCACC
TGAATCCacccagctttcttgtaca
OCAA
19
pENTR221
gtacaaaaaagcaggctCCACC
TGAATTCacccagctttcttgtaca
OCAA
20
pENTR/D-TOPO
GTACAAAAAAGCAGGCTCCGC-GGCCGCCCCCTTCACCATG
AGGGGTGGGCGCGCCGACCCAGC-TTTCTTGTAC
OCAA
21
pENTR221
GTACAAAAAAGCAGGCTCCACC
TTGGACCCAGCTTTCTTGTAC
OCAA
22
pENTR221
GTACAAAAAAGCAGGCTCCACC
TTGGACCCAGCTTTCTTGTAC
OCAA
23
pENTR221
GTACAAAAAAGCAGGCTCCACC
TTGGACCCAGCTTTCTTGTAC
OCAA
24
pENTR221
GTACAAAAAAGCAGGCTCCACC
TTGGACCCAGCTTTCTTGTAC
OCAA
25
pENTR221
GTACAAAAAAGCAGGCTCCACC
TTGGACCCAGCTTTCTTGTAC
OCAA
26
pENTR221
GTACAAAAAAGCAGGCTCCACC
TTGGACCCAGCTTTCTTGTAC
OCAA
27
pENTR221
GTACAAAAAAGCAGGCTCCACC
TTGGACCCAGCTTTCTTGTAC
OCAA
28
pENTR221
GTACAAAAAAGCAGGCTCCACC
TTGGACCCAGCTTTCTTGTAC
OCAA
29
pENTR221
GTACAAAAAAGCAGGCTCCACC
TTGGACCCAGCTTTCTTGTAC
OCAA
30
pENTR221
GTACAAAAAAGCAGGCTCCACC
TTGGACCCAGCTTTCTTGTAC
OCAA
31
pENTR221
GTACAAAAAAGCAGGCTCCACC
TTGGACCCAGCTTTCTTGTAC
OCAA
32
pENTR221
GTACAAAAAAGCAGGCTCCACC
TTGGACCCAGCTTTCTTGTAC
OCAA
33
pENTR221
GTACAAAAAAGCAGGCTCCACC
TTGGACCCAGCTTTCTTGTAC
OCAA
34
pENTR221
GTACAAAAAAGCAGGCTCCACC
TTGGACCCAGCTTTCTTGTAC
OCAA
35
pENTR221
GTACAAAAAAGCAGGCTCCACC
TTGGACCCAGCTTTCTTGTAC
OCAA
36
pENTR221
GTACAAAAAAGCAGGCTCCACC
TTGGACCCAGCTTTCTTGTAC
OCAA
37
pENTR221
GTACAAAAAAGCAGGCTCCACC
TTGGACCCAGCTTTCTTGTAC
OCAA
38
pENTR221
GTACAAAAAAGCAGGCTCCACC
TTGGACCCAGCTTTCTTGTAC
OCAA
39
pENTR221
GTACAAAAAAGCAGGCTCCACC
TTGGACCCAGCTTTCTTGTAC
OCAA
40
pENTR221
GTACAAAAAAGCAGGCTCCACC
TTGGACCCAGCTTTCTTGTAC
OCAA
41
pENTR221
GTACAAAAAAGCAGGCTCCACC
TTGGACCCAGCTTTCTTGTAC
OCAA
42
pENTR221
GTACAAAAAAGCAGGCTCCACC
TTGGACCCAGCTTTCTTGTAC
OCAA
43
pENTR221
GTACAAAAAAGCAGGCTCCACC
TTGGACCCAGCTTTCTTGTAC
OCAA
44
pENTR221
GTACAAAAAAGCAGGCTCCACC
TTGGACCCAGCTTTCTTGTAC
OCAA
45
pENTR221
GTACAAAAAAGCAGGCTCCACC
TTGGACCCAGCTTTCTTGTAC
OCAA
46
pENTR221
GTACAAAAAAGCAGGCTCCACC
TTGGACCCAGCTTTCTTGTAC
OCAA
47
pENTR221
GTACAAAAAAGCAGGCTCCACC
TTGGACCCAGCTTTCTTGTAC
OCAA
48
pENTR221
GTACAAAAAAGCAGGCTCCACC
TTGGACCCAGCTTTCTTGTAC
OCAA
49
pENTR221
GTACAAAAAAGCAGGCTCCACC
TTGGACCCAGCTTTCTTGTAC
OCAA
50
pENTR221
GTACAAAAAAGCAGGCTCCACC
TTGGACCCAGCTTTCTTGTAC
OCAA
51
pENTR221
GTACAAAAAAGCAGGCTCCACC
TTGGACCCAGCTTTCTTGTAC
OCAA
52
pENTR221
GTACAAAAAAGCAGGCTCCACC
TTGGACCCAGCTTTCTTGTAC
OCAA
53
pENTR221
GTACAAAAAAGCAGGCTCCACC
TTGGACCCAGCTTTCTTGTAC
OCAA
54
pENTR221
GTACAAAAAAGCAGGCTCCACC
TTGGACCCAGCTTTCTTGTAC
OCAA
55
pENTR221
GTACAAAAAAGCAGGCTCCACC
TTGGACCCAGCTTTCTTGTAC
OCAA
56
pENTR221
GTACAAAAAAGCAGGCTCCACC
TTGGACCCAGCTTTCTTGTAC
OCAA
57
pENTR221
GTACAAAAAAGCAGGCTCCACC
TTGGACCCAGCTTTCTTGTAC
OCAA
58
pENTR221
GTACAAAAAAGCAGGCTCCACC
TTGGACCCAGCTTTCTTGTAC
OCAA
59
pENTR221
GTACAAAAAAGCAGGCTCCACCATG
TAGGACCCAGCTTTCTTGTAC
OCAA
60
pENTR221
GTACAAAAAAGCAGGCTCCACCATG
TAGGACCCAGCTTTCTTGTAC
OCAA
61
pENTR221
GTACAAAAAAGCAGGCTCCACCATG
TAGGACCCAGCTTTCTTGTAC
OCAA
62
pENTR221
GTACAAAAAAGCAGGCTCCACCATG
TAGGACCCAGCTTTCTTGTAC
OCAA
63
pENTR221
GTACAAAAAAGCAGGCTCCACCATG
TAGGACCCAGCTTTCTTGTAC
OCAA
64
pENTR221
GTACAAAAAAGCAGGCTCCACCATG
TAGGACCCAGCTTTCTTGTAC
OCAA
65
pENTR221
GTACAAAAAAGCAGGCTCCACCATG
TAGGACCCAGCTTTCTTGTAC
OCAA
66
pENTR221
GTACAAAAAAGCAGGCTCCACCATG
TAGGACCCAGCTTTCTTGTAC
OCAA
67
pENTR221
GTACAAAAAAGCAGGCTCCACCATG
TAGGACCCAGCTTTCTTGTAC
OCAA
68
pENTR221
GTACAAAAAAGCAGGCTCCACCATG
TAGGACCCAGCTTTCTTGTAC
OCAA
69
pENTR221
GTACAAAAAAGCAGGCTCCACCATG
TAGGACCCAGCTTTCTTGTAC
OCAA
70
pENTR221
GTACAAAAAAGCAGGCTCCACCATG
TAGGACCCAGCTTTCTTGTAC
OCAA
71
pENTR221
GTACAAAAAAGCAGGCTCCACCATG
TAGGACCCAGCTTTCTTGTAC
OCAA
72
pENTR221
GTACAAAAAAGCAGGCTCCACCATG
TAGGACCCAGCTTTCTTGTAC
OCAA
73
pENTR221
GTACAAAAAAGCAGGCTCCACCATG
TAGGACCCAGCTTTCTTGTAC
OCAA
74
pENTR221
GTACAAAAAAGCAGGCTCCACCATG
TAGGACCCAGCTTTCTTGTAC
OCAA
75
pENTR221
GTACAAAAAAGCAGGCTCCACCATG
TAGGACCCAGCTTTCTTGTAC
OCAA
76
pENTR221
GTACAAAAAAGCAGGCTCCACCATG
TAGGACCCAGCTTTCTTGTAC
OCAA
77
pENTR221
GTACAAAAAAGCAGGCTCCACCATG
TAGGACCCAGCTTTCTTGTAC
OCAA
78
pENTR221
GTACAAAAAAGCAGGCTCCACCATG
TAGGACCCAGCTTTCTTGTAC
OCAA
79
pENTR221
GTACAAAAAAGCAGGCTCCACCATG
TAGGACCCAGCTTTCTTGTAC
OCAA
80
pENTR221
GTACAAAAAAGCAGGCTCCACCATG
TAGGACCCAGCTTTCTTGTAC
OCAA
81
pENTR221
GTACAAAAAAGCAGGCTCCACCATG
TAGGACCCAGCTTTCTTGTAC
OCAA
82
pENTR221
GTACAAAAAAGCAGGCTCCACCATG
TAGGACCCAGCTTTCTTGTAC
OCAA
83
pENTR221
GTACAAAAAAGCAGGCTCCACCATG
TAGGACCCAGCTTTCTTGTAC
OCAA
84
pENTR221
GTACAAAAAAGCAGGCTCCACCATG
TAGGACCCAGCTTTCTTGTAC
OCAA
85
pENTR221
GTACAAAAAAGCAGGCTCCACCATG
TAGGACCCAGCTTTCTTGTAC
OCAA
86
pENTR221
GTACAAAAAAGCAGGCTCCACCATG
TAGGACCCAGCTTTCTTGTAC
OCAA
87
pENTR221
GTACAAAAAAGCAGGCTCCACCATG
TAGGACCCAGCTTTCTTGTAC
OCAA
88
pENTR221
GTACAAAAAAGCAGGCTCCACCATG
TAGGACCCAGCTTTCTTGTAC
OCAA
89
pENTR221
GTACAAAAAAGCAGGCTCCACCATG
TAGGACCCAGCTTTCTTGTAC
OCAA
90
pENTR221
GTACAAAAAAGCAGGCTCCACCATG
TAGGACCCAGCTTTCTTGTAC
OCAA
91
pENTR221
GTACAAAAAAGCAGGCTCCACCATG
TAGGACCCAGCTTTCTTGTAC
OCAA
92
pENTR221
GTACAAAAAAGCAGGCTCCACCATG
TAGGACCCAGCTTTCTTGTAC
OCAA
93
pENTR221
GTACAAAAAAGCAGGCTCCACCATG
TAGGACCCAGCTTTCTTGTAC
OCAA
94
pENTR221
GTACAAAAAAGCAGGCTCCACCATG
TAGGACCCAGCTTTCTTGTAC
OCAA
95
pENTR221
GTACAAAAAAGCAGGCTCCACCATG
TAGGACCCAGCTTTCTTGTAC
OCAA
96
pENTR221
GTACAAAAAAGCAGGCTCCACCATG
TAGGACCCAGCTTTCTTGTAC
OCAA
97
pENTR221
GTACAAAAAAGCAGGCTCCACCATG
TAGGACCCAGCTTTCTTGTAC
OCAA
98
pENTR221
gtacaaaaaagcaggctCCACC
TGGATCCacccagctttcttgtaca
OCAA
99
pENTR221
gtacaaaaaagcaggctCCACC
TGAATCCacccagctttcttgtaca
OCAA
100
pENTR221
gtacaaaaaagcaggctCCACC
TAGCTTGacccagctttcttgtaca
OCAA
100
pENTR221
GTACAAAAAAGCAGGCTCCACC
TAGCTTCCAGCTTTCTTGTACA
OCAA
101
pENTR221
gtacaaaaaagcaggctCCACC
AAGCTTGacccagctttcttgtaca
OCAA
101
pENTR221
GTACAAAAAAGCAGGCTCCACC
AAGCTTCCAGCTTTCTTGTACA
OCAA
102
pENTR221
gtacaaaaaagcaggctCCACC
TGGATCCacccagctttcttgtaca
OCAA
103
pENTR221
gtacaaaaaagcaggctCCACC
TGAATCCacccagctttcttgtaca
OCAA
104
pENTR221
gtacaaaaaagcaggctCCACC
TGGATCCacccagctttcttgtaca
OCAA
105
pENTR221
gtacaaaaaagcaggctCCACC
TGAATCCacccagctttcttgtaca
OCAA
106
pENTR221
gtacaaaaaagcaggctCCACC
TGGATCCacccagctttcttgtaca
OCAA
107
pENTR221
gtacaaaaaagcaggctCCACC
TGAATCCacccagctttcttgtaca
OCAA
108
pENTR221
gtacaaaaaagcaggctCCACC
TGGATCCacccagctttcttgtaca
OCAA
109
pENTR221
gtacaaaaaagcaggctCCACC
TGAATCCacccagctttcttgtaca
OCAA
110
pENTR221
gtacaaaaaagcaggctCCACC
TGGATCCacccagctttcttgtaca
OCAA
111
pENTR221
gtacaaaaaagcaggctCCACC
TGAATCCacccagctttcttgtaca
OCAA
112
pENTR221
gtacaaaaaagcaggctCCACC
TGGATCCacccagctttcttgtaca
OCAA
113
pENTR221
gtacaaaaaagcaggctCCACC
TGAATCCacccagctttcttgtaca
OCAA
114
pENTR221
gtacaaaaaagcaggctCCACC
TGGATCCacccagctttcttgtaca
OCAA
115
pENTR221
gtacaaaaaagcaggctCCACC
TGGATCCacccagctttcttgtaca
OCAA
116
pENTR221
gtacaaaaaagcaggctCCACC
TGAATCCacccagctttcttgtaca
OCAA
117
pENTR221
gtacaaaaaagcaggctCCACC
TGGATCCacccagctttcttgtaca