C.elegans database

C.elegans Database

  

"The final column in this database, headed ""Source BioScience LifeSciences_Location"" will identify the"                     
"chromosome number, plate number and well position for each clone in the"                       
384-well plates supplied by Source BioScience LifeSciences Ltd.   
                   
                        
Example: Gene Name F56C11.3
                       
                        
is found in Source BioScience LifeSciences_Location I-1A09
                       
                        
"I-1A09 defines chromosome 1 (I-), plate 1, well A9 (A09)"
                       


Plate Well Chrom GenePairs Name Fwd Primer Seq Rev Primer Seq Source BioScience LifeSciences_Location
1   A01 I   K10E9.1 CATGGAAGCCCTACGGAATA    TGATGATCTCGTGAAGCTCG    I-1A01
1   A03 I   F56C11.1    TAAAGCAACTGGAAATGGGC    CTTCGAATTCACCGCATTTT    I-1A05
1   A04 I   F56C11.2    AAGCACTCGGCATTTCCTAA    AACGCATACATCCCAAGGAG    I-1A07
1   A05 I   F56C11.3    TTTGGGCTTTAAAAATCAAGACA ATCACATCTCGACACTCGAACTT I-1A09
1   A06 I   F56C11.5    TAAAAATCGGTGGCCTGAAC    ACCCCCTCAATTTATTTCCG    I-1A11
1   A07 I   F56C11.6    TCGTAGACCATCTGCAGCAC    AGGCTTCGCTGTTCACTCAT    I-1A13
1   A08 I   F53G12.1    AAATCGTGTCGACAAACAAAGTT ATGTTAAGAGCGAATCATTTGGA I-1A15
1   A09 I   F53G12.2    CTTCACACCGTTGGACATTG    GGTCTTCCACGTTCTTGAGC    I-1A17
1   A10 I   F53G12.3    ATCATCACCAACGGGTGTTT    GACTCGCGTGTGAATGAGAA    I-1A19
1   A11 I   F53G12.4    TGCGTTTTTCACGTTCAGAG    ACGTGTCACCCATAGCATGA    I-1A21
1   A12 I   F53G12.5    AAGATGAATTTGGAACTCGTTGA TGTGATCTATGCCTCAATGACAC I-1A23
1   B01 I   F53G12.6    TGCTTTGCTCGAAAATGTTG    GAACGGCAGTAGCCTCTCAC    I-1C01
1   B02 I   F53G12.7    GCTTTCGAGGAGAGGGATCT    AAACAATGAAGATGGCTCGG    I-1C03
1   B03 I   F53G12.8    CGTGTATTCAGCTCGACCAA    GAAGCAATGTTGGAGGCATT    I-1C05
1   B04 I   F53G12.9    TGTGAAATATCGACTTTCTTGCC TCATACCTTCCTTCCGGATAAAT I-1C07
1   B05 I   F53G12.10   CCGGAAGGAAGGTATGAACA    TGCGTGTGAAACCCATAAAA    I-1C09
1   B06 I   F53G12.11   AACTCTTGAGGGAATAGACGACC TCACCACAAATAAAACCAATTCC I-1C11
1   B07 I   C53D5.a TACAAACAAGGAAGATTCTCGGA GGAAACAAGGAAAAGAACGAGAT I-1C13
1   B08 I   C53D5.b GGTTTCAACAACTGTCTCCACTC TGTGGAATATTCAAATTTTTGGG I-1C15
1   B10 I   C53D5.d TTGATTAGAGCCAACGGAAGATA TAAAAACGAATAAGCGATTTGGA I-1C19
1   B11 I   C53D5.e TTTGTAAAGCTCTTCCACGAAGT AGTAACCCTACAGCAAATCCACA I-1C21
1   B12 I   C53D5.f TCCCCGTCAACTATGATAGAGAA ATTTGAATTCCGTGGTATACGTG I-1C23
1   C01 I   C53D5.g TTTTGCTGAAAATTTCTGTCCAT CAGAAGCTGATAAGGTTAACGGA I-1E01
1   C03 I   C53D5.i CACAGTTGAACACGTTGATCATT GGAAACAAGGAAAAGAACGAGAT I-1E05
1   C04 I   R119.1  CATGCGCCTTGAATACCTTT    TGTGGAATGCTTTTGCATGT    I-1E07
1   C05 I   R119.2  CAATTTTCAAGTTTTCCTTGCAG TTCTCAATTCTTTCGGTATTCCA I-1E09
1   C06 I   R119.3  CCTCCCTCTCCCCTCTAAATAAT TCGACATAAGAAGCAACATCAGA I-1E11
1   C07 I   R119.4  GATGTACACAAGCACAAGCTGAG ATTATTTAGAGGGGAGAGGGAGG I-1E13
1   C08 I   R119.5  ACAAGGAAAAACACATGACTGCT TTCAAATTTCTTACGGTCTTGGA I-1E15
1   C09 I   R119.6  CGAAAAATGACACCCTTGGT    AATCCGAATCAAATACCCCC    I-1E17
1   C10 I   R119.7  AAAACTGTTGTGGGGACAGC    ACGTCGAGAAGGTCATCGTT    I-1E19
1   C11 I   C07F11.d    CTCCAATTTCAATTTTCAGAACG TTAAAGGAGACCTACATCGTGGA I-1E21
1   C12 I   W04C9.1 AAAACCACCAAACCCAACAA    TGTTCCGAAGATTTTGGAGG    I-1E23
1   D01 I   W04C9.2 CAAAACTCGGAATTAAAGTTGGA TCTAACGAAGGAATACACGAGGA I-1G01
1   D02 I   W04C9.3 TGGTGCTTGTTATCATCAGAATG AAAACCAAATGTATTTGTCCGTG I-1G03
1   D03 I   W04C9.4 GTACTCCTCTCGGGTGAAAGAAT CTGAATTTTTCGATATTTGTCGC I-1G05
1   D04 I   W04C9.5 GAGCTCAGAAATGTTCATCGAGT AATTCTTGAAGCGCTGTAACTTG I-1G07
1   D06 I   F56A6.1 CCAGAGTCTCTCGAACTATGGAA CTTTGAGAGTTGTGCTGAAACCT I-1G11
1   D07 I   F56A6.2 ACAGCATGAACCTTCCGAAC    GTCGTGGATTGCTCCATTTT    I-1G13
1   D08 I   F56A6.3 TCCGAACTTTGATGTTCAAGTCT CTCCTGTAAGACGGCAAGAGATA I-1G15
1   D10 I   T06A4.1 TAGTGTGACTTACCCACGTGATG TATCAACCACATTTGGGAGTAGG I-1G19
1   D11 I   T06A4.2 CGAAAGAAATGAGGTTGATTTTG CAAATTTTTGGTATTTTCCGTGA I-1G21
1   D12 I   T06A4.3 ATTTTCTGGATCGATGGAGGTAT AACCCATCCCAGTCTGAAATTAT I-1G23
1   E01 I   Y73A3A.1    ACCACCAATGATGCCAGATT    GGAAAAGGGCGACACAATAA    I-1I01
1   E02 I   ZC123.1 ACAGCCGGAAGACTCTACGA    TGAAATGACCACGCCAATAA    I-1I03
1   E03 I   ZC123.2 CAGCAATTTTTCGACAAGCA    GTCGCGAACGTCTTATCACA    I-1I05
1   E04 I   ZC123.3 AATCGACTTGGACATCTACGAAA GATGATGTACTAGGTGTGCTCCC I-1I07
1   E05 I   ZC123.4 GATGAACGACAACTCCCGAT    CTGAAACCATGTCAACCGTG    I-1I09
1   E06 I   Y95B8A_79.a AAATGTAGTTGTCCGTGTGGAGT AGTCTTCTCATCAGTCTCATCCG I-1I11
1   E10 I   Y95B8A_84.b GAAATTAAATACGGATGCTGCTG TCTGCAAGAATGTGATCTCTGAA I-1I19
1   E11 I   Y95B8A_84.c CAATTTTCACACAAAAACTGCAA ATAAAATTCGGCCACCAACTTAT I-1I21
1   E12 I   Y95B8A_84.d AAATTGAGCATTTCTAGTTGGCA GCATGAGATTTTTAGACACCTGG I-1I23
1   F02 I   Y95B8A_84.f TCATTGTAAAGTATTGCAAGCGA ATAAAATTCGGCCACCAACTTAT I-1K03
1   F03 I   Y95B8A_84.g GAGCCTGTTGTCATCTGACTTCT TGAAAATTGAGGTTCTAGGGTCA I-1K05
1   F04 I   Y95B8A_84.h TTACAGGGGATTTTCAGGATTTT GGAGAAGAGGGTGAAAAGAGTGT I-1K07
1   F05 I   Y95B8A_84.i CTCTCAATTCTTCTCTGCCTCCT GCCCTTTGATTTTAGCTTTGAAT I-1K09
1   F06 I   Y95B8A_84.j CTACAAACCTCCCTTCTGCCTAT TCGCTCATAAATAGGTGACCAGT I-1K11
1   F07 I   Y95B8A_85.a CGCAAACCTACAAAATGATCTTC AATCATCTTTCTTTTCCAGGAGG I-1K13
1   F09 I   Y95B8A_85.c ACTGATGACGTAAACGCAAATCT TGCCAAATACCTGTGACTTACCT I-1K17
1   F11 I   Y95B8A_85.e TCGAGACGTTAGATTGCTTCTTC AATGTGCCCATTATTTATGTTCG I-1K21
1   G02 I   Y95B8A_85.h TTTAATTGTCCGTGTGGAGTACA AATTAATCTCAAAAATGGAGCCC I-1M03
1   G03 I   Y34D9B.a    AGAGAAAACTCGGCCACTATGTT ACGACGGTAATGATCGAGTAGAA I-1M05
1   G04 I   F54A5.1 TAAAGTTGGCTAAAGGGAAAAGG TGAAAGAATTGAGGTTTTCGTGT I-1M07
1   G05 I   F54A5.2 CAACACGTGATAAATTGCAAAAA TTTTTGGGCATTATTTGCTTAGA I-1M09
1   G08 I   C54G6.2 TTCACTTTCAGGTAATCCTTCCA CCAGAACCCTGTGTTAAACTTTG I-1M15
1   G10 I   C54G6.4 ATGGATAAGAAAGGTGTTGGGTT TGAAAGAATTGAGGTTTTCGTGT I-1M19
1   G11 I   R06A10.1    CTCCGAAACACGAATTTAGTGAC TAGAAATTGGGCAAACTGGTAGA I-1M21
1   G12 I   R06A10.2    TGAATTTTACTGACAGAGCAGCA CGTCGTTTCTCAATTCAATTTTC I-1M23
1   H01 I   R06A10.3    TTACATTTTTGCATTTTCTGGCT TTGCTCCAAACAATTACAGGAGT I-1O01
1   H03 I   ZK993.a ACGATGTTTAACGGAAAACTGAA TGTGTCAATTGAGAATGAGGTTG I-1O05
1   H05 I   ZK993.c ACGATGTTTAACGGAAAACTGAA TCAAAACCACCAAAAAGCTTAAA I-1O09
1   H06 I   K12C11.1    GATTGTGGAGGATATATGGGTGA CAAATAAACTCTTCGTTTTCGGA I-1O11
1   H07 I   K12C11.2    GAGAAACCGAGTATCTCAGTGGA GCGATGCGTTTAATTAAGTTTTG I-1O13
1   H09 I   K12C11.4    CGTATCCCTTTCCTTTTCCTTTA AGCCCTAACCACATCCATATTTT I-1O17
1   H10 I   F37F2.1 GTGCAATACGCATTGTCAGAATA TCATTCTTCGTCACAAAAACCTT I-1O19
1   H11 I   F37F2.2 CAAACAATCGATGAAAAGTTGGT TGTCTGAAAATCTCCAATTTCGT I-1O21
1   H12 I   F37F2.3 GACTGGTGTTTTCATAATCGCTC TTTTGTCATCATATTTCACTGCG I-1O23
2   A01 I   F47G6.1 AACTTTCAAACAGTGCATCCCTA TATCTATAGAGCGCGTTAGCCAC I-1A02
2   A02 I   F47G6.2 AAAGAAATTCTGGAAGTTTTGGC CAGTTTATCAGGGACCAACTCAG I-1A04
2   A03 I   F47G6.3 AGAGGACTCGACTCAACAAAGTG GCTGTCATACTGGATCAATGTCA I-1A06
2   A04 I   F47G6.4 GAGTTTGAGGAGAACGCGAG    AGGCACAAAAACGCCTACAC    I-1A08
2   A05 I   M01D7.1 ACAGCTCGAGGAGGTGTTGT    AGCGTGCGACAAAGAAAGAT    I-1A10
2   A07 I   M01D7.3 TCATCATTATCGCCGATTCA    ATCCAACAGCAGGACAAACC    I-1A14
2   A09 I   M01D7.5 AAATAGTTATTAATTGCCGGCGT TCCAGAAGCTAACCAAAATGGTA I-1A18
2   A10 I   M01D7.6 ATGGGGTGAAAGGATTTAAAGAA TTTAAGTAGAAAATCGCCCTTCC I-1A20
2   A11 I   M01D7.7 GTTTAGGTGGTGGTGTCTCACTC TTCCAGTCTATGATACGAGCGAT I-1A22
2   A12 I   C53H9.2 CAGTTGGAATGACGGTTCCT    CTTTCGAGCGAAATCCTGAC    I-1A24
2   B01 I   F12B6.1 AGAAACCCGATCTCCTCGAT    TTTCCCTGACATCCAGGTTC    I-1C02
2   B02 I   F12B6.2 CATACGACGAAATGAATGCG    ATCTTTGGATGCTCCACGAC    I-1C04
2   B04 I   W03F11.1    CGAGCTATCACCAAAATTCATTC CACTTCTTAACCTCATTTGGTGG I-1C08
2   B05 I   W03F11.2    CCGACCCCTGATTCAAACTA    TCTAGGTCAAAAGCGGAGGA    I-1C10
2   B06 I   W03F11.3    ATTCGAACTCCGTTTTCTTTTCT AATCAATCAAATCGCAATTTTTG I-1C12
2   B07 I   W03F11.4    ACCGCAAGCTTCAAGAGTGT    CTCAGAACTCAGGGCCTTTG    I-1C14
2   B08 I   W03F11.5    TGTGCTTTGTCATGATATTTTGG CCACGTGGAATCTACCACTTTAG I-1C16
2   B09 I   W03F11.6    GTGGCCAAAGAAAATGGAAA    GACGCTGATGTTCGGAATTT    I-1C18
2   B10 I   F23C8.1 CTGCACAAAATGTACCAATACGA GCAAATTAACATTCAAAGTTCGC I-1C20
2   B11 I   F23C8.3 AGAAAATTTGAATGAAAAACGCA TCTTAGTGTGGGCTAATCGGATA I-1C22
2   B12 I   F23C8.4 AAATCCCAAAATTCTTCTGGAAA AAACTCACTGAGAACTTTGAGCG I-1C24
2   C01 I   F23C8.5 CCTGCATCACATAAAACATTGAA CAATCAACGGAAAATCGATTAAA I-1E02
2   C02 I   F23C8.6 AAAATGAAACCGTCAGCAGAATA TTTATGACGTAAAGTCCGCAGAT I-1E04
2   C03 I   F23C8.7 GAACAAATCAAAGATCACTTCGG GCGAGTACGGTAACTGAGAAAAA I-1E06
2   C04 I   F23C8.8 AAACCATACAGTACCCCGTACCT TGCTCCCTCAGAAAAACTTTACA I-1E08
2   C05 I   F23C8.9 ACCAATCGTTATTCATATCACCG AAAAATGGACGAAATGGAAGATT I-1E10
2   C06 I   F23C8.11    TTGGTCTGTATGTGTAGCACCAG ATCAGGAAGAGATCGTGGAATCT I-1E12
2   C07 I   F23C8.12    AGATTCCACGATCTCTTCCTGAT AATCACGCTGGAGATATGATTGT I-1E14
2   C08 I   T16H5.1 AATTCAAATTTTCACGTGGTGAC GTCAAGACCGTCAAATGTTCTTC I-1E16
2   C10 I   C55C2.2 GGTGCAACTCTACATTTAAACCG AACATTTCCAAACTCGAGGTACA I-1E20
2   C12 I   C55C2.4 AGTTATCAGTAGGGTTTCAGGGC AGTTTACATCCATGTTGTTTCCG I-1E24
2   D01 I   C55C2.5 GGATTTCTAGGCCACTTGAGATT AACTCCTCCACTATAGCCTGTCC I-1G02
2   D02 I   K07A3.a AAATACCCGGTAAGCGTCATAAT TCATTTGTGTGGTTCTCACTTTG I-1G04
2   D03 I   K07A3.b TCTCCTCGATTTGTGGAAAATTA GAACCATCTTCGGAATCTACAAA I-1G06
2   D04 I   K07A3.c TGCATATTCCCTATTCCAGAGAA GCAAAATTGAAAATTGAAACTGC I-1G08
2   D06 I   Y23H5A.2    GAGAAGATTTTCTGCGGAATTTT GGTATCCCTCTCTGACGACTTTT I-1G12
2   D07 I   Y23H5A.3    TCTCGGCCTGTTTCTTCAGT    TGGGGCACATTTAAGAGGAG    I-1G14
2   D08 I   Y23H5A.4    ACAGCGAAGCAAGCAATTTT    CGAGACCTCACCTTCAAAGC    I-1G16
2   D09 I   Y23H5A.5    AGTTTTTAAAGTTCTAGGCCCCC AATCAGCTCTATCGATTTTTCCC I-1G18
2   D10 I   Y23H5A.6    ATATCTCAATCACAGACGCCCTA CTTCTCTAATTACACCCTGGCCT I-1G20
2   D11 I   Y23H5A.7    GTCGTTTTACCTCCGTTCCA    CGGTGATTTCTGGCAATTTT    I-1G22
2   D12 I   F40E3.2 ATTTTTGGATTGTTCGCTGC    TTGGATCCGTCCTACTGTCC    I-1G24
2   E01 I   F40E3.3 CTAAACAGTTTCCGTTGATTTGG TACGATCTCGGAAATGAAAAAGA I-1I02
2   E02 I   F40E3.5 TACGGAAGGAAAATTCACGG    ATGGTGGAAACGGTAATGGA    I-1I04
2   E04 I   F32B5.1 CTTTGCGCACAAAATAGGGT    CTTCTCAATTCCGCGAACTC    I-1I08
2   E05 I   F32B5.2 AATTTCAGTTCTTCTCCTACCCG AATCGAGAGCATCGACTACTTTG I-1I10
2   E06 I   F32B5.3 ATATTGCCGCGAGCTTTCTA    TGAGCTCAGCCTTTCTGTGA    I-1I12
2   E07 I   F32B5.4 TTGATCAAAATGTTCTTCTCCGT AAATTTGAAAACGAATCAGCAAA I-1I14
2   E08 I   F32B5.6 ACCAATGAGACCTTGTTCGC    CTGTTACGACTGCTCCGACA    I-1I16
2   E09 I   F32B5.7 CAAATGAGCCATTGAGAGCA    TGACGGCCGCTATTAAATTC    I-1I18
2   E10 I   F32B5.8 GCCTGGTAGTTATTGCATGTCTC AAAATTCAAATTGTCCGGTTTTT I-1I20
2   E11 I   W03D8.1 TGTTCAAGGCAACAAAGTCG    GCAACTTGACGCAAATCTCA    I-1I22
2   E12 I   W03D8.2 CAGCTCACCGACAAGATGAA    CATATCGCGAAATCCCAAGT    I-1I24
2   F01 I   W03D8.3 CAGTTCATACCGATTTCACAACA GATAAAGAAGGAAATGGAATGGG I-1K02
2   F02 I   W03D8.4 TTATGAAGGAAAATCGAAAAGCA GAAACTAAATGCCGGAGAAGATT I-1K04
2   F03 I   W03D8.5 ATCAATTTCACATGAACCGAATC TCATTTCTCCAAAAAGGACTTGA I-1K06
2   F04 I   W03D8.6 CCATGACAGCAGTTGCACTT    TGCGTGCACTATTAGAACGG    I-1K08
2   F06 I   W03D8.8 ATCATTTAGCGCCATTCACC    GCGGATAGGGAAAACTAGGC    I-1K12
2   F07 I   W03D8.9 CTGTGCAACTCACAAATCCG    TTCGAGAAGAGGAACGAGGA    I-1K14
2   F09 I   W10C8.1 TTTTGATAGCACCAAAACCAACT AAATGGCCTAACTTTCTCACTCC I-1K18
2   F11 I   W10C8.3 ACACAGCGTGTTTTCATCTTTTT AAATTCAAACGTTCCCTCTTCTC I-1K22
2   F12 I   W10C8.4 GAAGAGACTCAAAAGTCTGGCAA TTCTTGACGGAACAAAAGAGTTC I-1K24
2   G01 I   W10C8.5 CTCCTCCAACAGATTCCGAG    GCCGTGTTGAAACTCTGTCA    I-1M02
2   G02 I   M01B12.1    TTAAACAGCGAATCATCGACTTT TTTCCGACACTTCCTGAATAAAA I-1M04
2   G03 I   M01B12.2    TGCATCTTTCCATTCCTTCC    ACTATGGAAGCAAAAGCCGA    I-1M06
2   G04 I   M01B12.3    GAATATCACAGCAAACACAACGA TAAAAGTCCCAAAATGGAGGAGT I-1M08
2   G05 I   M01B12.4    TTCTGAAGGCTCTTGAATCTCTG TTCACAATACTTCCCCTTCTCAA I-1M10
2   G06 I   M01B12.5    TATCATCGTGCTCTTCTCCAAAT GATACCGCCATGGATATTGTAAA I-1M12
2   G07 I   C45E1.1 CATGTTGAACGATCTGAAATCAA ACGAGGTAGAAACTACAATGCCA I-1M14
2   G08 I   C45E1.3 TATAAAAAGTTATGGCGGCTCAA TTTGCAGAAAATGAGTCAAAGGT I-1M16
2   G09 I   C45E1.4 TATAAAAAGTTATGGCGGCTCAA TTTGCAGAAAATGAGTCAAAGGT I-1M18
2   G10 I   K09H9.1 ACTCAAGGAGAAGGGAAAAATTG AACCGGTTTTCTCTTTGAAGAAC I-1M20
2   G11 I   K09H9.2 GGCAAGTGGAAATGAGGAAA    CAGCAAAACCTCGGAAAAAC    I-1M22
2   G12 I   K09H9.3 CAAAGAGAACAACGCAACGA    CAAGGGTCTTGAAGGAGTCG    I-1M24
2   H01 I   K09H9.4 GATCAAGACGTGGAAGGGAA    AAAACTCGGCCATTACGTTG    I-1O02
2   H02 I   K09H9.5 CGTAGGAGTGTTGTAGGATGGAC TATCTGCAAACCCCTAACAAAGA I-1O04
2   H03 I   K09H9.6 ATTCCTGATTCTAAATTAGCGGG AGCAAGAAGTCGAACTACCACAG I-1O06
2   H04 I   K09H9.7 GAGAGCAACCACAAGTTTTTGAC TTTCCACAACTCATCAACTCAGA I-1O08
2   H05 I   Y44E3B.1    GAAATGGAATCTAAAACGAAGCA CGAAAAATTTCAGGACTCACTTG I-1O10
2   H06 I   Y44E3B.2    AAATTGCTGAAAAGAGCTGTACG AGTTGGCCTCGGATAGTATTCAT I-1O12
2   H07 I   W01B11.1    TTTTTAAACAAAGATGCCGGTTA CTTTTTGAAATTTCTTTCCCGTT I-1O14
2   H08 I   W01B11.2    GGCCACCCAAGATAAACTGA    TTCCAATTCTTCCATGAGGC    I-1O16
2   H09 I   W01B11.3    GAGGAGTTCGCGCTCATATC    TCTTCTTGATTGCGTTCGTG    I-1O18
2   H10 I   W01B11.5    CTCTTTTTCTTTTCTTTTGCGCT AACGAACAACGACAATCATCTCT I-1O20
2   H11 I   W01B11.6    CTAACGATCGGAATTTGGTCATA TGGAGCACCAAAACTACTGAAAT I-1O22
2   H12 I   Y44E3A.1    TAACCATTTTTGGGAACTTTTCA CAGCTTGCATTCATTCTTTTTCT I-1O24
3   A02 I   Y44E3A.3    TTCTCTTTTGAAAATTGGGATGA CAGATAACCGAAATGTCTATCGC I-1B03
3   A03 I   Y44E3A.4    GGAAATTTATGAGAAAATTGGGC TACGGAGGATTTTCAAAGTCAAA I-1B05
3   A04 I   Y44E3A.5    TGAATTTTACCGATTTTGGAGTG TACAGCTCAAAACAAGACGATGA I-1B07
3   A05 I   Y44E3A.6    TTTCGATGATTTTCCTCAATACG CCAATTTTTCCAAGTTTCAGATG I-1B09
3   A07 I   W05F2.2 GACCTAAAAACGGGGGAAAA    TCCAATGGAAACGTCACAAA    I-1B13
3   A08 I   W05F2.3 ATGAAGGTTAGGGGCAATAATGT GGGAATTTTTGGATTTTCTTTTG I-1B15
3   A09 I   W05F2.4 CCTCCACACGACTTGGATTT    AAAATTTTTGTGAGCCGGTG    I-1B17
3   A10 I   W05F2.5 GTACGCAACACACAACACACTTT TGGAAGTATTCGTCGACTTCAAT I-1B19
3   A11 I   W05F2.6 CAAAAGAAAATCCAAAAATTCCC CAGAATTTTATGAATAGTCGGCG I-1B21
3   A12 I   W05F2.7 CTATGGCCACTGGGACAACT    AATTCCAGGCATTGGACAAG    I-1B23
3   B01 I   F25F1.1 AAATCAAACCGTTTCAGGAAAAT ATTCTGAAAGTGTTCTGACCCAA I-1D01
3   B02 I   F25F1.2 CCTACCTCCGCACAACATTT    CTTTTGGCGGCTAGCTTATG    I-1D03
3   B03 I   K03E5.1 CGCAAATCATTTCTCAATCCTAC AGACCACAGAATCTGCAATGTTT I-1D05
3   B04 I   K03E5.2 CGATTTTCACATCATCTGTTTCA AATTTTCGTTCTTCGGTTTTCTC I-1D07
3   B05 I   K03E5.3 TTCCCCAGTCGAAACTATACTCA GACACCCTTGAAGAGGAAAGACT I-1D09
3   B06 I   K03E5.5 TGCAACATTTTTGTGTGTACCTC TGAAACTTTTTGGATTTCAAGGA I-1D11
3   B07 I   T28F2.1 ACAGAATCCCAGCGATCAAC    GCTGGAAAATTAGGCGACTG    I-1D13
3   B08 I   T28F2.2 TTCACTTTGACTGCCCATATCTT TTTCAGTTGGTCATTGGAAGAGT I-1D15
3   B10 I   T28F2.4 TTAACAATTTGCGGGTAGGC    ACGTTCAAAGTATTTGGCGG    I-1D19
3   B11 I   T28F2.5 AACTCGGAGCAATTCGAAGA    CCTGGCTTTTCTGCAGTTTC    I-1D21
3   B12 I   T28F2.6 AGCAAGCCCTTGAGAAAACA    GAAGGATTGTTCGGACGTGT    I-1D23
3   C01 I   T28F2.7 GAAACATTGATGCAGCCCTT    TCAGCGGCTGGTTTTTCTAT    I-1F01
3   C02 I   T28F2.8 AATGATGCTTGGTCTCAGATGAT ACTTTCGTCATAACACAAATGGG I-1F03
3   C03 I   D1037.1 TTTTTCAGGTCAAAAAGTTCCAA TCATATTCTTTCCGTTCTCTGGA I-1F05
3   C05 I   D1037.3 TTAAAGACCAAACGGCTTATCAA CTTGATTTTTGCCATTTTCTGAC I-1F09
3   C06 I   D1037.4 GAGAGCGGACACAGAGAAATAGA CTCACTCACTCCAATAAAATGGC I-1F11
3   C07 I   D1037.5 TCACAAGAACATGCAACAAATTC CAATAATGTGTTGGCAAGTGAGA I-1F13
3   C08 I   H26D21.1    ATTGAGTAAGAAAAGATGCTGCG AAAATTAGGCATTCAAACAACGA I-1F15
3   C09 I   H26D21.2    CCCTTTGTTGTTTCGAGAATATG GTTCGCATTGTGATCAGTGAATA I-1F17
3   C12 I   T12F5.1 CACCAACGGCAGGAGATATT    CCCCAGAACGCAATTAAAAA    I-1F23
3   D01 I   T12F5.2 AATCGACAAACACCAGAGCC    ATTGGAGCCAGGATGTGAAG    I-1H01
3   D02 I   T12F5.3 TTTTCAGGATTTGGAGGTGC    GTGTTTCCATTGCCGAAGTT    I-1H03
3   D03 I   T12F5.4 GGGCAAGAAGTTGAGAGTGC    CGAGAACCATCGGAAATTGT    I-1H05
3   D04 I   T12F5.5 AAGTTTGGTGCAGGCCATAC    CGAAAAATCGCGAAAGAAAG    I-1H07
3   D05 I   Y8G1A.1 GCACATGTGTTCTTTCTTCCTTT CCAATTCTTTTCTCGAACTTCCT I-1H09
3   D06 I   Y8G1A.2 TGCTGTCACCTACATTCATTCAC TCATACCGAGCATAGGATGTTCT I-1H11
3   D07 I   ZK770.1 ACAATGGGTGACTGCGTGTA    CTAATTTCCCACAGCCCAAA    I-1H13
3   D08 I   ZK770.3 AATCCCTTTACGGGACAAAAATA ATGCCTACATGCCTACCTCACTA I-1H15
3   D09 I   C32E8.1 GATATTCCATTTTCCTTCGTTCC TAATTGTCACGCATGTTTTTACG I-1H17
3   D10 I   C32E8.2 ATTTTCTCCCGGAAATTGTTTTA ATTTACTTATTCTCCTCAGCGGC I-1H19
3   D11 I   C32E8.3 GTTATGCTTTTCAACTGACGGAC TGTGTACTTGTGTCGATTTACGC I-1H21
3   D12 I   C32E8.4 TGGCCAGTTCTATCAATCAGTTT TAAATGAGAAAGAATGATGGCGT I-1H23
3   E01 I   C32E8.5 ACCCGACGTGATACCAGAAG    TCGTGGAATTGTTTGTAGCG    I-1J01
3   E02 I   C32E8.6 AACAAATCCGCTCCGTATTG    CTCGAAACGCTTCACATCAA    I-1J03
3   E03 I   C32E8.7 CACAAGCCATGGGTTTACATTAT GCGAGAGAGTACTGTAGGGTGAA I-1J05
3   E04 I   C32E8.8 ATGCAACATCCACGTACGAA    CTGACCTCTCGTTTCTTCGG    I-1J07
3   E05 I   C32E8.9 ACAAATGCCAAAGTTCACAGATT GTTGCGAGACCGTAGTAAAAATG I-1J09
3   E06 I   C32E8.10    TCTTAAATTTTGGCGATTTTTCA GACAAGTTGCTCAAAACAATTCC I-1J11
3   E07 I   C32E8.11    AAAATTCTGAAGCGCGAAAA    ATTCTCCTAGCCCCACTGGT    I-1J13
3   E08 I   F53F10.1    TTAGGAACTGCTTGCTCTTTTTG ATTTTCAGACACCGATATGCACT I-1J15
3   E09 I   F53F10.2    TCGTGTGATGCTTCCAAGAG    GAACGGCGTTGTTCATCTTT    I-1J17
3   E11 I   F53F10.4    TTTCAAGTACATTATCATCGGGG AAAATTAACAGCATCCAGATCCA I-1J21
3   E12 I   F53F10.5    ATGTTTGGAGGATCTGCACC    CAGCACCAATGCTGAAAAGA    I-1J23
3   F01 I   T03F1.1 GCCAAGATGAGTGATGAGCA    GTCCTCATGAACGACGGTTT    I-1L01
3   F02 I   T03F1.2 TTGGATCAGCAGTAACAGCG    ATCATATCAACCGCCTGGAG    I-1L03
3   F03 I   T03F1.3 GCTGTTCCAACCATTCAGGT    GGTGGCCTTGACAACTTCAT    I-1L05
3   F04 I   T03F1.4 CTTCGGACTAAAGCCAGCAC    CGGTCATCAAGCAAGAGACA    I-1L07
3   F05 I   T03F1.5 GAGACTTCGGAGTTGGCTTG    ATGTTTCAGGGTTTCGTTGC    I-1L09
3   F06 I   T03F1.6 CTTCCTCGGTCACAGCTTTC    TAGTCGGTTGGGAGGATTTG    I-1L11
3   F08 I   T03F1.8 CCTACCACAACCAGAAGACACTC TCAACAGTTTCGGTACATTCAGA I-1L15
3   F09 I   T03F1.9 ACTCGATTCACAGAATCAACGAT GAGGAGAGAGAGTCAACACTCCA I-1L17
3   F10 I   T03F1.10    TGTTACGGTAGGCTGGAACC    CCCCTTAACGTTTTCCCATT    I-1L19
3   F11 I   T03F1.11    CTTGGGGTGAGCTTTATCTTTTT ACCAAAACACAGACCTTCTTTCA I-1L21
3   F12 I   C50F2.1 TGCAGCTTTACGCATGATTC    CAATGCGAGGATGATGTACG    I-1L23
3   G01 I   C50F2.2 GAATTCGGCAATTTGGAAGA    TGTCTTTGGAGGAGAAGCGT    I-1N01
3   G02 I   C50F2.3 AATGGCCGACAAAGAAAATG    TTCTTCTTCCGGATCACCAC    I-1N03
3   G03 I   C50F2.4 AATTGTAGGTTTCAGATAGGCCC ACTGCTCCTCCTTCATATTTTCC I-1N05
3   G04 I   C50F2.5 CAGTTTACGGTTGCCGAACT    TTAGAGATAATCGGCGCGTT    I-1N07
3   G05 I   C50F2.6 ATCCGAAGTCTGATGGGATG    CTTCTCGTCTTGGCTTCACC    I-1N09
3   G06 I   C50F2.7 CAGCAAATTTATGAGCTTCAACC CTCACAACATATCCAGCAAATCA I-1N11
3   G07 I   C50F2.8 CGGAAGATATTCGGCAAAAA    AACCTTGCATGTCGGACTTC    I-1N13
3   G08 I   T20F5.1 TTATTCGATGAAACGGTAGGAGA CTCTCTCTTAGAATAGGCCGGAG I-1N15
3   G09 I   T20F5.2 TTGTTTTCATGCCTTTTCAAGAT GAAAACTGGGAGAAAAGTCACAA I-1N17
3   G10 I   T20F5.3 ATTAAACGACTTGTTTCAGCAGC TTAGCAGTAATTCGATTAGCCCA I-1N19
3   G11 I   T20F5.4 CAGTTTGGGCGATCGTATTT    GAACCTTCGCTCACGTCTTC    I-1N21
3   G12 I   T20F5.5 GGTGGTGGAGTAGTGATAACGAG AATATGTGCCTTTTGATTCTGGA I-1N23
3   H01 I   T20F5.6 TAACCTCCTTCCACCACAGG    TTCCGAAGACTTGGAGCAGT    I-1P01
3   H02 I   T20F5.7 CTCCAAATCCATTCTTCGGA    TGGTCCCAACCCTGATCTAC    I-1P03
3   H03 I   T21E3.1 ATTAATTTTCCAGGTATGGCGTT TCACGAAGTAGGTATTCAGCCAT I-1P05
3   H04 I   T21E3.2 GTAACAAATATATCGGCGCTTTG CTCCTTTCCAAGATAACGGAGTT I-1P07
3   H05 I   T21E3.3 GGACATCCTTTCTCATCGGA    TACGGGAACAAATCGGAAAG    I-1P09
3   H06 I   F47B3.1 GCGTCCAAAAGACCCTGATA    CAACACAACTCGCAAAAGGA    I-1P11
3   H07 I   F47B3.2 TGTACAATTTGTGTTCAATTGGC TAAATAAATTTCAAAAAGGCGCA I-1P13
3   H08 I   F47B3.3 TGAATACATCAGAACATTGGGTG ATTAATGCACCTCCAGGAAAAAT I-1P15
3   H09 I   F47B3.4 CAGTTAAAATGGCCCTCGAA    ACCGCATAACCCTGTTTCAG    I-1P17
3   H10 I   F47B3.5 TTTCTCTGCATCCTTCTTCTCAC GTTCGAAGCTCAAATCTTGGTTA I-1P19
3   H11 I   F47B3.6 CAACACAACTCGCAAAAGGA    GCGTCCAAAAGACCCTGATA    I-1P21
3   H12 I   F47B3.7 AAAATGATTGCCAGATTCCG    ACTATCGTGACACCCTTGCC    I-1P23
4   A01 I   F47B3.8 TTCCATTTGCATCCTCATCA    AACACAAAATGTTCCGCCTC    I-1B02
4   A02 I   F28H1.1 GAAATTCTTGCATTATTTGGCTG GCCGTTTGTGTATAGTAACCGAG I-1B04
4   A03 I   F28H1.2 TCGGGAGAAAAACACTGAAAATA CATTTTTGGAATTCTTGAGTTGG I-1B06
4   A04 I   F28H1.3 CACATCGATTGTGGTCTTGG    GAGGACATGAGTTCCGGTGT    I-1B08
4   A05 I   F28H1.4 ATTAATGCACCTCCAGGAAAAAT ACGAATCATAGAGTCATCCTCCA I-1B10
4   A06 I   F28H1.5 TGGAGCAAAATTCAAAGGTAAAA TTTTTCTCCTGACTGGTATGGAA I-1B12
4   A07 I   F55C7.2 TCAAAAAGTTCCTTTTCCAAACA ATTCTGCTTCACTGAACTTGGAG I-1B14
4   A08 I   F55C7.3 TCACATTTCCGTTCCATCAA    TGAAGAAAGCCGACGGTACT    I-1B16
4   A09 I   F55C7.4 GCTCATTTTGCGATTCCATT    AGGACATGAACGAGGATTCG    I-1B18
4   A10 I   F55C7.7 CTTTGGTTCACCGTCGATCT    TCTCCACGACGAACTCTCCT    I-1B20
4   A11 I   C09D1.1 ACGTCTTCAATCACATGCCA    CAATATCCCATCCACGGAAC    I-1B22
4   A12 I   C09D1.2 ATTGATCCATTTACCCCTCTTGT ATTGTCCAAAAGTGAGTTGCATT I-1B24
4   B01 I   C24G7.1 GAATCCAATTCCCCCAGATT    AAACGCAATTTCCAGTGAGG    I-1D02
4   B02 I   C24G7.2 CACCTTCCTTTGTCCCAAAA    CGGGGAAACTGTGAACTCAT    I-1D04
4   B03 I   C24G7.3 TATCAATTTTGGTGTTTATGGGC TGTTTTCAATTGCAGGAAGTTTT I-1D06
4   B04 I   C24G7.4 TATGGAATGCCAAAGCACAA    TTGTTTTGAAGCGAAAACCC    I-1D08
4   B05 I   C24G7.5 ATTTCCAAACGGCTCCTTCT    TGAGACCACCGATCTGAACA    I-1D10
4   B06 I   H31G24.c    ACAGGATTATACAAAGGTTGCGA AACGATTAGCGTGGAAAATGATA I-1D12
4   B07 I   H31G24.d    TCTCGTATTCACGCCTCATTATT TTTACTCTCCCATCCGTTGACTA I-1D14
4   B08 I   E01A2.b CTACCACTATGGTGCATCAAACA TGACAACGTTTTTCCTAATCGAC I-1D16
4   B10 I   E01A2.d TGAACGGCTTCTACTTCGACTAC GAGCAGAAAATGCAGAAAATCAC I-1D20
4   B11 I   E01A2.f TCTTCTTTTTGGCTTCAACTGAG GCAGAAAATGAAAAGAAACGAGA I-1D22
4   B12 I   E01A2.g CAATGCAATATTTCCATTCAGGT TATTTTTGACACACATTCATCCG I-1D24
4   C01 I   E01A2.h ATCCCGTAAGTCGTTCTGGTAAT TTGAGAAGGGGGAAATAAATAGC I-1F02
4   C02 I   E01A2.i TAGCACGAAAGAAAGTTACCGAG GGAATCAAAAAGACGGAGAGATT I-1F04
4   C04 I   R12E2.2 CGGTTGCGGTGAGTTTTTAT    AACCTCTTCCGATGGCTTTT    I-1F08
4   C05 I   R12E2.3 TAAGGTTAGCATACCTGAGCGAG AGGGGTTGATGATTTACTGTCCT I-1F10
4   C06 I   R12E2.4 GGTGGGTTAATTTGTGTGGC    TGTCAGGCTGTCCCAATACA    I-1F12
4   C07 I   R12E2.5 ACCACTTCCATTCTCATCGC    TCGAAATGGCCTAAAAATGC    I-1F14
4   C08 I   R12E2.6 ATCACGAAAAAGCATAACGAAAA GGAAATGAGATTGTTCCCTTCTT I-1F16
4   C09 I   R12E2.7 TGTTGGCAAAGCAGACATAGTTA GCCCATTCAAAATACAACAGGTA I-1F18
4   C11 I   R12E2.9 TCCATGTCCACCGTCAGTTA    TTGCTCTTTCTGCATTGGTG    I-1F22
4   C12 I   R12E2.10    CAATGTTCCACGTGACGTTC    AAATCATCAATCGCCAGGAG    I-1F24
4   D01 I   R12E2.11    TTCTTGTTTTATGTGATGCGATG CAAATCACGTACCTGGTTCATCT I-1H02
4   D02 I   R12E2.12    CGAAAAGATAGCCTCGTTTGATA TTTGGAAAAATAGCTTGTGCTGT I-1H04
4   D03 I   R12E2.13    GGTAAATATCACGAAGAAAGGCA CGTTGATTTAATTTTTGCAGGAG I-1H06
4   D04 I   R12E2.14    CCTAACCTTGGGTATAAAATGGC TCTTCGAGCTGATTACTTTCCAG I-1H08
4   D05 I   R12E2.15    GGTGCAAGTCTAAAAGGGAAAAT GAACTTTTGATACACCAAGCTGC I-1H10
4   D06 I   C18E3.1 AAACGCCAAGAATCATCGTC    CAGAAGGGTCCCAATTCAAA    I-1H12
4   D08 I   C18E3.3 AAGAGCCTCGTCCAATCTCA    TCAATTTGGAGCATCAGTGC    I-1H16
4   D09 I   C18E3.4 TTCCAACTACTAATTTGCTCCCA CTTCCAGCAGAGAGAACTGAAAA I-1H18
4   D10 I   C18E3.5 TCATTCAGATCTTCCTGTGGAAT TGGAAAGCAAAAAGTTTCCATTA I-1H20
4   D11 I   C18E3.6 CAAAATGTCATTCTTTTTCTGGC ATGGAAAACAGGAAATCCGTAAT I-1H22
4   D12 I   C18E3.7 CGTTCAGAGGTTTCAGCACA    CTGGATTTCCACCAACTCGT    I-1H24
4   E02 I   C18E3.9 TGTTGTCGGAGGGATAAAGG    ATTATGAGCAGTCCCAACGG    I-1J04
4   E03 I   C43E11.1    CCAAGGAAGGGAAGAACTCC    TCTTTGGGTTACCATCTGGC    I-1J06
4   E04 I   C43E11.2    AGTGCCCATTCGAGATTCTG    GCTTCTTTCACAGTTTCCGC    I-1J08
4   E05 I   C43E11.3    GCCGATCCTCCAGTATCAAA    TCCACACACGACATCGAAAT    I-1J10
4   E06 I   C43E11.4    TCCAGTTATTCGAGGTTCCG    CGACTCTCCCCGACATTTTA    I-1J12
4   E07 I   C43E11.5    GAGCTGAGTACATCATTGTGCAG GAGTTCATTCAGTTTACGGTTGC I-1J14
4   E08 I   C43E11.6    CTCAAATGCCACAGCTACCA    CACCTTGGTGCCTACGAAAT    I-1J16
4   E09 I   C43E11.7    TCACGTGAGAGAGTGTGAGAGAA CACAGCCTTATTCTTGGCTTAAA I-1J18
4   E10 I   C43E11.8    TGCGATGATTTCTGTGCTTC    AAATTCCAAAAATTGCGTGG    I-1J20
4   E11 I   C43E11.9    TTTGAAAGGAAGACCAACAAAAA TCTTACTTTGGCATTTCCCTGTA I-1J22
4   E12 I   C43E11.10   AGTGCAGCGTTCTTTCGATT    ATCGATTTTGCAGGGTTTTG    I-1J24
4   F01 I   C43E11.11   CAAATTTTCAGGGTAGCAGAATG AGTGGACGTAAAGAATCGTTCAA I-1L02
4   F02 I   Y47D9A.a    GGAGCATTAGGACTTGGAAGATT TACCTTTGAAAAATCGGCAACTA I-1L04
4   F03 I   Y47D9A.b    GTCAATGAGTGATATTTCCCCAA GATGCTTTTTGCAATGTCATGTA I-1L06
4   F04 I   Y47D9A.c    GTGGATGGATAAGGTTAAAAGCC TCCCGATGAGATTTACAAAAAGA I-1L08
4   F05 I   Y47D9A.d    AATCTCCCCCAACCTCATAGTTA ATCGTTCAAAGCCAGATTAATGA I-1L10
4   F06 I   Y47D9A.e    TAAATCATTTTCAGTCATCGGCT AGAAACTTTTGGGGCTGATAGAG I-1L12
4   F07 I   Y47D9A.f    AAAGAGACGCAGACAGTAGGTTG CAATCTTGTTTTCTGGAATGAGG I-1L14
4   F08 I   Y47D9A.g    CCGCGTCAGTATAAAATATCTCG TTATACGGTAAGACGACGCAGTT I-1L16
4   F09 I   T03A1.3 TGGCGAATGATTAGTGAACTTTT GCAGTTTCGGTTTCAATAGTTTG I-1L18
4   F10 I   T03A1.4 TTTGGCTCATCAGCATCTTG    TACACTGTCAGCCGTTCTGG    I-1L20
4   F11 I   ZK973.a ATGGGCGTTTCGTTTTTATTTAT TTGGACATACATTGTCTGACAGC I-1L22
4   F12 I   ZK973.b CTGTTCCATGAGAAGTTTTGTCC AGGTCAGAAGAACAGCTCACAAG I-1L24
4   G01 I   ZK973.c GACAATTTGGTGAAATTTTGGAG CAAATGTTCCAGATCAACAGTCA I-1N02
4   G02 I   ZK973.d CTTTGGCAATTTCAAACTATTCG ACGTATTGTAGCGGATTTTCAGA I-1N04
4   G03 I   ZK973.e AAATCACCAGACGAGCTTATTGA TCACCAGTCTTTTGGATGTTCTT I-1N06
4   G04 I   ZK973.f AAATCACCAGACGAGCTTATTGA TCACCAGTCTTTTGGATGTTCTT I-1N08
4   G05 I   ZK973.g AAATCACCAGACGAGCTTATTGA TCACCAGTCTTTTGGATGTTCTT I-1N10
4   G06 I   ZK973.h CAACAACTCCAATCTGTACCACA TCACCAGTCTTTTGGATGTTCTT I-1N12
4   G07 I   ZK973.i ATCGCTGAAGATTTGGATAACAA CTTCAAGGTCCGGAATAAGAGTT I-1N14
4   G08 I   ZK973.j ATGGCTCCCCGATATAATACTGT TTCACAGACGGTTTTCGTATCTT I-1N16
4   G09 I   ZK973.k GATAACTTTTCTTCGATCCGCTT CGATTTGTTTATTTTCCTTGCAG I-1N18
4   G12 I   T21E12.2    ATTGATGGCAATTGGACATTATC AAGAAGCCCAGTCACAATACAAA I-1N24
4   H01 I   T21E12.3    AATTGTGGAGTTGTCAGAATCGT TGCATTTTTAAATTTTAGGGGGT I-1P02
4   H02 I   T21E12.4    AAGGAAGGAGCTCAACGACA    CCTTTCCTTCCTGGGTCTTC    I-1P04
4   H03 I   T21E12.5    TTTCTTCTGCATCCATTTCATCT CCATCGCGTAAACTAAAATTCTG I-1P06
4   H04 I   C11D9.1 CGAGATGTGCTCAAGTTGGA    ATGGTCATGGTCGGTCATTT    I-1P08
4   H05 I   C41D11.1    GCAGACTTGCTGCCTCTTCT    TCATCCTTCCAAATTCCGTC    I-1P10
4   H06 I   C41D11.2    TGCTCTTGATCTCGCTTCAA    GGGAGGAAACAAAAACACGA    I-1P12
4   H07 I   C41D11.3    TTTTGGATATTTTCGAAGCAAAA TCAATTCTTATGGCTGTTGACCT I-1P14
4   H08 I   C41D11.4    TCTACCAATTGACGACTTCCAGT ATCCTTCCTATCCCATTCAACAT I-1P16
4   H09 I   C41D11.5    ATTCGGCTTTTGAGGGCTAT    TCGAAATGCAAAAGATTCCC    I-1P18
4   H10 I   C41D11.6    GGCGTCAATAATTGCAGGAT    ACCGTGCACCTCAAGGATAC    I-1P20
4   H11 I   C41D11.7    AAGAATGATGGCCATAAAGTTGA AATGCTTGAGAATCAATATCGGA I-1P22
4   H12 I   C41D7.1 TTAGCATTAAGCTTGAAACAGCC TCATCCTTGAATTTCTTCGTTGT I-1P24
5   A01 I   C41D7.2 GGCAAATCAATTTCTTCGGA    CGCTGGCAGTTATCACAGAA    I-2A01
5   A02 I   T01A4.1 AAGTGCGCTCTACAGTAACCAAG CTCGTCTTCTTCATCCGTCTCTA I-2A03
5   A04 I   T01A4.3 TCTGACGTTGACTAAGTTGGGAT CTCAATAGCCTCAAAGAGCTGAA I-2A07
5   A05 I   D1007.1 GCCGGATCTGTTTTGGATAA    AAGTGCCGTAAAAATGGGTG    I-2A09
5   A06 I   D1007.2 GCGGCTGGTTTGAAAAATAA    CCATTCAATCCATTCTTGCC    I-2A11
5   A07 I   D1007.3 AACAGAGTTCACTTTGTCCTTCG GGAAGAAAGAAAATGGCAAACTT I-2A13
5   A08 I   D1007.4 AATGATCAAATTTGGGACCTTCT AAATTTCGCATCTGAAACAAAAA I-2A15
5   A09 I   D1007.5 AGAGCGAGTGGTGTAACGCT    AATCGATCGGTGAATTTTGC    I-2A17
5   A10 I   D1007.6 CATTAGTCGGAAGAATTTCGTTG ATAACATTTATTGTGGTGGTGGG I-2A19
5   A11 I   D1007.7 TCAGTGCAAGCCAGATCAAC    TTGGTTGAGGCCTGAGAGAT    I-2A21
5   A12 I   D1007.8 GAATGAAAGACAAGGCAAGATGT AGTGTCGTTTGTAGACGTCGATT I-2A23
5   B01 I   D1007.9 ATCAGTTTCAGTAAACACGCTCC GACCGGGTACTGTATTTTTAGGG I-2C01
5   B02 I   D1007.10    GTCTGCTTCTCTTGGATCTTGAA CGTTGAAAAGTGATTTCCTTCAG I-2C03
5   B03 I   D1007.11    GGTTTCGACATGAGTAAAAATCG TCCGAATCTGTTCATTTGAGTTT I-2C05
5   B04 I   D1007.12    TATTACAATAACGGGACCGAGAA CACGAATGTTTTAATTTTGGGAA I-2C07
5   B05 I   D1007.13    CCTCTGGAGCACATCTATTAGGA GGTCTCCAATTCACGGATACATA I-2C09
5   B06 I   D1007.14    TTGGCTTGAAAATGGAGTAAAAA ACTTCTAAGTGCACAACGGTCAT I-2C11
5   B07 I   D1007.15    CACACAGAATTTGACCCGTG    TTTCAATGGATGACCCCAAT    I-2C13
5   B08 I   C44E4.1 GTTGAAGTTGAGGGTAACACTGG GGGATCACATATAGCAAGACAGC I-2C15
5   B09 I   C44E4.2 CGACATTATCTGCGAAGCAA    AGGCAGAGAAGCCAAAACAA    I-2C17
5   B10 I   C44E4.3 CGAAGATATTTCAAAGATGCCAG TGTGAACCCAAAAGAAGAAAGAA I-2C19
5   B11 I   C44E4.4 CAGTACGCTTAGCCTTTGGC    CGCAGAAACGAAGAGAATCC    I-2C21
5   B12 I   C44E4.5 GCGAGTAAAGCAGAACTCGATTA ATCAACATGAAGAATGTGGCTCT I-2C23
5   C01 I   C44E4.6 ACATGCGAGTACTGTAGCTGTGA TTGCTGATCAAATAGGCAACTTT I-2E01
5   C02 I   Y119C1a.a   ATCACGATATGCTCCAACTCCTA CTTCTGCTCAACAGACCAATTCT I-2E03
5   C03 I   B0041.1 TTTCGATAAAGACCTCGAAACAA AGATATACAATGCGCCCAATATG I-2E05
5   C04 I   B0041.2 GGTGGTGGTATGCACAATCA    CCATTGCCGTTTCAAAGTCT    I-2E07
5   C05 I   B0041.3 CATCAGCAACAGAGTTTTGTCAG AAACGATTTGATGTTCCGATCTA I-2E09
5   C06 I   B0041.4 TTCTTGAAGGCAGACTCGGT    CGCTCGTGACTGTGTACGAT    I-2E11
5   C07 I   B0041.5 CGCTGTATTAATTTTCACTTCCG CTGTCTCCAGTCTCAATCTCGTT I-2E13
5   C08 I   B0041.6 AGTGGAATTGGAATAAACAGGGT TTCGCTTGAAATTATTGCGTATT I-2E15
5   C10 I   T04D1.2 AGTCGCGCCTTATGCTAAAA    GAAATTGGGCTCGCTAGATG    I-2E19
5   D01 I   W09C3.1 TCTCATTTTTGAGGCCAACC    GATCTCCGTCAACTTGGCAT    I-2G01
5   D02 I   W09C3.2 GATTCGCATAACTCGACCGT    CCGGACAAGTTGCATTTCTT    I-2G03
5   D03 I   W09C3.3 ATCACTCGAAACGGCAAAAC    ATTCCCGTAATGTGTCGCTC    I-2G05
5   D04 I   W09C3.4 GCGAATCATTTTTCTCTCGC    CTGGACAAATAGCACACGGA    I-2G07
5   D05 I   W09C3.6 TGCGCAGACACCGTATTTAG    ATGTCCGGTGGAAGACTGAC    I-2G09
5   D06 I   W09C3.7 TTTGACAAATCGGACAGAAAAGT AACTTCCAACTCATCTTTCCTCC I-2G11
5   D07 I   W09C3.8 TTCTTCTCCCAACGACGACT    CAGAAAACACGCGCAATTTA    I-2G13
5   D08 I   C10H11.1    GAAGTGCTCATTTTTGATTTTGG CAAATAATCTCCAAACTCGCATC I-2G15
5   D09 I   C10H11.2    GTCCCCTTTCAGAAAAGATTCAT TTACCCACATTTTGTAGCACCTC I-2G17
5   D10 I   C10H11.3    ATTCAGTGATGCAATGCTCCTAT ACTGATTCTAATCCCCACATTCC I-2G19
5   D12 I   C10H11.5    TTCCGTCATATTGGAGAGCC    TGTCGCCACACTTTTCTGAC    I-2G23
5   E01 I   C10H11.6    TTCACTCACCTGCTTATGCG    TTGAAATTGAAGCACGTGGA    I-2I01
5   E02 I   C10H11.7    ACAGAAGCTTAAGCGATGAAAAA CGTTAGAGGAGAAGTAACGAGCA I-2I03
5   E03 I   C10H11.8    TGAGCGGTTTTATGTGACCA    GCATCCCCTATCAGCTTGAA    I-2I05
5   E04 I   C10H11.9    GCATTATCTCGATCACGGGT    ATTTGAACTCCGACCGAATG    I-2I07
5   E05 I   C10H11.10   CCAAGCTGTACTCGTCGTCA    TTTTAAAGACGCATGTGCCA    I-2I09
5   E06 I   M04F3.1 TGTGGAACGAGACTGTCGAG    CCAGTGGGATGAAAGAAGGA    I-2I11
5   E08 I   M04F3.3 GCGAAGAAGTCCACCAACTC    CGAGCCAACTGCAATTCATA    I-2I15
5   E09 I   M04F3.4 TGAAAAGACCATTGTCAGGAACT ATTTTGTTGTTGTCTCACCGTCT I-2I17
5   E10 I   M04F3.5 TGATAGAATTGTTGTGGATGTGC TTCAACGGAGGAATAGTGAAAAA I-2I19
5   E11 I   F54D7.1 TATCTTCTGCGAACCAGAAAAAG TCTTGCCAGTTCATCTATACGGT I-2I21
5   E12 I   F54D7.2 ATCTTCAACCGGAGCATCTG    AGTGGAACCATTGATAGCCG    I-2I23
5   F02 I   F54D7.4 GGCTTCACCGTCTCTTCAAC    CTCTGCGGAAATCACAGTCA    I-2K03
5   F03 I   F57C9.1 CTCCGAGCTTTGTTTTCCAG    CAAGCCTGGGAAATGTGAAT    I-2K05
5   F05 I   F57C9.3 AAAGAGCAATCAGGCCCTCT    TATTGCACCGTTTTTGGTGA    I-2K09
5   F06 I   F57C9.4 TGATGTAGGAACACGGACCA    GGTCAATTTCACCGTCGAGT    I-2K11
5   F07 I   F57C9.5 CAGTAAACGCACCACGAAGA    TACCTCATTGCCTTTGGAGG    I-2K13
5   F08 I   F57C9.6 ATCGCATTTGGAATTCTTGC    TGGAATTCCTTTGCTTCTGC    I-2K15
5   F09 I   F57C9.7 TGGAAGAAGACGAGATGGCT    GAATCTTCGGGAGTGAACCA    I-2K17
5   F10 I   F57C9.8 AGGGAAAAAGTGTTGGCCTT    ACGTCCAGCTTCTGCTTCAT    I-2K19
5   F11 I   C01F4.1 AAAAATCCAGAATGCTCAAAACA TCATCACCTTCTTGACCTCAAAT I-2K21
5   F12 I   C01F4.2 CAGGTGTGACACAGACACTTCTC GTTAAGCCTCAAGATCCACCTCT I-2K23
5   G01 I   C01F4.3 TCAAATGGCTATTCTGTCCAAGT AATCAGCTGCCGATATACGATTA I-2M01
5   G02 I   F25F8.1 GACGACCGTCCTTCGATTTA    TCACGTGGTGTTGGAGTGAT    I-2M03
5   G03 I   F25F8.2 ACAGGGGAAAATCTAAACGAGAG CGGATAAGTTTGACAAGTTCCTG I-2M05
5   G04 I   F21F3.1 GGCAATTTTCCAAAGCTTTTACT TCTCTTCTTTTGTTTTCAGCGAC I-2M07
5   G05 I   F21F3.2 ACGGGCTAAACACAAGAACG    TTCGACTTGTTGTCACGAGC    I-2M09
5   G06 I   F21F3.3 TGCCAGAACGACAAAAACAA    CAGACCAAGTTTTGCGTTGA    I-2M11
5   G07 I   F21F3.4 CAAGGAACATCACATGACGG    AGGTCTTGCCTTTTTGACGA    I-2M13
5   G08 I   F21F3.5 TCCTCCCTTTGAAGTTGGTG    TGACGTGTTCGGTTTGGTTA    I-2M15
5   G09 I   F21F3.6 TACTACGAAAATTGGGAGAGCAA ACCAAGTTACAGCATCTTACCCA I-2M17
5   G10 I   F28B3.1 GTTGTTGTGTGTGCTCCACC    GGCTGGTACGAGATCGAGAG    I-2M19
5   G11 I   F28B3.2 GTTTCCGTAATTTCTCTTTGGCT CAAACAACGCTTTGATATGTTGA I-2M21
5   G12 I   F28B3.3 CATCAGAAGACGAAGACAGTGTG AAATTAATGAATTCGCAGCAAAA I-2M23
5   H01 I   F28B3.4 GTGTTTCGTTGTAAACGTTAGGC AGATTCTCTCACGAAACAAGTGC I-2O01
5   H02 I   F28B3.5 TCGAAAAAGTAAATTGCGCC    GCGAGAAACTGTCGTTGTGA    I-2O03
5   H04 I   F28B3.7 GTTTCCACAAACGAATTGAAGAG GCAACAAAATATGCTGACATTGA I-2O07
5   H05 I   W03G9.1 CAAGCGGAAAGTTCGATGAT    GAGGAAGAATCGACGACAGC    I-2O09
5   H06 I   W03G9.2 TCAGACGAAGATCGATGACG    AAAATTGCTCACCTTGGCAC    I-2O11
5   H07 I   W03G9.3 GCAACGTGGCCTAGAAAAAG    GGGGAACGATGAGCATAGAA    I-2O13
5   H08 I   W03G9.4 TCCTTGGCATAGAATCCTGG    GTGCGACGCAGCTGTATTTA    I-2O15
5   H09 I   W03G9.5 GTCCACCTTTCTCCCAATCA    GGATTTGCCGAAGATTCAAA    I-2O17
5   H10 I   W03G9.6 CACACAATGAGTTTCACCCG    GCGGCTCTCGAACATTCTAC    I-2O19
5   H11 I   W03G9.7 ATCCCAGTGGCATCTTATCG    AGCTCGGAACAACTTTGTGG    I-2O21
5   H12 I   F54C1.1 GAGGTCTGGCTCATTTGCTC    TCGAAGCTTGGTCTCCTTGT    I-2O23
6   A01 I   F54C1.2 ACGAGACAAGAAATCCACCG    GCATCTCCGTCCTTCTCAAG    I-2A02
6   A02 I   F54C1.3 GGATTCTCATCTCGCTCGTC    GATTTCGCCTTCAGGAAACA    I-2A04
6   A03 I   F54C1.5 AAAGAATCATCGCTGTCCGT    CGAGGCTACAGAGTTTTCGG    I-2A06
6   A04 I   F54C1.6 TCGAAAATCGGAAATATGCTTTA TTTAGTTTGGCGTTTCTCATCAT I-2A08
6   A05 I   F54C1.7 AACTCCTCGAACTCAATCTTTCC AAGAATGTGTTTTGTGGAGGAGA I-2A10
6   A06 I   F54C1.8 ACGAGCGATCTCTTTTCTTTCTT AATTTTCAAATCGAATAACCCGT I-2A12
6   A07 I   C46H11.1    TTGACAGAAAGTGAACAGGGATT AAAAATGAACTTGCATGGCTAAA I-2A14
6   A08 I   C46H11.2    TAACCGACATCTTTGGGTCC    ATTCCCATTGCTCTGATTGC    I-2A16
6   A09 I   C46H11.3    TTTAATCTATCGCTTTCCCCTTC AATTAGAGACGTTGTCGATTGGA I-2A18
6   A10 I   C46H11.4    TCCTGTCGTCCTACTCGCTT    AGTCAATCATCCAGCATCCC    I-2A20
6   A11 I   C46H11.5    TGTACCTTTAACGAAGGCAGGTA ATTTGGCTTTTTGGTTTTTGAAT I-2A22
6   A12 I   C46H11.6    GCGACAAAATAGTCAAGGTGAAC AGCACAAGCATTACCAAGAATGT I-2A24
6   B01 I   C46H11.7    TCTGCAATAAAACTCCAAGATCC TGTTTGCTTTCAATCCAGGTACT I-2C02
6   B02 I   C46H11.8    ACTGAGTTGTTGCAAAGAGAAGC AACCATCATTCTATCATGTTCCG I-2C04
6   B03 I   C46H11.9    CTATTTGAACACATTTCTTCCCG AACGTGTAGCCCAGACAGAATTA I-2C06
6   B04 I   C46H11.10   CGAATATCTAGCCGATCCGA    ATGGCATCAAACTCTTTGGG    I-2C08
6   B05 I   C46H11.11   CTTCTCTGCCAACCGCTTAC    TACATTGGAAACCAGCGACA    I-2C10
6   B06 I   Y110A7A.a   GGAGACATTTTGAAAGCAAAACA AAATTGACAATACAGCCAGCAAT I-2C12
6   B07 I   Y110A7A.b   TCGAGACCACGATATAAAGCAAT ACAAATGTGTTTGGAGTCGAAGT I-2C14
6   B08 I   Y110A7A.c   TTTGCTACAGGTCCAATCCTTTA CATTATCCCACACCAACTCCTTA I-2C16
6   B09 I   Y110A7A.d   ATTGGTCAGTGCAGTCAGATTTT CCGAACAATTGAAGATGAGATTC I-2C18
6   B10 I   Y110A7A.e   TGTGGATAGAGCACAGTTGAAGA AAAATGAAAGAAAATCTGCACCA I-2C20
6   B11 I   Y110A7A.f   GTGGGAGGATGGTTTACAATACA CAGCTTCAGCGAGTAATTTCAGT I-2C22
6   B12 I   Y110A7A.g   TCATCCCATAAATCGTAATCGAG GCTTTTGCATTTTTAGATGGTTG I-2C24
6   C01 I   Y110A7A.h   GGGATTCTTTTGAGCATTTCTCT AAATATGACAGAAGCATCGGAGA I-2E02
6   C02 I   Y110A7A.i   CAATCTTTCTCTCCGTCTCTCAA GATCTCATCTACATCGCATTGAA I-2E04
6   C03 I   Y110A7A.j   TAATTTTCACCGACGTTTGAGAT TAAATACTAGCAATTCGTCCCGA I-2E06
6   C05 I   Y110A7A.l   CTCTTGTTAAATGCCTTGAATGG GGTTGTTCGTAGAATCAATCGAG I-2E10
6   C06 I   Y110A7A.m   CTACCTAAAAATGTCGTTGGCTG AAGTCGATTCATTTGGTTTGAGA I-2E12
6   C07 I   Y110A7A.n   TAAACAACTCTCAATCCTCCCAA TGCAAACTTTGAACGTATCTTGA I-2E14
6   C08 I   Y110A7A.o   ATTAAAATTGATTTCCGTCCGTT TGTAGAAAATGACACAGCGAGAA I-2E16
6   C09 I   Y110A7A.p   AAAGGAAATTTTCAGCCAATGTT TGCACATAAAGAAAGCAAAATGA I-2E18
6   C10 I   Y110A7A.q   TTTGAGAGAAGGAACACGAAGAG AACAAAGAAACGCAGCAAGATAG I-2E20
6   C11 I   Y110A7A.r   TGTTTGAAAAAGTTTCCACCTGT TGATCCGCTATATAGGCAACACT I-2E22
6   C12 I   Y110A7A.s   TCTCTCCTTTTTAGCCTGGTTCT TTGGAATAAATGGGCCTAAGAAT I-2E24
6   D01 I   F56A3.1 TCGACATCAAATGCTTCTCG    GTTCGGAAAGTGGAAGACCA    I-2G02
6   D02 I   F56A3.2 CCCAATTTGAGATCGAGGAA    TGAGCTGAAAAAGCTGCAAA    I-2G04
6   D03 I   F56A3.3 GAAGGGCAGTTGGTCATTGT    TTCTGCTGAAATTTCCGGTT    I-2G06
6   D04 I   F56A3.4 CTTTCTCTGGGAAGAATGCG    TTTTCGTCTGCTGATGTTCG    I-2G08
6   D05 I   C32E12.1    TTTCAGGGCAAGAAACCATC    CTGCCAACCAAATCCAAGTT    I-2G10
6   D06 I   C32E12.2    TTGCATTGGAAGTATTGGCA    CTAAGCCGTTCAGCATCTCC    I-2G12
6   D07 I   C32E12.3    GAGTCGAGAAAGCCGTGTTC    CATTTTGTGCCTGTGTGGTC    I-2G14
6   D08 I   C32E12.4    TTGGATTGGTGGAGTCACAA    ACGATCATCTTCTTCCACGG    I-2G16
6   D09 I   B0261.1 GACGAATCAAGTGTCGCTGA    CTTCCATGGCAATTCGTTTT    I-2G18
6   D11 I   B0261.4 CTGGAGTTTTGCGGACTTTC    TCCATGTCTTCTGTTCGTGC    I-2G22
6   E01 I   B0261.6 TGAGGACAATTGCTGGATTTACT TGATATCTTCGTTTGAAATGCCT I-2I02
6   E03 I   C01G8.1 GGTGGTGGAAGCTCTCTCAG    CGTAAATAAAACGCGGGAAA    I-2I06
6   E04 I   C01G8.2 ACATCAACGCTATTTTCCCG    AATTCCAGAATGGATGTGGC    I-2I08
6   E05 I   C01G8.3 TTTTCGATTCCACGAAAACC    GACGTGCAGGGATGAGGTAT    I-2I10
6   E06 I   C01G8.4 GCTTTTGCTCCATTCGTTTC    GTGGTGGTGGAAGATATCCG    I-2I12
6   E07 I   C01G8.5 CAGAACGTCGTAGTCAGTGACAG TTTCAGGACTTTGTCTTCTACGC I-2I14
6   E08 I   C01G8.6 CAGCTTAGCAACAGCCACTG    CTTTCACGATTTCCACCGAT    I-2I16
6   E09 I   C01G8.7 TACACTTGTCGACGGAGCAG    ACGTCTCATCAATTACCGCC    I-2I18
6   E10 I   C01G8.8 CGAAAAATCCCCTTCTCTCC    GGTGGTGGACCAAAGAAAGA    I-2I20
6   E11 I   F48C1.1 CCAACTGTTTCCGGTGACTT    TGAGATATGCACCTCCACCA    I-2I22
6   E12 I   F48C1.2 CAGACCAAATTGGCTACCGT    AGACGCGGAACTGGAAATAA    I-2I24
6   F01 I   F48C1.3 TAATTCGAAAGAAAAATGCAACG GTCAACTCTTGAAACCTGACACC I-2K02
6   F02 I   F48C1.4 GTTCGTTCATTTTTACCCCCTAC AATTTTTCGTGGAAATTTACGGT I-2K04
6   F03 I   F48C1.5 GGTTAGAAGATGAGCAGAGACGA AAAATGTCAAAATTCACGATTGG I-2K06
6   F04 I   F48C1.6 ATCCTTGTCCCTGATTGCTG    TGCAGAAATGTCTTCATCCG    I-2K08
6   F05 I   F48C1.7 TTGGAAAAAGCGTCCTCATC    TTAAATTTGGTGCCGCCTAC    I-2K10
6   F06 I   F48C1.8 CATAGGAAACAGCCATTGGG    GTTATTACGGAGGTGGGGGT    I-2K12
6   F07 I   F55A12.1    ACGTTGCCTTGCATCTCTCT    CAACAGCGTAAAGAGCCCAT    I-2K14
6   F08 I   F55A12.2    TGCCTCAACAGATCCATCAA    CATCAATTGGATGAAAGGGG    I-2K16
6   F09 I   F55A12.3    GACGAATTGACGAACAGGGT    TGCTTTCCACGTATGTTCCA    I-2K18
6   F10 I   F55A12.4    AAACGTGACTGATAAAGAGCCAG ACTTTCGCAAAATGTGTTTGAAT I-2K20
6   F11 I   F55A12.5    GTTCCCGATTTGAGTCCTGA    TGGCAATGGAAAGAGAGCTT    I-2K22
6   F12 I   F55A12.6    TCACTTGGGGGAAAATACCA    CTCGACTTGGGAAACTCTGG    I-2K24
6   G01 I   F55A12.7    ACAGGGATGACTGTTTTGGC    GGAACCGTACTCCGTTCAGA    I-2M02
6   G02 I   F55A12.8    CGATTGAGCCATTTTTCGAT    TTGAAGGAGGTGGAATGGTC    I-2M04
6   G03 I   F55A12.9    ATTCTCACCTGGAATGCGAC    CCCAACAATCTCCACCAAAC    I-2M06
6   G04 I   C24A11.1    GTTGAATTTTATTGACTTCCCCC CGGATATCAAACGAATGTATGCT I-2M08
6   G05 I   C24A11.2    GCGAGAGAATATGAATCCAGAGA TGAATCAATGACACTTCATTTGC I-2M10
6   G06 I   C24A11.3    AATCAATCAATCTTCGCGTTTTA TTAGTCTAATGGAGTTTGGCAGC I-2M12
6   G07 I   C24A11.4    ATGTTGCAGGAAGTATTTTTGGA ACGAATTGAAATTAAAACTGCGA I-2M14
6   G08 I   C24A11.5    CTTTCTTAGAGCTCCTTTTTGGC CAATATCATTTCCGGTAGCTGAG I-2M16
6   G09 I   C24A11.6    AAAAGAAACGAAAATCGTGTGAA TCTGGAACATTCGGTGTAGTTTT I-2M18
6   G10 I   C24A11.7    GATGAAATGAGAAACCGACAAAG ATTCAAACAGAAATTGGGTTCCT I-2M20
6   G11 I   C24A11.8    TATTTTCAACTTCACGCAGAGGT CAAATGTCAACAACTCCAACAGA I-2M22
6   G12 I   C24A11.9    ATTGGTCTGTTTCAAAACGAATG TTGTTGAAGCTCGAAAGAAAATC I-2M24
6   H01 I   C30H7.1 TACAAGCATTTCCCATAAGAAGC TGAGAAGTACACTGGTTGCTTGA I-2O02
6   H02 I   C30H7.2 GACACTTACCACTGGATCTGGAC TCCTTCTCCTCCTCTACACCTCT I-2O04
6   H03 I   F27C1.1 AAAAATGTTTTCTGCTGTTTCCA GAAGATCAGCCAGCTTCTTGTTA I-2O06
6   H04 I   F27C1.2 TCAGTAGAGCGCATTTGGTG    CGAATCCGTCACTTCTCCAT    I-2O08
6   H05 I   F27C1.3 GCTTCTTGTCGTTTCTTGGC    GAGGAAGTTTGAAGCATCGC    I-2O10
6   H06 I   F27C1.4 GGAAGAACGTAAGGACAACACAG ACCGAAAACATGACATAAATTGG I-2O12
6   H07 I   F27C1.6 CAAGATGTTTTCGGTGCAGA    AAAACAAAAACCGACGCAAC    I-2O14
6   H08 I   F27C1.7 GGCATCCTTGTATTTCTTGACAC GCCCTTTTTCTCTTGAAATTAGC I-2O16
6   H10 I   F27C1.9 TTGCAAGTGAACTCTCTGATGAA TTTTGGAAACAGCAGAAAACATT I-2O20
6   H11 I   F27C1.10    TACTTCATAATCGCGGCCTATAA AATCGATGTTGAGGAGAATTTGA I-2O22
6   H12 I   F27C1.11    GGAGCTTTCACTCGCAAAAC    TTGAAACAAACGGTTCCTCC    I-2O24
7   A01 I   F27C1.12    TAAAATTACCGCCATCAAGCTAA ATCGTCAGTTTCGCAAATTTTTA I-2B01
7   A02 I   F27C1.13    CCAAGTGTCTTCAAAAACCAAAG CACGCATATTCTTTCATCTTTCC I-2B03
7   A03 I   T05E8.1 TGTTCCGGTTTCAGCTCTCT    ATCGGTTCATTTGGAAGCAC    I-2B05
7   A04 I   T05E8.2 AAATTTCCAAAATCTCGGGG    CAAGCCAAACAACAGCTGAA    I-2B07
7   A05 I   T05E8.3 TTGTGACAGCCCTGAACAAG    GCACACGAACGGAGTCTACA    I-2B09
7   A06 I   C09D4.1 ATCTGTTCTTCTTGGAGCACTTG CTCTTTGTGCATATTTCCCTTTG I-2B11
7   A07 I   C09D4.2 CTCCCTTTTCATTCGTCCAA    ACTTCGAAATCCATGCATCC    I-2B13
7   A08 I   C09D4.3 TCAAGAGTCTGTCGCAATGG    ATGGCAACTCTCCAACCAAC    I-2B15
7   A09 I   C09D4.4 CCTCACGAAATACTGCACGA    AAGGAGCGGCTGTCAGTAAA    I-2B17
7   A10 I   C09D4.5 CAACAAAGTTTTACTTTCCAGCG TCGCTAATTTTTGTTGTTTTCGT I-2B19
7   A11 I   C09D4.6 CCGAATAGCACTATTTTGAGGTG GACATCTCCTTGGACACTTTCTG I-2B21
7   A12 I   F59A3.1 CAGCAAGATGCTCTCACTCG    TGGTTAAGACCGGACACCTC    I-2B23
7   B01 I   F59A3.2 CCCCGAGTTGAGAATGTGAT    AGTAGAGTGTGGGCGAGCAT    I-2D01
7   B02 I   F59A3.3 CTCGCAACTTTTGGCATGTA    TTTTGTTTTGCACCCTCTCC    I-2D03
7   B03 I   F59A3.4 ACCACGTAGATCATGGCTCC    CCGGGGTATTAACCCAATTT    I-2D05
7   B04 I   F59A3.5 CAAAGTACGCAATGTGTCGTAGA ATTGAAGAATGTCGCAGGAAATA I-2D07
7   B05 I   F59A3.6 TCGAATGGTACGCCTTCTTC    ACCGAAACTTTTCTCTGCCA    I-2D09
7   B06 I   F59A3.7 TCAGGTGTAATGGATTGGCA    GGGAATTCAAAGAGACGCAG    I-2D11
7   B07 I   F59A3.8 ATTTCCGCATGATTCTCGTC    CCATCCTCGAAAGAAACCAA    I-2D13
7   B08 I   F59A3.9 TTGATGTGAAACGAAACGGA    TATGGTTTTTCCAGCGGTTC    I-2D15
7   B09 I   F59A3.10    ATATCCGGTTTCTGTTTTTGGAT TTGTGCTGCCAAACTAGTGTAAA I-2D17
7   B10 I   M01A10.1    TAATTGGTCGCAACGGTGTA    TAATGATGCTTACCACGCCA    I-2D19
7   B11 I   M01A10.2    TTGTGAACCAGTGCTGCTATAAA GCACTGAATTCCTTATTTCGTTG I-2D21
7   B12 I   M01A10.3    AGTGCGCGGGTAAGAATAGA    CTTGCTGCAGTCGATGATGT    I-2D23
7   C01 I   M01A10.4    GGACTCATTATTTCAGGCAACAG CCACTCGAATATCTCCAGTCAAC I-2F01
7   C02 I   M01A10.5    TACATCATCCCTGTCTGGCA    AAGCAATACGGTCGTCCATC    I-2F03
7   C03 I   M01E11.1    ATTTATGGCATCTTTTGCCG    ATACCCACGAACGAATGGAA    I-2F05
7   C04 I   M01E11.2    GATATTCTTGCGGCTTTGGA    TTGCAATTTTCGATTCCCTC    I-2F07
7   C05 I   M01E11.3    TTGGATCCCACCATGAAAAT    TCGATCGTCTTGTTTTGCAG    I-2F09
7   C06 I   M01E11.4    TTTACGATGGAAGGTTTCGG    GAGGATGTCGTGGACTCGAT    I-2F11
7   C07 I   M01E11.5    TTACTTTGCCGACTTTCGGT    AAGAGCAACTACGGCGAAAA    I-2F13
7   C08 I   M01E11.6    TGTCCCTTCTGGGATCTTTG    AGGCTACCGACTTTGCTGAA    I-2F15
7   C09 I   M01E11.7    AGCTTCTTGTTCTCTTGATGGTG GAAAAACGAGAGAATAGCGTTGA I-2F17
7   C10 I   F46F11.1    TATCCTGGAATCCGTCGAAC    TGTCTGAATGGTGTGGCAAT    I-2F19
7   C11 I   F46F11.2    TACAGTCAACCTCACTTGCTTCA AGCATGCATAAATTGGGAATATG I-2F21
7   C12 I   F46F11.3    GTGATTTCCGAGAGCATAAACAC TTTCCAAAACCTTATTGAGCGTA I-2F23
7   D01 I   F46F11.4    AGTAGAGCTCGAAATTGAATCCC CATGCGCCTTTAAGTTTACTGAT I-2H01
7   D02 I   F46F11.5    TTAGAAATTGATGGGAGAGGGAT TGATTTTTCTTGTCTTGTGCTGA I-2H03
7   D03 I   F46F11.6    CACGCACCGCATATGAATAC    AAGCACTTGCCACGAGAAAT    I-2H05
7   D04 I   F46F11.7    CATTCTGTTCATTCGAGGTTTTC TGAGAAATACGAGAGGAGCTGAC I-2H07
7   D05 I   F46F11.8    TGAATCCGTAACTGTGCAGC    ATCTCCAGTTGTTTGGCGTC    I-2H09
7   D06 I   F46F11.9    TCGTCGATTTACAGATGGCA    CACCATATCGTGGAATGCAG    I-2H11
7   D07 I   M01A12.1    ACAAGGCGTCACTGTTTATCAAT ACCTGTTAATTGGCAAGTTTCAA I-2H13
7   D08 I   M01A12.2    ACATAAATACCGAATGGATGCTG GAGCGAAGATATAAGCGATTGAA I-2H15
7   D09 I   F55F8.1 AGGAGTGCCTACATCGCATC    AGAATCGCGCAGAAAAATGT    I-2H17
7   D10 I   F55F8.2 CGGCAAAATATCCTTCCTCA    TGGCAGACATGTGATGTTGA    I-2H19
7   D11 I   F55F8.3 TAGAAGACGCTCTGCATACATCA TGATGTTTCCTTTATCAGTGGCT I-2H21
7   D12 I   F55F8.4 GAATCATGACGGCCATTTCT    ATCCAAGATCAACCATTCGG    I-2H23
7   E01 I   F55F8.5 TTACATCCCACATTTTCGCA    GCAAACGGCCAGTATGTTTT    I-2J01
7   E02 I   F55F8.6 CGGAAACAAAAATACCGTATGAA GGTTTCTATTGTCTTCTCGGCTT I-2J03
7   E03 I   F55F8.7 ACCATGGAACTTGCACATGA    TTGGACAAATCCCCTGGTTA    I-2J05
7   E04 I   F55F8.8 AATGGAATTCAACTGTCAAATCG ATGGAAGTACGAAGAATGTTGGA I-2J07
7   E05 I   F55F8.9 AAATGTGGTTCTGTCGAGCC    GAAACGACTGCACTGACGAA    I-2J09
7   E06 I   T19B4.1 CAGTTGCATTTGAACCGATG    CAAACCTTGCATCCCAAACT    I-2J11
7   E07 I   T19B4.2 GTTCCTGCCACAATTCCAGT    GGTTGAGGCAGTAGAGGCAG    I-2J13
7   E08 I   T19B4.3 CTGAAAATGACACTTCCACGTTT CAATCGAGAAGCTTTCAGTCATT I-2J15
7   E09 I   T19B4.4 AAAATGACGGGAGGTTTAATTGT GAATGCTGTTAGATTTTTCGCTG I-2J17
7   E10 I   T19B4.5 TTTGCAAACACAGCTTTTCG    GATTATTGCCCACGTGTCCT    I-2J19
7   E11 I   T19B4.6 CTCAAAATGCAAATTGTGCTGTA CGATGAACCTTAATACGTCTTCG I-2J21
7   E12 I   T19B4.7 GGTAGGCACAGTGGGAAGAA    CTGAGGCAATCTCTGCAACA    I-2J23
7   F01 I   C04F1.1 CCTACCAGCAAATTGGAAACATA GCCAGATACGATCTATGCATTTC I-2L01
7   F02 I   C04F1.2 TGCTGGTTTGGCATTCAATA    CGATTCCTTCGGTTTCATGT    I-2L03
7   F03 I   C04F1.3 AATGAAGCGTGAAAACTATCCAA CAATCAAAACTAATTACGAGCCG I-2L05
7   F04 I   F56H1.1 GGCAGGCATACACAGCTTTT    TAGAACGCATGAGTCAACGC    I-2L07
7   F05 I   F56H1.2 TCAAAACTTATCGCCGGAAC    CAGGCTTTTCTTCAACTCCG    I-2L09
7   F06 I   F56H1.3 AGGTGTTATGGGCCTTTTGTAGT CACGCTTTGATGTAAATGAGTGA I-2L11
7   F07 I   F56H1.4 GACCAGAACGAAGAAGAGCG    CAACTAATTTTCAGGCCCCA    I-2L13
7   F08 I   F56H1.5 CAGCTCCAACATCCAGAACA    CCAAGTAGGCGGTGTCATTT    I-2L15
7   F09 I   T22E7.1 GACAACGCAGTTGTAAAGAATCC ACCGAATTTCTTAAAAGTGGAGC I-2L17
7   F10 I   T22E7.2 TTCCAAGTTTCTCAATTTTTCCA TAAATGCGAAGTGATACGGTTTT I-2L19
7   F11 I   B0414.1 AAAGTTTCCAAGCAACACGG    TTCTGGGAAATACTGCCTGG    I-2L21
7   F12 I   B0414.2 CGTCACCTGGTACACCTCTTTAC TGAGAGAAATTTGGTGTGTTGTG I-2L23
7   G01 I   B0414.3 ATTGAACTTTGAGGTGTTGCATT CACAGTGTTATTAGGCTTTTGGG I-2N01
7   G02 I   B0414.4 GCTTAAACAGACATACTACGCGG TTTCATTTTCCTACTTTCAGGCA I-2N03
7   G03 I   B0414.5 CTTGTCCAGGCCATTCAACT    CAGACTTGCTGCCGTTGATA    I-2N05
7   G05 I   B0414.7 AGCTTGGTGACGATTTGTCC    CCTGCAAATCGGGAAAGTTA    I-2N09
7   G06 I   B0414.8 TTTGAAACCAAAGCATGCAG    ATTTCCCCCAAATTTCGTTC    I-2N11
7   G07 I   C32F10.1    ACCAATTTCGGCATTCTACG    GAGCTGGATGCAGGAAAAAC    I-2N13
7   G08 I   C32F10.2    CTGGAAGACGTTTCCGTGAT    GGTCTTCCAAGTTCGTCTCG    I-2N15
7   G09 I   C32F10.4    AGGAATCGGAGGAGCAGTTT    TTGGCACACTCAGACACACA    I-2N17
7   G10 I   C32F10.5    TTATCATCCGCACTCATGGA    TCCTCATAAAGATGGACGCC    I-2N19
7   G11 I   C32F10.6    ACTGTATTACGAATGCCGCC    GGCAACGATGACTGGAAGAT    I-2N21
7   G12 I   C32F10.7    CCGTTTAGATGTCTTGAATCCTG ATTCTGCAACTCATATGCCAACT I-2N23
7   H01 I   C32F10.8    CCGGTAGGATTTCCTGGATT    GTTAGGTTCGTGCAAACGGT    I-2P01
7   H02 I   F33D11.1    TATTATCATTTCGCAATCAAGGC CGCGCTAGTCAGTAGGTTAAAAA I-2P03
7   H03 I   F33D11.2    TCAACTCGGAACAAAACGTG    CCCAAGTTCCATCCTGAAAA    I-2P05
7   H04 I   F33D11.3    TTCGGTATGTGGTGTGGCTA    GCTATGTATGACCCGCGAAT    I-2P07
7   H06 I   F33D11.5    GCAGCAAGAAGTGAGCATGA    GAAAGACATCGTGCTCGTGA    I-2P11
7   H07 I   F33D11.6    TCCAACAAGTCCAATCAAGAAGT TGTAAATTCGAAGAAAACCCTGA I-2P13
7   H09 I   F33D11.8    ACCAGATTTTGTGAGGAGTTGAA ACCCCCAGAATATTCCTTCTACA I-2P17
7   H10 I   F33D11.9    GACGCATGAAAGGACTTTATCAC ACTTCTCGTCAATTGCCATGTAT I-2P19
7   H11 I   F33D11.10   CATCTAATCCTCTCGCCCAA    TTTTCGCCGTATTATCTCGG    I-2P21
7   H12 I   F33D11.11   AAAATCCGAATGGAGCAATG    TTTTCGTTTTTCGTTTTGCC    I-2P23
8   A01 I   C34G6.1 TAATGAGTCTTCTGGACACAGCA ATCTATTTGTCGGCAATCTTTGA I-2B02
8   A02 I   C34G6.2 CTGCCAAAACGGTGTATGTG    GAACTTGTGCAACTGGAGCA    I-2B04
8   A03 I   C34G6.3 ACCATTTTCAGACTTTCGATTCA ATTTGTTCTTACAATTCCCGGTT I-2B06
8   A04 I   C34G6.4 CAGCATTTGGGGGTGTAAGT    AGAGAAGCAGCAAGACGAGC    I-2B08
8   A05 I   C34G6.5 GCTGCAATGGAAAGAGATCC    CAAGCGAGAAAAATTCGGAG    I-2B10
8   A06 I   C34G6.6 TTGGAACGTTCATCAGCAAG    CTGTGCTTGCGGACACTTTA    I-2B12
8   A07 I   C34G6.7 CTGTCGTTCACCGGTAGGAT    TACTTGATTCGTGTTGGGCA    I-2B14
8   A08 I   Y76G2B.a    TCACTCAAGGAATTTGTCGATTT CCATCACAACATGTCCATAACAC I-2B16
8   A09 I   Y76G2B.b    ATGACAGTCCTGGTTCTACGTGT CCAGTGAATACAAGCTCTCGACT I-2B18
8   A11 I   B0207.2 CGAAAGCATCCTATCTAAACCCT GTTGAAAATTCTGTCTTGGATGC I-2B22
8   A12 I   B0207.3 GGTTCAAAACCGACCAAGAA    TCCGTGTTTGTTGCTGTTGT    I-2B24
8   B03 I   B0207.6 TGCAAAAAGCAAACAAAACG    AAAATTAACGCGGCAAAATG    I-2D06
8   B04 I   B0207.7 CCTGAGTGGCATCACTTTCA    TATGAGCCTGTGTGCTCGTC    I-2D08
8   B05 I   B0207.8 TCTAAACATTGTAGGGGCTCAAA AAACACAGAGGAAGTTGCCATAA I-2D10
8   B06 I   B0207.9 TTTAGTTGCTGCTCCCATTGTAT TTAGTTTTCAACCTCGCAATGAT I-2D12
8   B07 I   B0207.10    GACGTCACGCAGTTACAACATAA CAACACGATTTTGAGATTTGACA I-2D14
8   B09 I   B0207.12    TTGGTCCATTCGAAAACACA    GGGCATTTGAATCGAAGAGA    I-2D18
8   B10 I   Y76G2A.1    TGTTTCAGATGATCCCTATCTCG TTCGCAGCCAATGAGTTATTATT I-2D20
8   B11 I   Y76G2A.2    AAATAGGATGCTTCATACGCAAA TTAAAACAACCTAACCTCCGTGA I-2D22
8   B12 I   C06A5.1 ACAATCCAGCCATCTCGTTC    CCTTGTCCAACTCGTGGTTT    I-2D24
8   C01 I   C06A5.2 TTGAAATTGGAGCAAAACACTCT TAGGCTTCAGCATTTTTCTTCTG I-2F02
8   C02 I   C06A5.3 ATTCAGGTGTTGGAACGGAG    ACTGCCGCCTGTAGTATTGG    I-2F04
8   C03 I   C06A5.4 TTTGCCTTGAGGTTTTCAATAAA ATTTTCTATCTCCGATGCAGTCA I-2F06
8   C04 I   C06A5.5 AGATCCGACTTCTCTTGGAAAAC TCAACATGGTTCGTGTCTACATC I-2F08
8   C05 I   C06A5.6 CTTCCAAATCCAGCCTGAAA    ACGACGCCTACTGTCTTGCT    I-2F10
8   C06 I   C06A5.7 ATGCGAATGGGTAGCAAAAC    AATCAGAATCCAGGGTGTCG    I-2F12
8   C07 I   C06A5.8 CTGAAAAGCCGACTGAGACC    GGACTTTCAAGGGAACCACA    I-2F14
8   C08 I   C06A5.9 CGCCTCCTCAATACCTGAAA    TACTGCCAGTGCCAAGTCTG    I-2F16
8   C09 I   C06A5.10    CGAGATAGGGATCATCTGAAACA GTTACGAGCAATACGATTTCCTG I-2F18
8   C10 I   B0025.1 GTTGGATCCCTTTGCATCAC    TATGTGCCGAAATTGCAAAA    I-2F20
8   C12 I   B0025.3 AGGAGAATGGGGATTCAAGG    GCTACAAACGGGTGGAAAGA    I-2F24
8   D01 I   C27A12.2    GAAACAATGGAAGAGAACAATGC ATTTTGTTGGGTCTTTGGATTTT I-2H02
8   D02 I   C27A12.3    ATTCCGATGCAATTTTCGAG    TTTCTTCATCAATCGGAGCC    I-2H04
8   D03 I   C27A12.4    AAGAGAATGTGGGTTCGTGG    GGCGAATGTTTTGTGTTGTG    I-2H06
8   D04 I   C27A12.5    GAAAGAGGAAAAACTCGGTCAAT CAAAAGAATGCAATGAATTGTGA I-2H08
8   D05 I   C27A12.6    CTTTCCCTCAAGCTGCAAAC    CTCTCCGATGACGATGGAAT    I-2H10
8   D06 I   C27A12.7    ACTTCGGGCATTCTTTTGTG    TGTTTGCCTCACTATCTGCG    I-2H12
8   D07 I   C27A12.8    GAGCATCCCGAGCATTTTTA    GCGAACAGAATAGCTCCGAC    I-2H14
8   D08 I   C27A12.9    TTTTCCAATTTTGGACCTGC    CATCCAGTCATGGCAGACAC    I-2H16
8   D09 I   ZK484.1 CTGGGATACGAATCAGTTCTCTG ACGAAAAGAAATTGGTGAGATGA I-2H18
8   D10 I   ZK484.2 CGTTATCGGCTTGATTTGGT    CAGCGTCCAAAGCAGATGTA    I-2H20
8   D11 I   ZK484.3 AAACGCATTTGCTTCTCGTT    AATTTGGTTTTTCTGTGCCG    I-2H22
8   E01 I   ZK484.5 AGTTGATTGTGCTAACGGATGAT CTTACCTGTGTCAGTAAGTGGGG I-2J02
8   E02 I   ZK484.6 AGAATCGTGCGAATAGATTTTGA ATCAGTTCGAATTTCAACGAAAA I-2J04
8   E03 I   ZK484.7 TGAGCCAGCTTCACATCAAC    GAGCATGGGAAGAACCGATA    I-2J06
8   E04 I   ZK484.8 TACTGTTCAGAAACGCACCTTTT TTTTCTTTGCCCTAGATTTTTCC I-2J08
8   E05 I   T27A3.1 GCTAGGAACGTGCTCTGACC    TCTGACTCCGTATGCAGCAC    I-2J10
8   E06 I   T27A3.2 GCAAGATGACCAAGCTCACA    CGTTTGAATTGAAGCGGTTT    I-2J12
8   E07 I   T27A3.3 AAACAACAACCAAAGCTTTACCA AGAAAAAGGTTGAAAGCCCATAG I-2J14
8   E08 I   T27A3.4 AACAAATACGTGACACAGACGTG GGAAAGGAAAAATGCTTTCAACT I-2J16
8   E09 I   T27A3.5 GCTACAAAGGCGCTCAATTC    TAGGCGTGCTGCTCAATATG    I-2J18
8   E10 I   T27A3.6 GCAGTTATGAGGCGAAGGAG    GGACGAAATCGTGGATCTGT    I-2J20
8   E11 I   T27A3.7 TGTCACTGTCTGGAACTCGC    AAGGAAAAGGGGTGAGCAAT    I-2J22
8   E12 I   F56F4.1 CCTCTCTCCATTCCCATGAA    CACTTTTCCCGCCTTGAATA    I-2J24
8   F01 I   F56F4.2 ATCCAGGTGGTCAATTCCAA    AGAAACGCCCAGTTTTGAGA    I-2L02
8   F02 I   F56F4.3 GTAGTTAACCGCGTAATGGTGAG CAAGAGTCCATAATCTTGTTGCC I-2L04
8   F03 I   F56F4.4 TGACAAAATTGTTTTCCTTTGCT GGATACGTTCATCCGTTTGATTA I-2L06
8   F04 I   F56F4.5 GGAGATTCTGCTCTTGACCG    TGTTGAAGGGTGAATGTGGA    I-2L08
8   F05 I   F56F4.6 CTCAAGTGATGCTTGGGTCA    GGAAATTAAAGGGCAGAGGC    I-2L10
8   F06 I   F56F4.7 ATGTTACACTGAATGGTTACGGG ATCGATATCCAATTCGTTTTGTG I-2L12
8   F07 I   T09B4.1 CTTTTTGGTCTTCGTGGGAA    TTCCGAAAACGAAGTAACCG    I-2L14
8   F08 I   T09B4.2 TGGTGCAAACCAGAAAATCA    TCGGTGGAATGTTGTCTGAA    I-2L16
8   F09 I   T09B4.3 GTGCCAAAATGAACAAATACCAT GATTGTTGAGAAAATCGGTTCAG I-2L18
8   F10 I   T09B4.4 ATTTCAATTCACATTTTGCTGCT CATCTGTTTATTTCGAGGAGGTG I-2L20
8   F11 I   T09B4.5 CTGGTGTATCCCGCTTGTTT    GACGTGAGTTGGAGCTGTGA    I-2L22
8   F12 I   T09B4.6 AGATCTACACTTTCTTCCCGTCC AAACTTTTTATTCGGCAATGACA I-2L24
8   G01 I   T09B4.7 TATCCCAATAAGTTCATGATGGC TCTCTGTGCTCTGTGCAATTTTA I-2N02
8   G02 I   T09B4.8 CAAGGCATCTTGTGCTGAAA    CAGCTTAAACCATGCAACGA    I-2N04
8   G03 I   T09B4.9 TCGACAGAGAACCCAGATATGAT TCGAATGCAGGAATTAAATGAGT I-2N06
8   G04 I   T09B4.10    ACATCCATCTTTCTGGCGAC    GCTTACGCGCAACTCTATCC    I-2N08
8   G05 I   T05E7.1 TGTGTCGCTCGATCTGATTC    AAGCTGTGTTCTTGGGTGCT    I-2N10
8   G06 I   T05E7.2 GGGTACATCTAACAAGATGCTCG TGTTGACCTATGCTCTGCTTGTA I-2N12
8   G07 I   T05E7.3 GACAACATCGAGACAATGCG    TTCTTTGGACGGGAACTTTG    I-2N14
8   G08 I   T05E7.4 TCTCTCCTTCAACCTTGCGT    GGCCCCTTTTTGTAGCTTTC    I-2N16
8   G10 I   T08B2.2 CCCAATCGCTTCTTGTGAAT    TTGTGGGGGTCAGATGAAAT    I-2N20
8   G11 I   T08B2.3 CCCTTGGTAGGAACTAGCAAAAT AACGATAACGCTGAAAATTCAAA I-2N22
8   G12 I   T08B2.4 TCGCGTCTAGTTCTAAAGTACGG GCTGACCGATATAAAACTGCTTG I-2N24
8   H01 I   T08B2.5 TCTAAAGCAAATGCTGTGCG    ACGACGTTCTTTGGCTCTGT    I-2P02
8   H02 I   T08B2.6 ATGGTCTGATTGTGTTCAGCTTT CATATGCCCATAGACAAAACCAT I-2P04
8   H03 I   T08B2.7 CACCTTCTTGGAGAAGACGC    ATTCAGCCACTTGGAGATGG    I-2P06
8   H04 I   T08B2.8 AATGCGAGAAAAATGGACTACAA GGTTTTCCTTTCTCGTTTTTGTT I-2P08
8   H05 I   T08B2.9 TCTTCAGGGAACTTCGTGCT    ATTTGGAACGCTGGTTTCAG    I-2P10
8   H06 I   T08B2.10    CTTTCCCTTGTTCTTTCCTTGAT AATTGGAAGAGAAATTAAAGGCG I-2P12
8   H07 I   T08B2.11    GCATCTGAAGAAGGTCGAGG    TTCAAGTGGTGGTCTGGTGA    I-2P14
8   H08 I   T08B2.12    AAGCTCCCACATTGTTTGTTAGA GATAAACGTGAGCTTTTCCAATG I-2P16
8   H09 I   C48E7.1 ATTGTATCCAAAATGCCATCAAC TCAACATGTTCCAAACTGTCAAG I-2P18
8   H10 I   C48E7.2 ACTCCAGAGGATGGTGATGC    CGATCTGGACCAGGAAGGTA    I-2P20
8   H11 I   C48E7.3 CGTTTGCTGATTTAGTGGCA    CCCTTTTTCGTCCTTCCTTC    I-2P22
8   H12 I   C48E7.4 GTTCGCCGAGTACTGGTATACTG GAAAGGGGAACTAAAACTCCTGA I-2P24
9   A01 I   C48E7.5 TGTCGCAACTGAAAATCAGC    CGTTTTGAAGTCGGCAATCT    I-3A01
9   A02 I   C48E7.6 TTTATTGGGTGGCTGGAGAG    TCTCTGATGGTGATGGTGGA    I-3A03
9   A03 I   C48E7.7 GTAAAGGTCGATCAAACATCGAG GCAAATTCTCAACCAACTTCATC I-3A05
9   A04 I   C48E7.8 ACACGGAAAAGGTTGACCAG    TTCGAAGGCAATTTCAGCTT    I-3A07
9   A05 I   C48E7.9 AAGCCCCAAAATGTGACAAG    GCTTCACCACTGTCAATCCA    I-3A09
9   A06 I   C10G11.1    TTTAGGTAGGTTGGCAAGTTGAA GACAGTGCCTCGATTAAAAATTG I-3A11
9   A07 I   C10G11.2    TCAGTGCGAGTTGGAGTCAG    TGTCTGAACGAATGCGAGAC    I-3A13
9   A08 I   C10G11.3    CGTGGGAAACCCTTTGACTA    GCACTGTTCGCTGGTATGAA    I-3A15
9   A09 I   C10G11.4    GAGATTCAACCATCTGGAATCAG AAATCTCAATTTGGCATCTTTCA I-3A17
9   A10 I   C10G11.5    CACCACGAGTATGTGCTGCT    TCATCATATGCTCCGCCATA    I-3A19
9   A11 I   C10G11.6    AAATTATTCGAAGAAAAGCGGTC AGTGCTGTGAGAGTGAATGTGAA I-3A21
9   A12 I   C10G11.7    TCGTCACTAACCAACACATCAAC CCTTCCTTGTCAAACTTTTCCTT I-3A23
9   B01 I   C10G11.8    AAAGTCATCCGTTCCGACAC    CGAGGAACTCCAACCACATT    I-3C01
9   B02 I   C10G11.9    TTCGAAAATTGTGGTAGAAGGAA GGTGAAGCCAGTTCAACTATGAC I-3C03
9   B03 I   C10G11.10   TTGATTCATTTCGTTAATTCGCT TTTAGGTAGGTTGGCAAGTTGAA I-3C05
9   B04 I   F26B1.1 GGGTTCTCCGATAGTGTAAGGAT CGAACGGTTTTTATCAAGTTCAG I-3C07
9   B05 I   F26B1.2 TTTTTCCCTTCAGTTCCGTG    AGATCCACCGAATCGTTCAC    I-3C09
9   B06 I   F26B1.3 CTGTCTCACAATGCCGAAGA    TGTCAGCGAGTCATTTCCAG    I-3C11
9   B07 I   F26B1.4 TTTTGTAGCTACTGGAGAAACCG TTTGAATATCTTGGGAAAACGAA I-3C13
9   B08 I   F26B1.5 CTTGCTACAATCTCTCCGCC    GCACCACGGTTCTGAAAAAT    I-3C15
9   B09 I   F26B1.6 TGTTTCATTAGGTTTCAAATGGG ATGCAGAAAACACAAACTCCAAT I-3C17
9   B10 I   F26B1.7 TAATCCTCATCAATTGAACCACC TTCTGAAACGACAATGAGGAACT I-3C19
9   B11 I   K04F10.1    ATTTTCTTCTTGGCACAAATTCA ATTATTCCGAGATCCTTCTTTCG I-3C21
9   B12 I   K04F10.2    CACAGTGACCACTTCCGATG    GTTCAGGGGTTTTGCGATAA    I-3C23
9   C01 I   K04F10.3    TTATGAATTTCCCGGACTCG    TACCGCCATAATGACACCAA    I-3E01
9   C02 I   K04F10.4    TTGACGATGGAATTCAAAGAGAT TGTTTTTGCCATATTGACAAGTG I-3E03
9   C03 I   K04F10.5    CTGGATTTCTCTGGAAAGCG    AATAAGGCCCCAATACGACC    I-3E05
9   C04 I   K04F10.6    GCCTGGCACCAATGTAGTTT    TTTAAGGGATCACGAGGACG    I-3E07
9   C05 I   K04F10.7    CGACTCGCTCGAGTTCTCTT    CCAGATTGTATTGGTCGGCT    I-3E09
9   C06 I   ZC308.1 AGTACGGCCGTTGGTATCAG    ATGTTGCTGCTGATTGTTGC    I-3E11
9   C07 I   ZC308.2 CGACCCGTCAATTTCCTCTA    CTGCGGCCAATTATGAAACT    I-3E13
9   C08 I   ZC308.3 TGGAAATTCTACCGTACGCC    CAACTGGCATCGTTTGATTG    I-3E15
9   C09 I   ZC308.4 TCTTCATCATGACCACCGAA    TTCATTTTGATTGCCGTGAA    I-3E17
9   C10 I   ZC328.1 ATCCACCAAATCTTTGTAACCCT GATGACTCTCTGAGTTCGACGTT I-3E19
9   C11 I   ZC328.2 GAGTTCTCCGATGAGTTCGC    TCACCACCTGGTCTCTCTCC    I-3E21
9   C12 I   ZC328.3 GACCTCATTGGGTGTGGACT    TTTGAAAATTTCGTTTCGCC    I-3E23
9   D01 I   ZC328.4 AACGAAACAATGATGACGCA    TTTCGATGTGAGCATGAAGC    I-3G01
9   D02 I   ZC328.5 TGTGTTTTGTTACGTTTCTGTGC AGAGACCATACAACGTTGAGGAA I-3G03
9   D03 I   R10A10.1    GAGAGATCACAAACATAAACCGC CCATAAAATTTCCCAATTTCCTC I-3G05
9   D04 I   R10A10.2    GACACGTTTGAAGACTCCTTGAC ACCGGTCTTAAATTGCCAATAAT I-3G07
9   D05 I   F37E3.1 CGAAAAATATCGGGCTTCAA    ATTAAACCCCCGCTAAATCG    I-3G09
9   D06 I   F37E3.2 AACATAGCCATCACTTCGGG    AATTTCCATGGATCTTTGCG    I-3G11
9   D07 I   F37E3.3 GCCCCAGAAATTTGTCTTGA    TCGATGGAAAATGATGACGA    I-3G13
9   D08 I   T23H2.1 GGCTCAAGACGAAACTGGAG    TTTCATTATCCGGGCTGTTC    I-3G15
9   D09 I   T23H2.2 GGCTCTGGCAAATCCAATTA    GACGAAAGGAACTGCGAGTC    I-3G17
9   D10 I   T23H2.3 TCTCCAAAATTTCACGAACAACT ATTTTCCGCGATTTCATTAATTT I-3G19
9   D11 I   T23H2.4 CCCTGGAATGCCTACAGAAA    TGTGTCCTTTGAAACTTGCG    I-3G21
9   D12 I   T23H2.5 TGAATACCCGGATGAAACATTTA ACCGTATGACATGCTCTTCAAAT I-3G23
9   E02 I   K06A5.1 AGACCACCAACTCAAATGGC    AACAAGACACCCGTCCAGTC    I-3I03
9   E03 I   K06A5.2 AAAATGACGATGAGCGATCC    TCAGCATTTCCTTCCAATCC    I-3I05
9   E04 I   K06A5.3 TTTCTCAGGACTGCAAAACAAAT CTTAATCCGAATCAGCACAATTC I-3I07
9   E05 I   K06A5.4 GCGTGAAGAACAGCAAACAA    TTCTCACGACGTACAATCGC    I-3I09
9   E06 I   K06A5.6 AAACGCCGTAGGAGATGATTATT CGAGATTCCAGAAAAGTATGGTG I-3I11
9   E07 I   K06A5.7 TTTCTCCATTAGGTTTCAACGAA TGTTTGATTTGGATTCTCTCGAT I-3I13
9   E08 I   K06A5.8 TTGGGAAGAGACCAAAGCAC    TTGATGGCATTCAATGAGGA    I-3I15
9   E09 I   C55B7.1 AGTGGTAACAATGGTGAATCTGG CCTCTTCACAGAAGTGCTTGATT I-3I17
9   E10 I   C55B7.2 GGCCAACGAGCAAAAACTAA    TCAAAAACCGGCTAAACTGG    I-3I19
9   E11 I   C55B7.3 CAGAGAGTGCAAACAGCAGC    ACAGATACTGGGCATCCGTC    I-3I21
9   E12 I   C55B7.4 GGAGGCTCTGGATCCTCTTT    CCATTGCAGCTTCTCGTACA    I-3I23
9   F01 I   C55B7.5 TTCGCACGAATCAAGTTACG    TGCCTGGAAGCTCTGAATTT    I-3K01
9   F02 I   C55B7.6 ATCGGATTATGGACCCTTCC    CAACCGCCTGTTTGAAAAGT    I-3K03
9   F03 I   C55B7.7 ATCCAATTGCCTTCGAACTG    GCTACTCCGCCATCAATGTT    I-3K05
9   F04 I   C55B7.8 ACTTTCTCCCAGGAATCGGT    CATGAAGGTTCGCATCAAGA    I-3K07
9   F05 I   C55B7.9 CTTCCAGTAATCGACTTTTTCCA AAAATATTCGGGAGTGTTGGTTT I-3K09
9   F06 I   C55B7.10    AATAAAGCCCTCTTCCAGATGAC TCAAATTTCTTGCACTGTTCTGA I-3K11
9   F07 I   C55B7.11    ATCGGATGTTGCTTCGGTAG    ATCGCACTTTTTGCCATACC    I-3K13
9   F08 I   C55B7.12    AAATATTTTGCAGAAAATGGCAA ATTGCTTCGATCAAGGAGTATGA I-3K15
9   F10 I   T10E9.2 TCAAGTGGCGTTGTTGTCTC    TTCGTTCCGTGGTAGTTTCC    I-3K19
9   F11 I   T10E9.3 ATGCAAAGAAAGGACGTTGG    TTCCCAAATACTCGGCAAAG    I-3K21
9   F12 I   T10E9.4 CGAAGACTGTGGCAATGAGA    AACCGCAAATGAGGAAGCTA    I-3K23
9   G02 I   T10E9.6 GTGTCTGGAATGGTATGGATTGT TGGAAAATCATTCCAATATGAGC I-3M03
9   G03 I   T10E9.7 GTGTTGGCTCAGCAACTTCA    TTGGGTAGTGTGATCCGTCA    I-3M05
9   G04 I   T10E9.8 TTGAAAATCCTGTATCCCAAAAA TTTTCCGAATAAATCCCAAAACT I-3M07
9   G05 I   T10E9.9 TCCGTGTTGCTTCATACGAG    ACGTTTTTCGATGCTGCTCT    I-3M09
9   G06 I   F57B10.1    ATTGGAAGATCGTGTCTCCG    GGACCAGCAGTAGACCAGGA    I-3M11
9   G07 I   F57B10.3    TGTTGAAGTTGTTCGCAAGC    TTCTGAACAATCGAGACCCC    I-3M13
9   G08 I   F57B10.4    TAGGCGATTTTCGTTCTTGG    CTCTGGGGTGTCAGATCGTT    I-3M15
9   G09 I   F57B10.5    CTAGTGTTCTGTTGGCATTTTCC ATTGAAAAATGATTTGAGCAGGA I-3M17
9   G10 I   F57B10.6    CGGATATTTACGGTTTCCGA    CACCAATGGCTCCAACTTTT    I-3M19
9   G11 I   F57B10.7    TTGACACCGATGGTCTACGA    TTTCCTTATCCCATTGCTGC    I-3M21
9   G12 I   F57B10.8    TGAAGATAACAATGATGACGTGC ATTTTCAGAAATGCTTGAACCAA I-3M23
9   H01 I   F57B10.9    GATTCGCAATACTTCGGCAT    CGACTCCTTTGGATCTCAGG    I-3O01
9   H02 I   F57B10.10   TGTAACACAGCAAGAGAAACGAA AGGATTTATACTTTGCGGGACAT I-3O03
9   H03 I   F57B10.11   CATAACATAAAAACCCGAAGCAA TCTCCCACTGCTAAAACTGTCTC I-3O05
9   H04 I   F57B10.12   GGTGATAACCATCGGTTGAATAA GAATTTCTTTTATGCGGGAAAAC I-3O07
9   H05 I   F48A9.1 GCAAACCCCTATATCCCGTT    AAAGCATGCACAACCAACAA    I-3O09
9   H06 I   F48A9.2 CTAAAAATGTGGGTGGTTGTGAT TGATGTTACTTTGATTTGCGATG I-3O11
9   H07 I   F48A9.3 TCAACACCTACACCAATGTCAAG TAATGTTTCTGCGAAAAAGGAAA I-3O13
9   H08 I   D2092.1 GCTGGCAAGAACATTCACAA    AACCGTCCAGCACTGGTATC    I-3O15
9   H09 I   D2092.2 GGTGGATCAGGAGATGCTGT    TCGTGCTCCTCGCTTTATTT    I-3O17
9   H10 I   D2092.3 CCAATGTTTTGGCAAGATGTATT GAGTAATCAACCAGCAAAAATGC I-3O19
9   H11 I   D2092.4 CACGAATTCTATAGGCCTTGATG GAATTGATGAGATCCTTCGTGAC I-3O21
9   H12 I   D2092.5 TCTCTCCAGCCAACGATTCT    TGGTGATAAAAAGAACGGGC    I-3O23
10  A01 I   D2092.6 GATTTCCTCACCTTTGGCAG    ATCTGCCTGCACAGCTTTTT    I-3A02
10  A02 I   D2092.7 ATCTTGCATTTTGGATTGCC    CACCAGCTACAAAGCGATCA    I-3A04
10  A03 I   D2092.8 AGATTCACACCGTCAACTCTCAT CTTTTCGTTGTCAGGATTTTCAG I-3A06
10  A04 I   ZC581.1 GACGTGGTGCTTTTGGAGTT    CCGGTCTCTTATCCGTGTGT    I-3A08
10  A05 I   ZC581.2 TGGAAACTTTGGAGCGTTCT    GTTTCCAGGGAAGGTTGACA    I-3A10
10  A06 I   ZC581.3 GAATGCCGATTTTTGCATCT    GAGAAACCCCACACCCTGTA    I-3A12
10  A07 I   ZC581.4 TTAAGAAATTGACTGCCGGAATA CAGCATTTCCTTAAAATTACCCC I-3A14
10  A08 I   ZC581.5 AATCAGCAGACAACACGGTTATT AGTGAGAAGACGAACACACAACA I-3A16
10  A09 I   ZC581.6 CGTTACCACCTCGTCGTTTT    CATGTGGAAAACCATTGCAG    I-3A18
10  A10 I   ZC581.7 CATTCCTTTTGGAGTCGGAA    TTGAACAAAATGGTTTGCCA    I-3A20
10  A11 I   ZC581.9 CTCACAATCCCGTTGGTTTT    TCCAGCAATAATGGGTCTCC    I-3A22
10  A12 I   C17F3.1 AGCGTGTAACCTTTTGAAAACAA AAACAACAGGGCTCAATCAAATA I-3A24
10  B01 I   C17F3.2 TAAGACGATTCTTCGTCCTTGTC ATTGTGCTCTTGGAATGAGGTAA I-3C02
10  B02 I   C17F3.3 TTCCTACGATTTCGTTGTTCAAT TAAAGTTGGGTACCGCTTATCAA I-3C04
10  B03 I   T23B3.1 AGATGGCAATCATCTCAGGG    CCATCAAATTTCCACCCAAC    I-3C06
10  B04 I   T23B3.2 CCTCATCAAGTTTCCATTTTCAG TACGAGCAGTTTCAGGTTTCTTC I-3C08
10  B05 I   T23B3.3 TTCAAGTCGTTATCGTTTGGAGT GTGTGTGTGTGAACAGCAGGTAT I-3C10
10  B06 I   T23B3.4 TGAGTTGGAGATGAAGGGCT    CGCTAACCCTGGAAAATTCA    I-3C12
10  B07 I   T23B3.5 GTTACGATTTGAATAGACCGCAC TTCACGGGAAAATAAGAAAAACA I-3C14
10  B08 I   T23B3.6 CGGATGTCTTTGCCTTCATT    AAAGTCGGCAACGTTCAGTT    I-3C16
10  B10 I   W02D3.2 AGACGGCGAGACACAAGTTT    AACTTGAGGCTGCTTTTCCA    I-3C20
10  B11 I   W02D3.3 AAGAACGGAGGAAGTGCTCA    TTCGTTTTGCGTCATATCCA    I-3C22
10  B12 I   W02D3.4 ACATTGCAGCTCCCAGAAGT    TTTCATTGTTTTTGCCACGA    I-3C24
10  C01 I   W02D3.5 CGGATCCAGATTCAAGAGTAGTG TGAACTTTTTACCTGCTTTTCCA I-3E02
10  C02 I   W02D3.6 AGCACAAGAGCACCTCCAGT    TTCTTGTTGATCTCGCCTCC    I-3E04
10  C03 I   W02D3.7 GCTATTTATTGCATCAAAGACCG TCCAAATTTTCAGAATGTCTGCT I-3E06
10  C04 I   W02D3.8 CCTCCCGGTTAACTTCATCA    CAAGAAATGCTTTCGCTTCC    I-3E08
10  C05 I   W02D3.9 ACGCATGATTCGTGTTGTGT    AATAGTGTTGCCTCATCGGG    I-3E10
10  C06 I   W02D3.10    GGGCGACTAAGAATACGACG    TTTCGGTGCCAAATTTCTTC    I-3E12
10  C07 I   F08B6.1 TTCCAATATTTGCTAAAAAGGCA GATGCGACAAGCCATAGATTTAC I-3E14
10  C08 I   F08B6.2 TTCAATTTCCATGTCTTCTTCGT AAAATCGGCGTTTGGATTAGTAT I-3E16
10  C10 I   F08B6.4 AAGGTTCTCAGACTTGACACGAG TCTCTCTCTTTTCTGTGCATTCC I-3E20
10  C11 I   F08B6.5 ATTGATTTGAACGATCATTTTGG AACCCACTGATCTTGTCTTGAAA I-3E22
10  C12 I   C37A2.1 ACAAGAAGGTTATGGTGCCG    AGCGTTTGGTGAATTTTTGG    I-3E24
10  D01 I   C37A2.2 ACATCACAAGAAAATCCGAGAGA TGTACAGGTGGTTGTTGAAGTTG I-3G02
10  D02 I   C37A2.3 CACCTGCACTTGCACAGTTT    CATCATGACCTCATCGCAAC    I-3G04
10  D03 I   C37A2.4 AAACGAGACGAAATTCCACG    TGAATCCTCTCTCGTTCGCT    I-3G06
10  D04 I   C37A2.5 TCTTACTTTTGCCCGTTTCG    TGTCAGACGATGAGGACGAG    I-3G08
10  D05 I   C37A2.6 CAAAGTTCCGATGCATCCTT    GTTGAAGCCCAGCCTAAATG    I-3G10
10  D06 I   C37A2.7 AACAATTCTACATCGCGACTTTC AATTTATCTTCCATCGCGAATTT I-3G12
10  D07 I   C37A2.8 GCATGCTGAAATTGGGAAAT    GACCGTCGGAAAAATCTGAA    I-3G14
10  D08 I   E02D9.1 CGAGCCCATCCTCTTTACAA    TAACCCGGTCCACTATTCCA    I-3G16
10  D09 I   E02D9.2 GCGAGAAATGAATGGTGTTTTAG CTGGAAAAACAACAAGAACAAGG I-3G18
10  D10 I   K02F2.1 TCCACTCAATGAAGCACTCG    CGTGGCGGTCTGTAATTTTT    I-3G20
10  D11 I   K02F2.2 CGAAACTTTTTCCAGGTCCA    TCCGTATGGGGTAGAACCAA    I-3G22
10  D12 I   K02F2.3 ATGGCAGTTTCTGATTTGCC    TCGCATAGCTGAGTGGTGTC    I-3G24
10  E01 I   K02F2.4 GGGACGAAATGAAGATCGAA    GTTGTCGTGGCGTTTCACTA    I-3I02
10  E02 I   K02F2.5 TCCTTTCAACCAATTTTCAGAGA ATTTATGGCTTCTTTCGGAACTC I-3I04
10  E03 I   K02F2.6 GAATCAACCGAACTTTCACTGTC CGTTCTAACCGTTTTGGTTGTAG I-3I06
10  E04 I   T21G5.1 CAACAATGGACGCAAAGCTA    CAGCTGGAGCACCAGATACA    I-3I08
10  E05 I   T21G5.2 CGAACAAAAGTCTCAAAAATGCT GAACCTGCAAAACACGGATATAA I-3I10
10  E06 I   T21G5.3 GAGCCGAGAGGTTTTATTTTGAT AATAGTTTCGATGTCAGTTCCGA I-3I12
10  E07 I   T21G5.4 AAGATGACTCCAATGGGCAC    ATCAATCGCCTTTTGAATCG    I-3I14
10  E08 I   T21G5.5 GTCTCACGTAATACCCACCATGT AAAACCAAATTGGGAACATCTTT I-3I16
10  E09 I   C48B6.2 TCCTCCCAATTGTAATGAAGCTA GAACAACAACAGCAACAAATCAA I-3I18
10  E10 I   C48B6.3 AATCATCACTCGAGCTGTTCTTC TTGGGGTCAAAATTTATTTCCTT I-3I20
10  E11 I   C48B6.4 CGACGATTGACAGATCCAGA    TGACGATTTCGTGGAAATGA    I-3I22
10  F01 I   C48B6.6 AAGAACTGCTTCCAAGGCAA    ACAAGTTTTGGAGCCGAAGA    I-3K02
10  F02 I   C48B6.7 CCAGCAAGTGTTGCTTGGTA    AAAACCGCGATAATCGAATG    I-3K04
10  F03 I   C48B6.8 GGTTGCAGTATGGTGCATTG    GCCCTGGTACGAAATGGTTA    I-3K06
10  F04 I   C48B6.9 TGTCTGCTCCGTCATTTTTG    TAGGCTCAAAACTCGCCAAT    I-3K08
10  F05 I   T10B11.1    TATCAGTTGCCCTTGATCTGTTT TGATTTCGTGAGTGTGTGTTGTT I-3K10
10  F06 I   T10B11.2    AGCGGAAAGGAAATGTTCAA    TAACAACGGCATTGAATGGA    I-3K12
10  F07 I   T10B11.3    ATCATCGAACTGTTCCGTCC    ACCAATGTTTCCAAACCCAA    I-3K14
10  F08 I   T10B11.4    ACGCATTCCCACTTTTTCAC    TAGTCTAACATCCGTCGGGG    I-3K16
10  F09 I   T10B11.5    CTTGATTGCCGGTTTCCTAA    TTCAATTCACAGCTCTTGCG    I-3K18
10  F10 I   T10B11.6    CTAACAAAGTTCAGGCAAGCTGT TCGTGAAAAGTCGAAAACATTCT I-3K20
10  F11 I   T10B11.7    CATACCATCGCCAGGAAGTT    TCAATGGATCGAAAGGAACC    I-3K22
10  F12 I   T10B11.8    CTTCTTTGCCAAATCCAAGC    CAAAGGTCGCAAAAATTCGT    I-3K24
10  G01 I   T10B11.9    TGAAAATGTACACGTGAACGAAC GCACTTTTTCTCACTTTTGGAGA I-3M02
10  G02 I   C30F12.1    TTTTTCTACCATTTGTTTTGCGT TGGTACAATCAATGTCAAATCCA I-3M04
10  G03 I   C30F12.2    ACATGATTTCCGTCTCCAGC    GCCCAGTCCGTTGTGATAAT    I-3M06
10  G04 I   C30F12.3    TTTTATTCAACAAGTGTGCATGG AGCGTGACGAGTGATTTTTAGAG I-3M08
10  G05 I   C30F12.4    TGGGAAATTGGTGCCATAAT    TCGACGCACTTCTCACAGAC    I-3M10
10  G06 I   C30F12.5    CGAAAATTGTGAGAAATTTTGGA TTTTTGGCAAATATTGCAGTTCT I-3M12
10  G07 I   C30F12.6    CCATGTGCACTGTTAAACGC    AATGTGCTTTTACCCGGTTG    I-3M14
10  G08 I   C30F12.7    ACAAAACACGACGATCCACA    ATGTTTTGGGTTCTCGTCCA    I-3M16
10  G09 I   H06O01.1    TTTCCAACGGCAACCTTAAC    GTTCCAGCCCAAGACTACGA    I-3M18
10  G10 I   H06O01.2    TTTGCACCAAGCGTATACCA    TATAGCGCCGAGTGGTCTCT    I-3M20
10  G11 I   H06O01.3    ACAAAATATTGCAGTCCGGC    TTCCTGTTTTCTTTGGTCGG    I-3M22
10  G12 I   H06O01.4    CTCATTTCCATTCTCGTTCAGAC GGCATGGGAATACATTTTTGTAA I-3M24
10  H01 I   F15C11.1    TCCTCCAAAAATGGCATCTC    AAGCGACTAGCCCAATTCAA    I-3O02
10  H02 I   F15C11.2    CCAACTGCGAACAAAGAACA    GCGAATTGGAAATTTGTCGT    I-3O04
10  H03 I   W01A8.1 CCAAGCCCAAAGCTACTACG    GTCCCTTCTCACGCAATGAT    I-3O06
10  H04 I   W01A8.2 GAATGCATTTTTGAATGAGCTTC CCAGACGCAGAGAAAAATACAAC I-3O08
10  H05 I   W01A8.3 TCGACATTGTCACCTCCAAA    AGCTGAAACCGTACAATCGG    I-3O10
10  H06 I   W01A8.4 ACGAGGATAACGACACAGCTAAA CTTGGATATTTTGAGACTCACGG I-3O12
10  H07 I   W01A8.5 TGGTCCAGTGACGACTTGAG    GGACGATGTAGATGGCTGGT    I-3O14
10  H08 I   W01A8.6 AATGCGAACCAAGCTGAAAT    CACTTCCAGGGAAACGAAAA    I-3O16
10  H09 I   F22D6.1 ACATTGGCATTGAGAGGTCTTTA TTGCATGATTTTCTTCAAGGTTT I-3O18
10  H10 I   F22D6.2 GAAAGGAGCGTTACAAATTGATG AAAGTGCCTACGTGTTCGAAATA I-3O20
10  H11 I   F22D6.3 CAGATAAGGCCAATCGGTGT    CTTGATAACCGCCACCTTGT    I-3O22
10  H12 I   F22D6.4 AATTGGGAAAATCTGACGAAAAT AAATTAGCAGTTGAGGTGTTGGA I-3O24
11  A01 I   F22D6.5 TCTTGCCGCTTCAATTTTCT    ATGTCTTTTGCGCACCTTCT    I-3B01
11  A02 I   F22D6.6 ATGCAAAGCCAATTCCAGTC    ATATCACGACCGCCTGAATC    I-3B03
11  A04 I   F22D6.9 TCCGGATGATCTGAAAAAGG    CACAAGCATGAAGGAAGCAA    I-3B07
11  A05 I   F22D6.10    CAGCACTTCTCTTCACCACG    ACATGCAACAAGGGACACAA    I-3B09
11  A06 I   F22D6.11    CTGTATTGCAGTTGGCGAAA    AGCAACCAACGCTTTTGACT    I-3B11
11  A07 I   F22D6.12    CAATCCGAGTCATTCACCCT    CATTCTTTCCGGTGAGTCGT    I-3B13
11  A08 I   F22D6.13    TCGATTTCTGTTCCAGTCAAAAT TGTATTTCTTTAAGCCACCGAAA I-3B15
11  A09 I   K10D3.1 CCCACACCGGAGAAATTTTA    AAGAGTCGGAGCGTGTCAAT    I-3B17
11  A10 I   K10D3.2 TCTGCACAATAGGGAAAACTTGT GTCTTGAAAAATGTGAGCCAATC I-3B19
11  A11 I   K10D3.3 CCCAGAATCAGGCACATCTT    TCAATCTACAGTACCCCGGC    I-3B21
11  A12 I   K10D3.4 GAGTGACAGCTGGTCCACAA    TGTGAATCGTCCTACCACCA    I-3B23
11  B01 I   K10D3.5 CGAATCATCAAATTTCGGGT    GGACTTTCGGGATGTCAGAA    I-3D01
11  B02 I   H37N21.1    TGGAAATTTTGAACGTTCTGTTT AAAAGAGGACAAGAATCAGGGAC I-3D03
11  B03 I   K07G5.1 GGGAGACTGCAACTCCTCAG    TCCCTCTTTCGCACTCTCAT    I-3D05
11  B04 I   K07G5.2 TTGTCAAATCGAGACCTCAAAAT TACTAGTCTTCGTGTAGCCCGTC I-3D07
11  B05 I   K07G5.3 GTGGATCGTCAGCCAAGAAT    TACCGTCTTTCCTCATTGGC    I-3D09
11  B06 I   K07G5.4 TTCGGAAATACGAGGCAAAC    GCGTTACCATGGAGGAAAAA    I-3D11
11  B07 I   K07G5.5 ATCGCCAGAAGCTCAGAAAA    GCTCGAGCGTCTGGTTTTAC    I-3D13
11  B08 I   M05B5.1 ATCCATCTGCGACAACTTCC    ACAGTTTGGGTGCAAACCTC    I-3D15
11  B09 I   M05B5.2 TGTTCCAGTTAAGGGAAATGGTA CGCTGTTCTCTGTACACTTTGTG I-3D17
11  B10 I   M05B5.3 CATTGAATGCTGGCTCTGAA    GGGTGAAGGTGAGAAGGTGA    I-3D19
11  B11 I   M05B5.4 TGAAACCACATATCGCTGGA    ATCCAAGCTCCGATGAAGTG    I-3D21
11  B12 I   M05B5.5 TGGGAATGATAGTTTGAAATGCT TCTCATTTCTCAAGTGCAAGTCA I-3D23
11  C01 I   M05B5.6 CAAAAATTCTTTCCGTTTCAGTG CAGAATGTGGGAAAACATCAAAT I-3F01
11  C02 I   C01H6.1 GAGAAATTGAAGCGTTCTGGTAA TAAAAGAGTAGCGGCCTTAACCT I-3F03
11  C04 I   C01H6.3 TCTTTCCGGATGGAATATGATAA CCTTCTGTGTCTAACCCTCACAC I-3F07
11  C05 I   C01H6.4 AGAAGCCATGTTGTTCCAGG    TAACATGAAATGATGCGGGA    I-3F09
11  C06 I   C01H6.5 ACATGTACGGAGCAACACCA    CGGAAGTTTTGAAGAGCCTG    I-3F11
11  C07 I   C01H6.6 CATTTTTCAGCGAGCCTTTC    CCCATCTTCTTCCGAATCAA    I-3F13
11  C08 I   C01H6.7 TCCACGCAGAGTCACCATAG    GATCGCATCGTGAATCATTG    I-3F15
11  C09 I   C01H6.8 TCATGTTTCCTCCCTCTGTTTTA TTTATTCAGCTTTGACTGCCTTC I-3F17
11  C10 I   C01H6.9 CGAATCGGGGTGTCTAAAAA    CGGCGCGTTATTTATTGTTT    I-3F19
11  C11 I   R06C7.1 GGGAAGAGATTGACGTTGGA    CGGTTTGTTTGTAGCCGATT    I-3F21
11  C12 I   R06C7.2 AACAAGAATGACAGGGTGGG    TCTTGTCGAACAACGCAGAC    I-3F23
11  D01 I   R06C7.3 CTGACATTCGATCCTCGACA    GAAGTTGGGCAGATCCAAAA    I-3H01
11  D02 I   R06C7.4 TTCAGTTTGATCTACCCCGC    AAAAGCCGATAAGATGGGGT    I-3H03
11  D03 I   R06C7.5 CTTGGCAATAAAGCTCTCCG    TCATTACCAGACAGCCTCCC    I-3H05
11  D04 I   R06C7.6 GCCCAAATATATTGCACACAAGT TGAGAATCTCCTTCTCATTTCCA I-3H07
11  D05 I   R06C7.7 TCAAATTCTTCATCCCAGCC    AATTTGAACATTTCAGCGCC    I-3H09
11  D06 I   R06C7.8 ACCGTCTCGTGGTAATTTCG    GAGCATCTTTGCCCCATTTA    I-3H11
11  D07 I   R06C7.9 TGTCGGTGTTGCAAGTCTTC    AGGAACTCCCTTTGCTTGGT    I-3H13
11  D08 I   R06C7.10    ATTGGCGGGTAAGTCTGTTG    CGGAGCTATCCTTCAAGCAC    I-3H15
11  D09 I   F21C3.1 TCATCTCCATCGGAAGATCC    AAAATGGTTAAGCGGGAGGT    I-3H17
11  D10 I   F21C3.2 TTAGCCGAAATTTTAAGGAGGTC CTTTGTGCACATTTCAAAACAAA I-3H19
11  D11 I   F21C3.3 ACATGATGCCACGGTTTAAAATA CAAATCACGTTATGGGTTCAAAT I-3H21
11  D12 I   F21C3.4 TCAATAACTGGTGCTGCTCG    AATCCCCAACCACAAATTCA    I-3H23
11  E01 I   F21C3.5 CATAGACGTGAGCACAAATGGTA TCTTTTCCCACTAAAAACGATCA I-3J01
11  E02 I   F21C3.6 CGGAAGTTCAAAACTGGATTGTA TTTCCGAAAATTAATGCAAAATG I-3J03
11  E03 I   F13G3.1 ACTGCCCTTGACGTATCCAC    GGGGATAATGGAGATGCTGA    I-3J05
11  E04 I   F13G3.2 TCTTATCATTCGAAAGTCTCCCA GACTTATCCTCAGCCATGAATTG I-3J07
11  E05 I   F13G3.3 ATTGAATTCAGGCTTCACGG    CGGGAGTTGGAAATACGAAA    I-3J09
11  E06 I   F13G3.4 GAACTACCTTCAATGAGTGCGAC GTTTGAGCGCACTTGATTTATTT I-3J11
11  E07 I   F13G3.5 CTTTCCGCAATGACTGGAAT    TTTGCATTTTGCGTTGTCTC    I-3J13
11  E08 I   F13G3.6 GGCCTGGCATTTCTAAAACA    CGACCAGACAGCTTGTGAAA    I-3J15
11  E09 I   F13G3.7 GGTGCATGCTGTATCCAATG    AGAAGGGACCGAACCAGAAT    I-3J17
11  E10 I   F13G3.8 CAGAATGTTCCCAGTCGGTT    GAGCATGTTCTCGATGGTCA    I-3J19
11  E11 I   F13G3.9 CTCGTTGTTGCGTAACCTTAATC ATGTAAAATCCCCAGTTTTCACC I-3J21
11  E12 I   F13G3.10    TAAAAACGATCAATTAAAGGCCA TGGAGGATGTTCTCCTTTTATCA I-3J23
11  F01 I   F52A8.1 TTTGCTTTGTGGATTTTGTAGGT ATGAGCAACGTATGGCAAATTAT I-3L01
11  F03 I   F52A8.3 AAATTCCCCACTAAAACCAGAAA AAATTTTCCAAAATCAGAGAGCC I-3L05
11  F04 I   F52A8.4 GAATTTTGGGAAATACTGGGAAC ATCACAGAGATTGGAGGCAATTA I-3L07
11  F05 I   F52A8.5 AGCTTCTTCGTCCTTCTTGAACT TTCACTCTCTTCGAATCTAACGC I-3L09
11  F06 I   F52A8.6 CGTACAGTCGCTGATCCTGA    AGGCACAGAGAAGGAGCTTG    I-3L11
11  F07 I   F07A5.1 AATCCGTAATTGGTTTCTGGAAT ATGCTGCTTTCTTCTTCCTTTCT I-3L13
11  F08 I   F07A5.2 CCGGGCATGAAACTTTCTAA    GTACTGGCGACCAGTGTCAA    I-3L15
11  F09 I   F07A5.3 TGGTGGACTACTCCAAAGGC    GCTGTTTACGCAAATGCAAA    I-3L17
11  F10 I   F07A5.4 AGGAGATGTAATACGCGAAACAA ATTTAGTTGTGAAGCGTCTCTCG I-3L19
11  F11 I   F07A5.5 ACAGAGTGTGGAAGGAAATTTGA AAGATCGTCTGACTCTGCTGAAC I-3L21
11  F12 I   F07A5.6 GAAGGTTGTTGCAAAATAGATGG CAAAAATTGGATTTTCACCGATA I-3L23
11  G01 I   F07A5.7 TGGCGATGACTCTCTTTCCT    GAAGGCTGTCGAACAGAAGG    I-3N01
11  G02 I   C15A11.1    GGAGCTTATGTGGTTTTGCTATG GGAAGAAAACATCACTCATTTGG I-3N03
11  G03 I   C15A11.2    CCATACTGTCCTTTGAGAAGTGG AATTCGGAAAATCGGACTTGTAT I-3N05
11  G04 I   C15A11.3    GAAAAATGAGGAGAACGGAGTTT ATAAAACCGAGATCTACCCTGGA I-3N07
11  G05 I   C15A11.4    TCATTTACCCATTGTTGCCA    CGGCAATCCGTTACAACTTT    I-3N09
11  G06 I   C15A11.5    TTTATCCGGAATTGTGGTATTTG ATCCGCTAATCAGATGTGAGAAA I-3N11
11  G07 I   C15A11.6    TCAAACGTCTTTTCATTGTCAAA AGGAGTGACTGAAAATTGTTGGA I-3N13
11  G08 I   C15A11.7    TCCCTTTCCGTACTCTCCCT    CGCAACAACTGGTATTGTGC    I-3N15
11  G10 I   ZK524.2 CGAAAAGATCTACGAAACAATGG AGATGCACTTCAACAAATGGTTT I-3N19
11  H01 I   T28F4.1 GAAGTCGTCAAAAAGCTCCG    TGCTCCTTCCAATTTGCTTT    I-3P01
11  H02 I   T28F4.2 ATTTACTTGCCCAAGATGCG    TACACAAAACCCTTCCTGGC    I-3P03
11  H03 I   T28F4.3 TGTGACTGGACTGCTCCAAG    ACGAAGGATCAATACAGCCG    I-3P05
11  H04 I   T28F4.4 CTGGATGCAACTGATGATGG    TCCAGCTTACTTGCCGAAAT    I-3P07
11  H05 I   T28F4.5 GATCATCTGCCAGAAGTAACCAC CGAGGGAATGTTAAATACAACCA I-3P09
11  H06 I   T28F4.6 TGTCAAATTTTGTGATTTTTCCC CTCTCCCTTCACAACAAATATCG I-3P11
11  H07 I   C26C6.1 CGTTATCCATTCCTACAGAGTCG AGCTTATCGAGTCGTCTGTAACG I-3P13
11  H08 I   C26C6.2 TGATGTACATGACATGCTGTGAA CATCTGAAATTGCAACTTTTTCC I-3P15
11  H09 I   C26C6.3 CGCCCATCTTTAAACCAGAA    GAGGACAACATTGTGGAGCA    I-3P17
11  H10 I   C26C6.4 GAACCTCTTGCAGGTCAAGC    TTGTTGGATTTCCACGAACA    I-3P19
11  H11 I   C26C6.5 TAAAGCGTTCGTTTTTCGCT    GAGCAAGTGCTCTGAAGGCT    I-3P21
11  H12 I   C26C6.6 TTTGGAGATTACCATGCAGAGAT AAAAATTGTTCCGAAAGGGACTA I-3P23
12  A01 I   C26C6.7 TGCCACTTGTCCAAAATTCA    CCCAAAAATCACCTGCTCAT    I-3B02
12  A02 I   C26C6.8 CTGGTCTTCCAGTGCATTTTATC TTTTCCAAATTACCCCAATTTCT I-3B04
12  A03 I   T25G3.1 ACAGCGCAAAGAAAGATAAACTG CGCTTTATTCAGCGAAGGTAATA I-3B06
12  A04 I   T25G3.2 CCAAGTACATGTCGATTGCG    TTCGTCCATCGGAAGTTTTC    I-3B08
12  A05 I   T25G3.3 CGCACCCCTTTTTCAAATTA    CAGCCTCTTTCATCTCCTCG    I-3B10
12  A06 I   T25G3.4 GTCACTGGAGGAGAATGGGA    GCGAAGATCGTTGACTGTGA    I-3B12
12  A07 I   D2030.1 TTCCGCTTGCCCAACTATAC    TGCGCAGTTTTCCATGTTAG    I-3B14
12  A08 I   D2030.2 GGACCATCTGGAGTTGGAAA    GTCTCTAAGCGACAGCCGAC    I-3B16
12  A09 I   D2030.3 TCATAACAGGCAACAACAAGAAA ATCTAATTTTTCACAGATCGGCA I-3B18
12  A10 I   D2030.4 CGAGAGAAAAAGAAACGAAACAA CAACGACACTCCGATATTACACA I-3B20
12  A11 I   D2030.5 TGTGTAATATCGGAGTGTCGTTG TGCTAGATTTTGGGAACAAAGAA I-3B22
12  A12 I   D2030.6 AGTGTGCTTTGCGATCTCCT    AATGGCATCTGGAAGTGGTC    I-3B24
12  B01 I   D2030.7 CCAGTTCGAACCATGGAAGT    AAAAGTGAGGAGGCGTTCAA    I-3D02
12  B02 I   D2030.8 TCCAGTGCTCACACTTCCAG    TTCTGCGACAAAACATAGCG    I-3D04
12  B03 I   D2030.9 TGCACCCAACTTCGTAATGA    TAAAAGCGCACAGCTTCTGA    I-3D06
12  B04 I   D2030.10    TGGATGATTTGTCAGCGGTA    ATTGGGGACGTGTTGATTGT    I-3D08
12  B05 I   F29D11.1    GTGACGTGGCAGTCTTCTCA    TTGCAGCCAATCCAATATCA    I-3D10
12  B06 I   F29D11.2    TTGTAACCATTTCATGGCGA    CATGCACCAACAGATCAACC    I-3D12
12  B07 I   F26A3.1 GTCCCGCATGGAGTATCCTA    GTAGCAGGGAAATGGACGAA    I-3D14
12  B08 I   F26A3.2 TGGATTTGGAAACGATTATTGAC CTCGGGTTTCAGTTAAACAACAC I-3D16
12  B09 I   F26A3.3 ATCCGATCCGAACCATTACA    CAATTTTCATCCCAAATGCC    I-3D18
12  B10 I   F26A3.4 AGATTTCGACCCGTATTTCTGAT AATGTTTCCCCAAAAAGGTAAAA I-3D20
12  B11 I   F26A3.5 CGTCTACCGACGGAGAAGAG    AGTTGTTGGGCAGGAATCAC    I-3D22
12  B12 I   F26A3.6 TAGCCCCCTACACCTCACAG    TTGTGCTCTTTGCCCTCTTT    I-3D24
12  C01 I   F26A3.7 CCACGGACTTCCATGTCTTT    TGAAGTGGATGACGAAGCAG    I-3F02
12  C02 I   T23G11.1    GCTCTGGAAAAGGAGATTCTAGC ACAGCCGATTATTCTCGATTACA I-3F04
12  C03 I   T23G11.2    CGATGAAATCCTTCTCCCAA    TTCCACGAAGTCCACATTCA    I-3F06
12  C04 I   T23G11.3    TGACGCTATCGACGAACAAC    AGTGAGAGTGGGGCTCTGAA    I-3F08
12  C05 I   T23G11.4    TATTGCATCCAACAATCTCACAC GTATCTCAATTTATCGACGCTGG I-3F10
12  C06 I   T23G11.5    TGGTACGAAAAACCAAAGAAAAA AAAGAAGGGGAGTGTGAGTTAGG I-3F12
12  C07 I   T23G11.6    ACGAGAAGGTCTGGCTGAAA    GGAATCTTCCAACCACCTGA    I-3F14
12  C08 I   T23G11.7    TTGGTCCTGTGGAGACAACA    AAAAGCATACGGACACTGGG    I-3F16
12  C09 I   T23G11.8    GGATCCAGTGATCGTCCTGT    TACGGGAAAAGTAACAGCGG    I-3F18
12  C10 I   T23G11.9    ACAATTGATGGTGGGTTAGTCAC CTTGATGATTTTCACGTCCTCAT I-3F20
12  C11 I   F27D4.1 GCAAAAGTGAATGGAGTGAAAAG GGCTGTTTATTCACATTGAAAGC I-3F22
12  C12 I   F27D4.2 GAGGTGAATTCGTGGCTGAT    TCTACAATCACGTCGGACCA    I-3F24
12  D01 I   F27D4.4 GCAACAAGGGCCTAGTAAAAAGT GAAAAGATCACGTCCAGACATTC I-3H02
12  D02 I   F27D4.5 TTGCCCGATTCATTTATCTTTTA GGCAACAAGTGTCAAATCTTTTC I-3H04
12  D03 I   F27D4.6 TTGTTGACTGGAAATGCGAA    TGCGATACGATCTTCGTCTG    I-3H06
12  D04 I   F58H10.1    TTCTCCAACTCCATGACAATCTT AAAATCCAGGGGTTAACTTTTGA I-3H08
12  D05 I   ZK1014.1    CGATTCAGCGATTCATCAGA    CAAGTGGTGCATCCAATACG    I-3H10
12  D06 I   H15N14.1    CGATTCAGCGATTCATCAGA    CAAGTGGTGCATCCAATACG    I-3H12
12  D08 I   D2005.1 ATCTCTTTCGCCTTCGCATA    AAGAAATTCAACGTGCCACC    I-3H16
12  D09 I   D2005.2 AGAGATGCCAGTTGTTCAAGAAG TAACAAAAGCGACATGAGTCAGA I-3H18
12  D10 I   D2005.3 AATTTATTGAAGCCATGAAAGCA GCGAATTCTCTGGAATTTATCCT I-3H20
12  D11 I   D2005.4 AAGGATGAAATTGCCAAACG    CTTTCACATTGTCGGGGTCT    I-3H22
12  D12 I   D2005.5 CGCTCAACGTGTCAGTGATT    CTTGCAATGGAAGCATTTGA    I-3H24
12  E02 I   F30F8.1 AAATGCTTGGACGGTAGACG    TTTCAGATTTATCCCAGCCG    I-3J04
12  E03 I   F30F8.2 CAAAAGGAATCGTTTAATTGCAG CGTTCTACCAACTTAGGCTCAAA I-3J06
12  E04 I   F30F8.3 ATAAACTTTGCGCGTCGAAT    GTGCCAACACTTTAGGCCAT    I-3J08
12  E05 I   F30F8.4 CAAACCGGAATTCAAAAGGA    CACTACAACCATGGATCCCC    I-3J10
12  E06 I   F30F8.5 AGAGATAGCCCCAATTAGACCTG TAGACTGGAGAGACAGATGCACA I-3J12
12  E07 I   F30F8.7 AAAATTCCGAAGATTAGGTCTCG GACAACACATCATGCACAAAACT I-3J14
12  E08 I   F30F8.8 TGCAATGGATCCGATGAATA    CCGATTTCTCCGATCTTCAA    I-3J16
12  E09 I   R11A5.1 AAAGTTGATGCAATGAAACGAAT AAAACGGGGAAAGTGACTCTAAG I-3J18
12  E11 I   R11A5.3 ATTCCACAGGAATTAGTTGCTCA TGTTTTTGTTGTTTGTAGGGACC I-3J22
12  E12 I   R11A5.4 CGATATCACCACATGGCTTG    GTGAAGCGAAGAAAAGGCAC    I-3J24
12  F02 I   R11A5.6 AAATTGCTTCTGATTTCATTCCA CATTTGAACATTGACCTTTCCAT I-3L04
12  F03 I   R11A5.7 GTGACGTTTGATGAACGACG    GACTGGGCAAAATCTGCATT    I-3L06
12  F04 I   F55D12.1    GTCACTTTGCTTATTGAAATGGC TGGTGTTTAGCCTTCAGAACAAT I-3L08
12  F05 I   F55D12.2    AATTTCCGTCTCCAATTCAAAAT ATACGCGTGATCTGCATTAATCT I-3L10
12  F06 I   F55D12.3    CGTCCCCATCCTATCAGAAA    TTTGGTGCTGCTGAAAATTG    I-3L12
12  f07 I   F55D12.4    TTTCTCAGCGAGACCCATCT    AGACCGCAGTTTCAGCAGTT    I-3L14
12  F08 I   F55D12.5    AAAGAAAACCCGAAAAGAAACTG TTTTGTATATTGCGTGTGCTACG I-3L16
12  F09 I   F55D12.6    AGCCCATAAGTCAAATCTTGTCA CTAAAATTTCAGATGCAGGATGG I-3L18
12  F10 I   F20G4.1 AGCTTTTTCAGCGAGTTCCA    TTTCGGACCATTTCAAGTCC    I-3L20
12  F11 I   F20G4.2 GCTATGCAAAGCCGATGAAT    TCGGAAATCAAAACTCCCAC    I-3L22
12  F12 I   F20G4.3 TCCGAGAAGTGAAGCGATTT    TATGCAGAACGTCTCAACCG    I-3L24
12  G03 I   T22C1.5 TATGGACAGCATATTCAGTGACG GGTCCCAAAATAAAACCGTTAAA I-3N06
12  G04 I   T22C1.6 CGTACCGAAGAAGCCAAGAG    TGGAAGGAGACGAAAAATGG    I-3N08
12  G05 I   T22C1.7 CAATGAAAACGAAACGTACACAA TGTGTGAAAGAAGTGATGGATTG I-3N10
12  G06 I   T22C1.8 TCTCGTGTCCCTTTGTTTCC    GAAGCAATGACTTTCGGAGC    I-3N12
12  G07 I   T22C1.9 ATTTCTGCCAACGAACTTAAACA GCTCATCAAAGCTTTTTCTACGA I-3N14
12  G08 I   T22C1.10    TCACCTGCATCAATCCAAAA    ACAAAAGAAGACGGCGAAAA    I-3N16
12  G09 I   T22C1.11    TGCTTTGCTCGATACATTCG    TGCCAAGAAACGGGTAGAAG    I-3N18
12  G10 I   H05L14.1    TTTTCCCAACCCAATCACAT    GGAGCCATCTAATCGTGGAA    I-3N20
12  G11 I   H05L14.2    CTCCTCATCCCACAGATGGT    AGCTCATCGCCATCAAATTC    I-3N22
12  G12 I   C54G4.1 TTTAATGATTCCAGGTCGCC    TTCACGTTGAGCCTGACTTG    I-3N24
12  H01 I   C54G4.2 GTCGGCTTCAATAACACCGT    CATTGCCGTTTTCTTTCGAT    I-3P02
12  H02 I   C54G4.3 TAGAAGAGTTGTTGGCGGATTTA CGATTATTCTCAAGTTGGTCGTC I-3P04
12  H03 I   C54G4.4 ACACGTGTAATTCGCTGCTG    GGCAATGTGCTCAGAGTCAA    I-3P06
12  H04 I   C54G4.5 TATTCTTGTCCGTCCTCCTCATA ATTTGAAAATCAGGTCAGGGAAT I-3P08
12  H05 I   C54G4.6 CGTGAAAACCTGATGTAATGTGA AAGATTTATTTCGGTTTCAGGGA I-3P10
12  H06 I   C54G4.7 TGGCTTCTTTCATTCCGAAC    GTGTCCCTTGATTTCGCAGT    I-3P12
12  H07 I   C54G4.8 TTTCTGCGACTTCGTGAATG    CGACGTGGTACGTAATGCAG    I-3P14
12  H08 I   C54G4.9 AACAACTTGCGGTTCCAAAC    GGATCCCCAATATTTCAGCA    I-3P16
12  H09 I   K04G2.1 GCTTTCCTACGACAGCCTTG    AAAGAGAAATCGTGGCGAGA    I-3P18
12  H10 I   K04G2.2 ATCAGGAAGTCGATATGGCG    AAAACACGCGAATTGGGTAG    I-3P20
12  H11 I   K04G2.3 TTCTGCTTCAATCGGGAATC    CGGCAACCAGTTCGAATTAT    I-3P22
12  H12 I   K04G2.4 GCCGACAAAATACCAGGAAA    CTGTCCAACCTCCATTCGAT    I-3P24
13  A01 I   K04G2.5 AATTCCTCCAAGTTTCTGTGGAT AAAGTTTGCACAGTCTGGAAGAG I-4A01
13  A02 I   K04G2.6 TCGCACTGAGCCAACATTAC    CCATCCCTGGTGCTAACAGT    I-4A03
13  A03 I   K04G2.7 TGAGTCATCATTGTTTCGTCATC GTCAAGGGTATTTGTGTTGGGTA I-4A05
13  A04 I   K04G2.8 GAACATCATCAATTGACGTCTCA GACTTTCCATTCGTTGATACTCG I-4A07
13  A05 I   K04G2.9 TGTTTTATTAGAAATCGGCAGGA CCATTCACTCATCAATTCCAAAT I-4A09
13  A06 I   K04G2.10    GGTGCGAGAGGAACCAGATA    CCGATTGAAGAAGTGCCATT    I-4A11
13  A07 I   F18C12.1    TGATGAAGCCAATTGTTGGA    TTTCGATTGACCCGTAGGAG    I-4A13
13  A08 I   F18C12.2    GAAGTTTGACCAGCTTCGAGTTA TGTATTAATCTCGTTCGGCTGAT I-4A15
13  A09 I   F18C12.3    CCCTACACAAGTCTACGGTGAAC ATAGAGAGCTGTTTGAAACCCGT I-4A17
13  A10 I   C09H6.1 ATTTGGAGAAGCTTGCAGGA    TTTTGGTCGACTTCCAAAGC    I-4A19
13  A11 I   C09H6.2 GAAGTTCTCTGCTCCCGTTG    TTTCTCGGCATAAATCGACC    I-4A21
13  A12 I   C09H6.3 TGGGCACATTTTACACGAGA    TGTTCGATTTGACCATTCCA    I-4A23
13  B01 I   T28B8.1 TATCTCTTCGCATCACTCTCCTC TAAGGCAAAGGAAGCAGTAGTTG I-4C01
13  B02 I   T28B8.2 GAAGAAACATTGCTTTCAAATGG AACAGGGATGTGATATTCATTCG I-4C03
13  B03 I   T28B8.3 TTAGATCTCAACCCGCCAAC    GGAACTCTCGCACTGTTTCC    I-4C05
13  B04 I   T28B8.4 TCTACCTCGACTGAGCCGTT    ACTACCCCATGCATCTCCAG    I-4C07
13  B05 I   T28B8.5 AGAATGAGGCTTTGGTGGAA    ACCGTATCCTGGTGAACTGC    I-4C09
13  B06 I   F08A10.1    CATTTTATCCGCTCACTCGTTAC TGTTTTCAGGTTGAACGAAACTT I-4C11
13  B08 I   T02E1.2 GTCTGCACAGCGAAAGTGAG    GGCAAGGTGATTTGAAAGGA    I-4C15
13  B09 I   T02E1.3 TCATTACCATGGAACTGGAAATC ACTGAATTGGGTGAGAAATGAGA I-4C17
13  B10 I   T02E1.4 GGATACCATCCACAAAAGTACGA GCATTTCTTCGACCAAAACTATG I-4C19
13  B12 I   T02E1.6 ATTCTTGCGATTTCGTGATTAAA AACTAGAGATCATCCTTGAGGGC I-4C23
13  C01 I   T02E1.7 CAGGGCCCGTATGAATAAGA    ACGAAGCCCAGGGTTAGAAT    I-4E01
13  C02 I   T02E1.8 TTTCACAACTACCGCCCTTC    GCGAGAAGAAACTTCCGTTG    I-4E03
13  C03 I   ZK265.1 GGGTCCAACTGTCATCGTCT    CTGGCACCAAGTCAAAATCA    I-4E05
13  C05 I   ZK265.3 TTCCTGAAGCTCCTGTTCGT    TGCTGCAGAATGTGGCTACT    I-4E09
13  C06 I   ZK265.4 TTTGCGATTTACCAGAACTGATT TTCCCATCACACAGTTCTTCTTT I-4E11
13  C07 I   ZK265.5 AACGAGGCAATAGAGGGGAT    TGGCTTTTGTGACTGTGCTC    I-4E13
13  C08 I   ZK265.6 CATCAAGTTTCTCTTCCATTTCG GTCCCCCATAACAGTATCAACAA I-4E15
13  C09 I   ZK265.7 CCCCAAAACGAACGACTTTA    GTCGATTCGGTCGATCCTTA    I-4E17
13  C10 I   ZK265.8 GACTGATGGGTTCGGAAAGA    TGCCAAACTACAGATGACGC    I-4E19
13  C11 I   T01G9.1 GCGAAAAACTAGTCATCGAGAGA TAGGATTACGAATGAAAGACGGA I-4E21
13  C12 I   T01G9.2 AAGAATCGATTGCACATCCTAAA GAAAATGAATGGAAAACAGCAAG I-4E23
13  D01 I   T01G9.3 TGGCCTACAACCACATCAAA    TTCTTTGCCGACGGATTTAC    I-4G01
13  D02 I   T01G9.4 TTCGGTACCACACGCAATAA    GTGTCTCACAGCAGTTCCGA    I-4G03
13  D03 I   T01G9.5 GATGGAATGAGGCTGGTGAT    TTCATCGGATTTCGGAGTTC    I-4G05
13  D04 I   T01G9.6 TGAATGGAAACTGGAAAGAAGAA AGAACAAAGCGCTAGTTTGTCTG I-4G07
13  D05 I   F52B5.1 GTGGCAAATGACTCTTCCGT    TCCGCCCAGATTATTTCAAG    I-4G09
13  D06 I   F52B5.2 GAAGTGAATGGGTCCACATTTTA AGAAATACGTTTGGGAATGGTTT I-4G11
13  D07 I   F52B5.3 TGTGGTTGGACGAAATTCAA    AAAACAAATGCACACCACGA    I-4G13
13  D08 I   F52B5.4 AAGAAATCCCGACAAATGAAAAT TCCGAAAAATACAAAACTCCTCA I-4G15
13  D09 I   F52B5.5 AAAAATTCTAGGCCAGTCTGGAG TTGTGAAAACAAATTAGGCGATT I-4G17
13  D10 I   F52B5.6 CCGAGACTTGAAGAGGTATTTGA CTGAACAATATTTGCGTCAATCA I-4G19
13  D11 I   C34B7.1 TTTTGAATTCCCAGAATCCG    GTGGGAATTTCAGTGCTCGT    I-4G21
13  D12 I   C34B7.2 TGAAGCATTTGCAACTTTGG    TGCTCCCTTGCCTTTACACT    I-4G23
13  E01 I   C34B7.3 ACTGCAAAAGTAGGGCATGG    TTGGATGGATTAGAAAGCGG    I-4I01
13  E02 I   F16D3.1 CTTTTAAACGGACAACTCGAATG TTGATGCCAACTTTAAAACCAGT I-4I03
13  E03 I   F16D3.2 GTCTTACTCCCCGACGCATA    GAAAAATCCGCAGAAATGGA    I-4I05
13  E04 I   F16D3.4 TTATCAGGGTCTCCAGTCGG    ATTTGAGAATATGTCGCCGC    I-4I07
13  E05 I   F16D3.5 CCTAGTGAAGCTGGTGGAGG    TATGTGTGCACAGGGTGGTT    I-4I09
13  E06 I   F16D3.6 TCAGTTAGCACTGCCATTACAGA TTCCCTTTTCAACACTTCACCTA I-4I11
13  E07 I   F16D3.7 GGATAAGTACGGGCAACGAA    AATCGGAGGAACACAACCAG    I-4I13
13  E09 I   T19A6.2 TTTGGAAAAGGAGCAGTTATCAA GTCTTAGAATCACTGGACGATGG I-4I17
13  E10 I   T19A6.3 AATTCTTCATGAGTCTTGGTGGA CTGGCAAAAGTTTTTAGATGCAC I-4I19
13  E11 I   F02E9.1 TTCAACCAATTTTTGATCGTTCT TTCTTGCTGAAATCCATCATTTT I-4I21
13  F01 I   F02E9.3 TTGCAACAATCACAATCGTAAAC ATCTATTACAAGCGAGCCAATGA I-4K01
13  F02 I   F02E9.4 TTGGGTGCAGAAAAAGAACC    CATTAACGCCACTCCACCTT    I-4K03
13  F03 I   F02E9.5 TTTTGATTTTCATGTTCCTTGCT TCTTGAACTTTTCTTTCCACAGG I-4K05
13  F05 I   F02E9.7 CGATCCGGAAAGAGATTCAA    CATACCCGGGAAAAGTGAAA    I-4K09
13  F06 I   F02E9.8 GCTACGGTCAACAGGCATTT    TTGTGGTGGAATTTTGCGTA    I-4K11
13  F07 I   F10D11.1    GCGAATTGTGGTTTAACCTGTAG CAATGGGAGTCAACTTCTACTGC I-4K13
13  F08 I   F10D11.2    TATCTCACTGTTTGTGCCGC    CGCATACGCGCCTTATTTAT    I-4K15
13  F09 I   F10D11.3    GCACTAAATAAGTTGCCAGGTTG AAGGGGTGGTCTGAATGTAAAAT I-4K17
13  F10 I   F10D11.4    TGTCCTACTGCCCAACTTTATGT TTTCCGCTACAGTAATCCTTCTG I-4K19
13  F11 I   F10D11.5    CAACAAGTAGAGCGTGGCAA    TGATTCCACATCACCCTTCA    I-4K21
13  F12 I   F10D11.6    GAATGACAGATGGAGCACGA    AACTGTAATGCGGTCCAAGC    I-4K23
13  G01 I   D1081.2 TTTTCTTTCATCATTCGCATTCT TTTTGATTGCCTGCTTATTTGAT I-4M01
13  G02 I   D1081.3 CTAACGGAGCTCCTCGAATG    TCACGCCTCGACATTATGAA    I-4M03
13  G03 I   D1081.4 TTCTAGAACATTTAATCGCGAGC ATCAGAAATTGCAAAAACCAAGA I-4M05
13  G04 I   D1081.5 ATTTCCTCCCAGTTCTCGGT    ACAATTGGGAGTCACAAGCC    I-4M07
13  G05 I   D1081.6 CTCACTGAAAACCCATCAGAATC TTATTCCCCTCTTCACTTTCACA I-4M09
13  G06 I   D1081.7 TCGCAATCATTCAGTGCTTC    TCTTCGATAATTGGGCTTGG    I-4M11
13  G07 I   D1081.8 AGCAGCTGGCTTAGCTTTTG    TCCGCATTTCTCTTTGCTTT    I-4M13
13  G08 I   K02B12.1    TCTTGTGCATTTGGCTTCTG    TAGGGCCAGAAAATTGAACG    I-4M15
13  G09 I   K02B12.2    GAAGTGTTCTGAAAACCGAAATG CCGGAATGTTATCAACAACTGAT I-4M17
13  G10 I   K02B12.3    CTGACCCTTTGCCAACAACT    CTATTTGAACACCCGCCAAT    I-4M19
13  G12 I   K02B12.5    TAAACCAAAGCCATTCCCTG    TTCAAAACTCGCACGTGAAC    I-4M23
13  H01 I   K02B12.6    ATCTTCTGCATTGTGTGTGTGTC ATGTTCTCTCCGTCAAATTGAAA I-4O01
13  H02 I   K02B12.7    ATGCATCATCATCCCATCCT    CCACCAACACTTGGAGGAAT    I-4O03
13  H04 I   M04C7.1 CGAATTTTGACAGGCATAGAAAC TTCCAACAAAAAGAGACTACCCA I-4O07
13  H05 I   M04C7.2 TTTCGGAAAAATTTGATCGC    GGACACCTGAAGAGATGGGA    I-4O09
13  H06 I   M04C7.3 TTTTTAACTACGGCACGATGAAG CACTTGACAACGCTTCTTTTTCT I-4O11
13  H07 I   T01H8.1 ATCAAGCTCTCCAACTTGTTCTG CTTTGATCCAGAATTCACGAAAC I-4O13
13  H08 I   T01H8.2 GTCCAACTCTTGCTACACGAACT TTTGATTTCTGATTCGGTGAACT I-4O15
13  H10 I   T01H8.4 GGCAGTGTTTAACAACGTAGACC TTTCCTCATTCTCCCAGTTATCA I-4O19
13  H11 I   T01H8.5 TTCCTTACCCATCTTCGGTG    TAATCGCCTGTTTACCCCTG    I-4O21
13  H12 I   R05D11.1    CCAGGGCTTCTGTCAATGAT    TTACGGTGAACCTCCGATTC    I-4O23
14  A01 I   R05D11.3    TTAAACTTCCCAAGAACGAACAA GCAATTTGGTGAAAATTCAGTTC I-4A02
14  A02 I   R05D11.4    ACACGTGTCGCATTCTTCAG    AGCTTCGGCGTGAATTAAAA    I-4A04
14  A03 I   R05D11.5    GCCCATCTCGGTCAATCTAA    GATGACAGTGGTGGAGCAGA    I-4A06
14  A04 I   R05D11.6    AAGATTCGAACAATGGGTGC    TGGAATGCAAGAGAGCTGTG    I-4A08
14  A05 I   R05D11.7    AAAATATCGACGATTTCAGCAAA CGTCCGTAGAGCGATAAAAGATA I-4A10
14  A06 I   R05D11.8    ACATCACTCGACACCATCCA    AGACGACGAATGGAACGAAC    I-4A12
14  A07 I   F43G9.1 CGGAAAGAATGTCTCCATACAAG TCAATTTTTCCTTCCATCTCAAA I-4A14
14  A08 I   F43G9.2 CTGTACTTGTGTCTGCGTCTCTG AAGCGGCATGTGTAGTCTTATGT I-4A16
14  A09 I   F43G9.3 TTGGTCCTTTCAGCCAATTC    CGCACGACTCAAATGAGGTA    I-4A18
14  A10 I   F43G9.4 TGAATTGCATCGCTTTCATC    ATCAAGTGCCAGTGTTTCCC    I-4A20
14  A11 I   F43G9.5 TTGAGATGTTCGTTTTAGACGGT TAAATCTCGAAAGAGTGGTTGGA I-4A22
14  A12 I   F43G9.6 ACCTGAAATGCGTATCCGTC    AATGGGCTGATCTCAAATGC    I-4A24
14  B01 I   F43G9.7 ACAAACGGTGGACTTTCGTC    GAAGTCTTTGGAGCGAGTGG    I-4C02
14  B03 I   F43G9.9 TGAGAATGTAGGGAATACGTTGG TACAAAAGACCGCCTGAATTTTA I-4C06
14  B04 I   F43G9.10    GTCAAGTTCTGCCTTCTCGC    GGAGCCATTCCAATCAAAAA    I-4C08
14  B05 I   F43G9.11    TTCACAGCTTGATTCATTTCTGA TAGAAGAGCTTGAGGTCTGGTTG I-4C10
14  B06 I   F43G9.12    AAGTTTTTGGACGGATGACG    TTCCACCCATTTTCAAAAGC    I-4C12
14  B07 I   VF39H2L.1   CATTAGTGCGCATGTATGAAAAA AAAGAACTCTCAATCACTCGTGG I-4C14
14  B08 I   F39H2.1 ATTGTTCCTCCAGATCCACG    ATCAATTCTTCACGCCCAAG    I-4C16
14  B10 I   F39H2.3 ACGTACTTGGTGCTTCATCCTAA AAAATTGAGCAAACGAATACGAA I-4C20
14  B11 I   F39H2.4 CATTTTGGCTGTTCTGATTCTTT GTTCTTAAGTCATGTGGGTCTCG I-4C22
14  B12 I   K07A12.1    TGTCGTCGTTCAGCTAATGG    AACCACGAAAACCGAATCAC    I-4C24
14  C01 I   K07A12.2    CCTGTGGAACTCCAAGCAAT    TGTTCTTCTGGATGTCAGCG    I-4E02
14  C02 I   K07A12.3    AAAAACCAAGGATTTCTTTCTCG AAACTTTTGAGGAAGATCGGAAG I-4E04
14  C03 I   K07A12.4    GTGATCACTTTCTCGACAATTCC CATGCCTTACTGCTCAGAAGTTT I-4E06
14  C04 I   K07A12.5    ATATTAAGATCCAACGGATGCAA GCGAAGAAGATGAGCTACAAAAA I-4E08
14  C05 I   K07A12.6    GTCATTTTAGTAACCGTCCGTTG AGAGTTTCCGTCAGAAAATAGGG I-4E10
14  C06 I   F39H11.1    TTTACACTGAATACCACGCACAA ACGAATTGTCAAAGAAACCAGAA I-4E12
14  C07 I   F39H11.2    TTTACAATCCGCCTCACTCC    GCACAAAATCAGCAAGGACA    I-4E14
14  C08 I   F39H11.3    CGGCAGAGGAACATATGGAT    TGAAGCCATTCACGCTACTG    I-4E16
14  C09 I   F39H11.4    CGGGATTTCAGAAAAATGGA    CCATTTATCGGTGGTTACGG    I-4E18
14  C10 I   F39H11.5    AACATGGAGATACTGAAACGCAT TCATTGTCGAAATTCACTTCCTT I-4E20
14  C11 I   C36B1.1 GAAAAAGGTTGCAAAGACAGAGA TCTTTCCGGAATTAATGTTCTCA I-4E22
14  C12 I   C36B1.2 ATTCACAAACCGGGATGAAA    AAGACCCAATCCACATCAGC    I-4E24
14  D01 I   C36B1.3 TAGGATTGTGAATGTGCCGA    TTCGGTAAGGATCAACTCCG    I-4G02
14  D02 I   C36B1.4 GGGAAATCAATACACACGGATAA TCGTGCTATCACTATCTTCTCCC I-4G04
14  D03 I   C36B1.5 CTGAGTAAATGCACCGGGAT    ACAAAATGGCTGAAAATGGC    I-4G06
14  D04 I   C36B1.6 GCATGTAGGTAGGTAGGCATGAG AAATTTGAGACTTGTGCCGATTA I-4G08
14  D05 I   C36B1.7 TGATTTTCCCACGATTCATTATC AATTTCTGAATTTTCCGATGACA I-4G10
14  D06 I   C36B1.8 CCAAACGGAGAGCGTATTGT    AAGGAGCAGCAATTCAGCAT    I-4G12
14  D08 I   C36B1.10    ACAGAGTCGTCTGCTCGGAT    TCTATTCGCATCTGGAGCCT    I-4G16
14  D09 I   C36B1.11    TTTTTCAATTCATCGCCTCC    AGCTGAATTTGCCTCGACAT    I-4G18
14  D10 I   C36B1.12    AAAAGGTTCAGCAAAAGCCA    ACGGCGAATTATGAACCAAG    I-4G20
14  D11 I   DY3.1   AACCATTCTGGTGGATATTCCTT TTAACAGAACGGCATCAACTTTT I-4G22
14  D12 I   DY3.2   AAGCTCTCGTTTTGGACGAA    CCCACTTTCCTTCCTCATCA    I-4G24
14  E01 I   DY3.3   TTCCCGTCTCTATTCTAATGCAA AGAGGAGTACGGTAGTTTACGGG I-4I02
14  E02 I   DY3.4   CCAATACATTTCCAAAATCCAAA ACTTCTTTCCAAACACCATGAGA I-4I04
14  E03 I   DY3.5   ACCCGAGTAGTTGGTGATGG    CAACCACAGCCTCAAGTGAA    I-4I06
14  E05 I   DY3.7   ATGAAGGAAGTCGTGGATGG    ACAGCAAGTTCTTCAGCCGT    I-4I10
14  E06 I   F36A2.1 ATTCCATCGCGAAAATTGAC    GCGTAGCGTTCACACAGAAA    I-4I12
14  E07 I   F36A2.2 AACATGAGCCCGAATAGCAC    TCACAAGGAAATACGGAGCC    I-4I14
14  E08 I   F36A2.3 TTCAAGAGCGGGATGTTTTC    TAAATATTCCAGTTCCGCCG    I-4I16
14  E09 I   F36A2.4 AAGCTCGCGTACTTTTGCAT    TATGTGGCACCAAGCACATT    I-4I18
14  E10 I   F36A2.6 TAAAAGCAGCGTATTGCTGTGTA ATTTTTCAGGGTTAAACATGGCT I-4I20
14  E11 I   F36A2.7 ATTTTCTCATGTTTCCCGGTATT CATGAGCTGATTTATCTGGTTCC I-4I22
14  E12 I   F36A2.8 CTCCACCAACTTTTACATTTTGC TATGCTCAAACATGGAGATTCAA I-4I24
14  F01 I   F36A2.9 TGACTGGAACGAATGTTGGA    CATAACCACTTCGTCGCGTA    I-4K02
14  F02 I   F36A2.10    TCCCGGAAAGATCTCTTTTCTAC GTATAGATTGCATACCGCTTTGG I-4K04
14  F03 I   F36A2.11    ACTGGAACAAAAAGTGAACAGGA TACGTCTGGATGGTTTTCTCCTA I-4K06
14  F04 I   F36A2.12    ACAACCGTCGGAATTGAAAC    TTCTGGATCCACGTTCAACA    I-4K08
14  F05 I   F36A2.13    TCGTTTGCTTTTGGCTTTTT    GACAAGGAATGAGTGGGCAT    I-4K10
14  F06 I   F29D10.1    GATCAAACCGAGAGAGACTCTGA TTTCTTTCGACTCAGGTGAAGAC I-4K12
14  F07 I   F29D10.2    ACGACAAACACGTAAGAACGAAT TTCCTGTTTAGCTGAAGCAAGTC I-4K14
14  F08 I   F29D10.3    ATGTTATTTTCAGCCGCAGG    GCTCTTGGTCTGGAGATTCG    I-4K16
14  F09 I   F29D10.4    TCTCAAATTCCTTCCCATCG    CAGTAAATACGCCGGTGGTT    I-4K18
14  F11 I   F55H12.1    TGCAGCTGTTGTCTTGATCC    GGATAACGCGCCAAATTAAA    I-4K22
14  F12 I   F55H12.2    TGCATGTTTGTCTACAGGGC    AAACAATGCGTGGTAGGGAG    I-4K24
14  G01 I   F55H12.3    GAAAAGATCAAAATGGGCGA    ATTTGGGTCATTTGGAGCAA    I-4M02
14  G02 I   F55H12.4    TTTCAAGTGCACTCTGTGTGAGT TTTCCAAAAATTTCGAGATTCAA I-4M04
14  G03 I   T08G11.1    GCCTTGTAATGCCCTTTGAA    GCTCAACAGGTTCTTAGGCG    I-4M06
14  G04 I   T08G11.2    CGTCTGCAAACACTGGAGAA    GAAAGGCAAAGGTAACGCTG    I-4M08
14  G05 I   T08G11.3    CTCGAACATTGATCTCCAAACTC TCATAAAAAGAGCCAGCTGAAAG I-4M10
14  G06 I   T08G11.4    CTCCACGAAGTGCAAATTGA    ACGTGGCTTAATGATTTCGG    I-4M12
14  G07 I   T08G11.5    GCCTTTCCCAGGTGTTGTTA    GCAAGCTCAATTTGGGATGT    I-4M14
14  G09 I   F53B6.2 CAAAACTGCAGACCTCGACA    GAATGCGAAATTCTTCGAGC    I-4M18
14  G10 I   F53B6.4 ACCAATGGGACAACCATCAT    CGCTGACTGCAATTGTGACT    I-4M20
14  G11 I   F53B6.5 GCCCAGTAACATCATTTCTCAAG GAGGACCGCTAGTACCTTTCATT I-4M22
14  G12 I   F53B6.6 CGCTTGGAAGCATGATGTAA    AAACATGACGGTGGTTGTGA    I-4M24
14  H01 I   F53B6.7 AGTCCCCTAGGTGGCTTGAT    CAGGATGATTTGGAACCGAT    I-4O02
14  H02 I   F32H2.1 AAACTGCAATGGTATGGCTTTTA TTCTTGATCAGTCCATCTTCCAT I-4O04
14  H04 I   F32H2.3 TGCATGCGAATAAGACGAAG    TTGCGGACACAGAAAACAAA    I-4O08
14  H05 I   F32H2.4 GCAGCTGATGCTTCGACATA    AGTCCCAGTCCTGCTGCTTA    I-4O10
14  H06 I   F32H2.5 AGCTTCGTAGAACAACACTGGAG TTATTGGAATCAACTCTTTCGGA I-4O12
14  H07 I   F32H2.6 CTTGCAAATCGAATGTGTATGAA TTCTGGAAACTCACCTTTACCAA I-4O14
14  H08 I   F32H2.7 GAAATCTCGAGAGCGGTACG    GCCAAGGAGATTCGGTATGA    I-4O16
14  H09 I   F32H2.8 GTACAATCCCCACGCAATCT    CAGCCTGTGCCCTGTTAAAT    I-4O18
14  H11 I   F36F2.1 TCATTCATTTCGTTGTTTGTCAG GATGGTTTCGTTTTTGTTGACTC I-4O22
14  H12 I   F36F2.2 ATTCAGAACCCCGTTCTCCT    ATTTTTCGACGACGCCATAG    I-4O24
15  A01 I   F36F2.3 ATTGCGTCCGGATCATCTAC    AGTTTCGGAACGAGGGTTTT    I-4B01
15  A03 I   F36F2.5 TCTACACCTGGCAGCAACAG    TCGTCGTCATCGTCTCTTTG    I-4B05
15  A04 I   C31H5.1 CACCTCATACCACATCCCCT    GCATTGCAGCAGCACATACT    I-4B07
15  A05 I   C31H5.3 TTCGATATTCGGAAAAACCG    TTGACATGGGATCCATCAGA    I-4B09
15  A06 I   C31H5.4 ATGACAAACATAATTACCGTCCG CTGGTCTTTTTGATCGATTTTTG I-4B11
15  A07 I   C31H5.5 TGGTGCATTTAGATGGAATTCTT CTTTCAGACCTCTTCTCGTCAAA I-4B13
15  A09 I   W06D4.1 GCAATAGCGGTACCATGCTT    TTATGCGGAACAGCTCAGTG    I-4B17
15  A10 I   W06D4.2 CGTGAACCACGATTTTGATG    TGGGGAACATTAGAACCTGC    I-4B19
15  A11 I   W06D4.3 CTAACAGAGTGTCACGCCGA    ACTTTAGAACGGCGCGAGTA    I-4B21
15  A12 I   W06D4.4 TGAGCAACTGCTTCACGAAC    TCTTCCGTTCCTTGATTTCG    I-4B23
15  B01 I   W06D4.5 TACACAATTTCGAAAAATACCGC GAAACAAAAAGCAAACGATGTTC I-4D01
15  B02 I   W06D4.6 CGGAGGAACCGAAAAATGTA    AACGATTCCGACATCTCCAG    I-4D03
15  B03 I   W10D5.1 CAGGTGACATTCACCAAACG    GTTCGAACTTAGGATGCCGA    I-4D05
15  B05 I   W10D5.3 TATTTTAAGGGTGTTGTCCATCG TATGCTGATAATTTTGAACCGCT I-4D09
15  B06 I   ZK858.1 TTTCGGAGCGAGAAGACACT    GTGGCTGAGTTGTTGTCGAA    I-4D11
15  B07 I   ZK858.2 GCTTTGTTCTTTCCCTCATTTTT CTTGAAGCTCATCGAGGAAGATA I-4D13
15  B09 I   ZK858.4 ACCAACGAATAGTGAGCAACAAT GCCTGGTAGATTTGAAACTGATG I-4D17
15  B10 I   ZK858.5 AAATGTTGGCAGAAAAATGAAGA GAAAAGGAAAAGTGGAAGTTCGT I-4D19
15  B11 I   ZK858.6 TCAGCGCACAAGGAGAAGTA    GAGTGATGTTCCATGGGCTT    I-4D21
15  B12 I   ZK858.7 ATGGTGCCAGTTTGGGATAA    GTGCATTTGGAAAGCCTCAT    I-4D23
15  C01 I   H32K16.1    AAAATTGTCTTTTTGAACTGCCA AATGCTTGATGAGAGGACACATT I-4F01
15  C02 I   F25H5.1 GGACATGCTTTTTGAAAGAGAGA TTACCTTGAAATTGCAGGACCTA I-4F03
15  C03 I   F25H5.2 GGTGCACCCTATCACACCTATAA TTTCAATTACAATCGGCAAAGTT I-4F05
15  C04 I   F25H5.3 CACTACCCATATGGAGCATTTGT ATCTTACAGCATTGGCAACATCT I-4F07
15  C05 I   F25H5.4 TCAAGAAGGACAAGACCGCT    ATTTGGTCCAGTTCCGTCTG    I-4F09
15  C06 I   F25H5.5 ATATCATCGCCTTGTTTCGG    GTTTTGGATTCGGACGAAGA    I-4F11
15  C07 I   F25H5.6 CATGAAGAGGAGCAGAAGAAAAA TACCCCTCAAAACCTCTGACATA I-4F13
15  C08 I   F25H5.7 AGAAATGCCAAGCGATCAGT    CCCTCGATCTGAAATGGAAA    I-4F15
15  C09 I   C45G3.1 GCTTCAAGAACTACGACGCC    TGGGTGTTCCAACGGATAAT    I-4F17
15  C10 I   C45G3.2a    ACTTGTCGAACTTCCATTTTCAA TGAACCGAAATCTCAAAAAGTGT I-4F19
15  C11 I   C45G3.3 TGGAGCGCAATTACTGAATG    TATGGACTTATTTTCGCGGG    I-4F21
15  C12 I   C45G3.4 AATGAACGTTTGCAAGAAAAAGA ACCCTGGCTTTCCTTTAATAGTG I-4F23
15  D01 I   VF36H2L.1   TTCAGTCATTGGCTCGTCAG    ATCTCTTGCATGGCTTGGTC    I-4H01
15  D02 I   F36H2.1 CAAGCCGAAAAACCGTTAAA    ATTTCCTTCGTTCCTCCGAT    I-4H03
15  D03 I   F36H2.2 ATGTTCCTCCGTTTGTCCAG    GGCGGCATTATGAGTCATCT    I-4H05
15  D04 I   F36H2.3 AGTACCATACTTCCGTCGCTGTA CATCAGTGGAACTTCTATTTCCG I-4H07
15  D05 I   F14B4.1 TCCAATCCAATCAACTGCAA    TTGCAGCAATCATGAAGGAG    I-4H09
15  D06 I   F14B4.2 CTTTCAGTCGAGTGGCAACA    GCAGGTTGTATGGCCAAGTT    I-4H11
15  D07 I   F14B4.3 TCACAAGTGCAATGAGTTTCTGT TTTCAAAAGGATGTCAATTTGCT I-4H13
15  D08 I   F26H9.1 TTCGCGAAGAGATGAAGGTT    TGAGGGGACATTCACACGTA    I-4H15
15  D11 I   F26H9.4 CAATCAGACCGCAATTTTTATTC TTGCACATTTACGTATGCTTGAG I-4H21
15  E01 I   F26H9.6 TTCTGGAAAGAAAAATGCAACAT GAAGGGTTGATGGTACATGAAAA I-4J01
15  E02 I   F26H9.7 AAGAATCTCAACGTGTCAATGGT CTTCATGTGCCTTTTTGATTGTT I-4J03
15  E03 I   F26H9.8 CATCAGAGGACGTTGAAGCA    TTTTCCAAAATCGGAATCCA    I-4J05
15  E04 I   C12C8.1 TTTGTCCTTTGCTTCAATTTCAT CTGAAGCAACTGTAGAGGTCGAT I-4J07
15  E05 I   C12C8.2 TGTATATCGTCGATGCGGAA    GTCGGACCATCCAAATATCG    I-4J09
15  E06 I   C12C8.3 CCAAGTCCAAATGAGCCAAT    ACTCAACCAACATCCCAAGC    I-4J11
15  E07 I   M04C9.1 GACAAGACTTTGAGATCTTGCGT ATGATGGGGGTAAGTTTCATTTT I-4J13
15  E08 I   M04C9.2 TTTGCTATCGAACTGCACTAACA AATGTTTGATTTTCAGCAAAGGA I-4J15
15  E09 I   M04C9.3 CCCGTGATTTTCTGTCGAAT    CTGACAATGTGCAATCCAGG    I-4J17
15  E10 I   M04C9.4 CGGTAGGTGAACAGCCAAAT    GCGTCAAATGACCGTTTCTT    I-4J19
15  E11 I   M04C9.5 CGAATATTGCCAGTTTCCGT    CTGGCCATTCATCCTGAAAT    I-4J21
15  E12 I   M04C9.6 AATTGTGGAAGGGAAAGAATCAT TCTATCGAAGATGAGCTCAAACC I-4J23
15  F01 I   F16A11.1    CGCACAAAATCCCTCTTGTT    TCGGGATCCTTTCTCAAATG    I-4L01
15  F02 I   F16A11.2    GACCGCAATTGGTCTCAGTT    GGAATTGATGAAGAAGGGCA    I-4L03
15  F03 I   C17E4.1 AAAATGGAGGCCTTCTCGAT    TTAATTTCACTCCCCAACGC    I-4L05
15  F04 I   C17E4.2 GACGCTGACTCAGTGGTGAA    GGAAGACACGAAGGACGAAA    I-4L07
15  F05 I   C17E4.3 AGAGGTGCGATTGAAATTGG    ATTTCTTCAGGTCGAGGCAA    I-4L09
15  F06 I   C17E4.4 AACAAATGGGAGCTTCTCAAAGT AACAATCGAAGCTATTTTGGTGA I-4L11
15  F07 I   C17E4.5 AGAGACAGTGAATAATGCGTGGT TTGAATTTCGAAAAAGTGTGGTT I-4L13
15  F08 I   C17E4.6 GACGATACAAGCAGCGATGA    TCCTTTTGGTTCCGTTTTTG    I-4L15
15  F09 I   C17E4.7 AACTGGGAGTAGAGGGAACAAAG ATGGTAAACAGTGGAGAACGAGA I-4L17
15  F10 I   C17E4.8 TTCGTTATCACCTGGTCTCTCAT ACAGCCTCTTCAACTGAGAAAAA I-4L19
15  F11 I   C17E4.9 TGCTGTCGAGTGTGTCTTCC    TGGCTTCCCTTTTGTGAAAC    I-4L21
15  F12 I   C17E4.10    GAACACGTGGAAAAGCAAATATC GAATTCAGATGGGAAATGAGATG I-4L23
15  G01 I   C17E4.11    CTTCTTATCCATTCACATCAGCC CTTTATCTTCTGTTCCGTGGATG I-4N01
15  G02 I   F46A9.1 TTAGTCGTGGATTGTTGTTGTTG ATAGTTTTCATTCAAGATTGCGG I-4N03
15  G03 I   F46A9.2 CTAGTCGAAAGTCCATCGCC    TGTACTTGGGAAACTTGGGG    I-4N05
15  G04 I   F46A9.3 CAATGGACGTATTTCAACAGTGA ATTCGATCTACCGACTTCACAAA I-4N07
15  G05 I   F46A9.4 CACATACAGGTGTGCTTGATTGT AATAAGGGGAAAGATATGGTGGA I-4N09
15  G06 I   F46A9.5 GCATCATACGACACACTCACATT GAGAAATAGGCAAACTGAAGGGT I-4N11
15  G07 I   F46A9.6 CTTCTTATCCATTCACATCAGCC CTTTATCTTCTGTTCCGTGGATG I-4N13
15  G08 I   F30A10.1    AGATTCTCACACATTTCCTCCAA ACTATTTTCTGGTTTGTCTGCCA I-4N15
15  G09 I   F30A10.2    TAACAATTCCATTGCAAGCTTTT ATGAAAATTGGTATAATGTGCCG I-4N17
15  G10 I   F30A10.3    TGCAAACTTTAACAGCGTCG    GTGGCAAAACCATCGAATCT    I-4N19
15  G11 I   F30A10.4    CAGGAGCCAAAATGGTCAAT    CCAGCTGGAGTCCAATCTTC    I-4N21
15  G12 I   F30A10.5    GAGATTTGCCGGAAGAACAA    TCGAAATTGCATTGCATCAT    I-4N23
15  H01 I   F30A10.6    TTCCCTTTTCAGCTCTCCAA    TGGTTTCAGTGTAGGCATCG    I-4P01
15  H02 I   F30A10.7    ATTCCTTCACGAAGTGGTGG    TTAACCATTACGGCCAGAGC    I-4P03
15  H03 I   F30A10.8    CATATGTGGCAAGAGCTGGA    GCGGAATTTAGCAAATCCAA    I-4P05
15  H04 I   F30A10.9    AAAAGACTGCAGCAATACCACAT TACAGAAAATGGGTAAACGCTTG I-4P07
15  H05 I   F30A10.10   AGGTGAAATGTTCGGACGAC    GAGATCCAGCGAACAAAAGG    I-4P09
15  H06 I   C41G7.1 GGAGGAATGGAGTGAGAAAACTT CAGAATATGGCAAAAATCTGGTC I-4P11
15  H07 I   C41G7.2 CTGCGACTTTTTCCCTGAAG    CTGACTCCAGACTCCTTGGC    I-4P13
15  H08 I   C41G7.3 TTTCACTGCAGCACGATTTC    CCGTACCCTGTTCCTCAAGA    I-4P15
15  H10 I   C41G7.5 ACGGGTCATCTGGTCTTCTG    TGAAATGGCTCATTTGTGGA    I-4P19
15  H11 I   C41G7.6 TTACCCAATACCGAGAACTCTGA AAATGGTATAGGAGGGTGTGGTT I-4P21
15  H12 I   C41G7.7 AATGCTTCCAAAAGTATGCATGT TTTTTCAAGAAATCCTTTCACCA I-4P23
16  A01 I   C36F7.1 GTTGTCAACTCATCTGATCCTCC GCAAGTAAATTGTCCGTTTGAAG I-4B02
16  A02 I   C36F7.2 TTGGATAAGCGAGATGAGAAGAG TGATATGGATCTTGGGGTTTATG I-4B04
16  A03 I   C36F7.3a    TTGAGGAGGTGATTGTGAATCTT GGAAAAATGAAAAGGGAAAGCTA I-4B06
16  A04 I   C36F7.4 TGGTTCAGTGTTGATTTGACAAG TGTCTAACCGGAAAACAGGAATA I-4B08
16  A05 I   C36F7.5 AACTGCTGCCAATGTCTGATAAT AATTTCACTTTTGACGAATCGAA I-4B10
16  A06 I   F42H11.1    TGATGGAAGGGAAGGATCTG    CTAGCGGTATGGCCGATTTA    I-4B12
16  A07 I   F42H11.2    GCTACCAGCTTCGTTTCCTG    TCGTCAGTTGTTTTCCGTTG    I-4B14
16  A08 I   K07A1.1 TTTTGTGGCGAATGTAACGA    TGCTCTACATCTCCGTGTGC    I-4B16
16  A10 I   K07A1.3 TTTTCCTTGATAACCAATGATCG AATGGACTAGTTTTTCCTCGGTC I-4B20
16  A11 I   K07A1.4 AATACCGAAATCAGCCAACG    CATCTGTGGACCGATTCCTT    I-4B22
16  B01 I   K07A1.6 CGTTTAGGAATGCAACAGAACTC CAATCAAATTTTCGTCCAATGTT I-4D02
16  B02 I   K07A1.7 TATTCGCAGAATGAGGGACC    GACTTCCGAAAACGATCGAA    I-4D04
16  B03 I   K07A1.8 TGCTCCTTGAATTTGGCTCT    TTGGCTTATGCCGAGTTTCT    I-4D06
16  B04 I   K07A1.9 CATTTGAGCAAGTTGAGCCA    TGAAAGATGCGGATAGACCC    I-4D08
16  B06 I   K07A1.11    AACAGTTTCATAATGCGGGC    CAGGCAATTTCAGAGCACAA    I-4D12
16  B07 I   K07A1.12    GAGAAATCGCTGATCTTGGC    CTCGTAATGACACATGCGCT    I-4D14
16  B08 I   K07A1.13    GCGATGCGATTCAATACTTTTTA CCTCAATGTTCCTTTGTTCACTC I-4D16
16  B09 I   T05F1.1 GGTGCCGTGCTTATTTTCAT    CCTTTGAGAGCATCGTAGCC    I-4D18
16  B10 I   T05F1.2 TTCTCTGAGCAACACGATGG    TTGTTTACTGTGCTGCCCTG    I-4D20
16  B11 I   T05F1.3 TAATTTGCGCCATCATCTTACTT TGATTGGGAGGAAATATGTTACG I-4D22
16  B12 I   T05F1.4 CATCAATAAAGGCCCATCAATAA ATATCCAGACGAGAAATCGTGAA I-4D24
16  C01 I   T05F1.5 AAGTGCTCCAATTCAGTCTTGAG GAAATTTCCGGTCTAGAATGCTT I-4F02
16  C02 I   T05F1.6 AACCAGAGAATGAGGACGATACA TTCCATCTGAAAACAAGCAAAAT I-4F04
16  C03 I   T05F1.7 GCTTCCCTTTGACACTCGTC    AGCATTGAATGAAAAACGGC    I-4F06
16  C04 I   T05F1.8 TGTTCATCAGCTGCCACTTC    TGTCGACCTTTCCTGGTTTC    I-4F08
16  C05 I   T05F1.9 TTTTCGGTATGGATGATATACGG ATCATCTTCATCACTCGCAAAAT I-4F10
16  C06 I   T05F1.10    AGTTTTGCACAAGCCCAAAG    TTTCCAGGCCCACTCTTATG    I-4F12
16  C07 I   T05F1.11    TTCAGATCAGAGCAACACCG    TATTGGTGAGTCGAATGGCA    I-4F14
16  C08 I   T05F1.12    AAATTGAACCTTGCTGAAAACAA TTTCTCGTTCAGATTCCCATTTA I-4F16
16  C09 I   C03D6.1 TGAGAAGAGTTAGCAATTCGAGG CTTTCTTTGTTGGGTGATTTCTG I-4F18
16  C10 I   C03D6.3 TCCAACCCGTATCTTTGAGC    TTTTCCGCAGTTCGTAATCC    I-4F20
16  C11 I   C03D6.4 GTTTCTGTGAATCAAATTGGAGC CCGAGAAAATATGAACGTTGAAG I-4F22
16  C12 I   C03D6.5 TGGTGTACGTTGGATCTGGA    CGAACGGAAAGCAACTTCAT    I-4F24
16  D01 I   C03D6.6 TAAATGGGAATCTGAACGAGAAA TTTTATTCGCAAAAACGTTGACT I-4H02
16  D02 I   C03D6.8 CTGGAAGATTTGATGCAGTCTCT TGACCAATAATCTTACCACCACC I-4H04
16  D05 I   C04F12.3    AACATGTTCTGGTGCTGGTTAGT TCCCGATGAGCAAATAGAAATAA I-4H10
16  D06 I   C04F12.4    TCGGTGTTTCTTCACTTCTCAAT GCCAAGCTATAAATTTCGAACAA I-4H12
16  D09 I   C04F12.7    CTTCTTGGTGTCTCCAAACAATC TTACATGGAAGTGCAATGTTCAG I-4H18
16  D10 I   C04F12.8    GTGCGGAACTACATCGAAATTAG CCATTTACCTTTGAAGTTTGTCG I-4H20
16  D11 I   C04F12.9    ACTTCTCTTCGAGACCAGGACTT CTGCGAAACAATTCATATCATCA I-4H22
16  D12 I   C04F12.10   GAGTTGATTGTAGAGAGCGAGGA GTTCTCATTGTACCGATTTTTCG I-4H24
16  E01 I   C16C2.1 ATGTTGCTCTTCTCAGCTCATTC TTCAGCTTGCATTCGGTATTTAT I-4J02
16  E02 I   C16C2.2 AAAACCAAGTCGTGGTGGAC    GGACGATAGCTGTTTTGGGA    I-4J04
16  E03 I   C16C2.3 ACTGAAAAATGCGATATGACACC AAATGCCTGAAAAATTCGATGTA I-4J06
16  E04 I   C16C2.4 CGAGAAGGAAAAAGACACGC    AGGGTCTCAGCTGTTTCCAA    I-4J08
16  E05 I   K02A11.1    ATTATGCAGAAGTCGAACGGTTA ACATGTCTCCTGGAACTGAAAAA I-4J10
16  E06 I   K02A11.2    ATGAAACATCCGCAAGAACTAGA TTTTCCCCTTGCATATTTATTGA I-4J12
16  E07 I   K02A11.3    ATTTGAGACGCCTCATTTGG    CCATCGGTCACTCCACTTTT    I-4J14
16  E09 I   F26E4.2 TTTCTCTCCACTTTCTCTGTTCG ATGCAAAATCATTTCCAGAAGAA I-4J18
16  E10 I   F26E4.3 CCAAAGTTCGTAGAGCCTCG    TCCCCGCAATTATCACTCTC    I-4J20
16  E11 I   F26E4.4 CAACAACGACTTGGTGATGG    AAGATTCAGATGCTTCGCGT    I-4J22
16  E12 I   F26E4.5 GGCTCAAAGCACATTTCCAT    TGTTCAGTTGGGTGGTCAGA    I-4J24
16  E8  I   F26E4.1 TCGTGCCAATGGAGTTGATA    TGTTTCTCTTCCGTTTCGCT    I-4J16
16  F01 I   F26E4.6 GAAGCACGCTTAAAACTGATTTC TTTATTCTGTCAAAAACCGTGCT I-4L02
16  F02 I   F26E4.7 TGCCGTTTCTGAAGTGTACG    CTGCTGATCTTTTGAACGCA    I-4L04
16  F03 I   F26E4.8 CTCGAAGCAACTGTTGGTGA    ATTCAGCCGGAATTGTCAAC    I-4L06
16  F04 I   F26E4.9 CGATCGATAATTTTCTTCATTCG GCGTTTTATTTTCACTGATGGAG I-4L08
16  F05 I   F26E4.10    TTCCAGCTCGTTCTTCGTTT    TCGGCTACCATATTTTTGGC    I-4L10
16  F06 I   F26E4.11    ATGGATGATCTGGGGTGGTA    CCAACCTCTGGTGGTTGTCT    I-4L12
16  F07 I   F26E4.12    ATGTCTTCGGTTTACGATTTCAA AATTTGAAAGTTTGAATTGCTGC I-4L14
16  F08 I   F26E4.13    ATCTTGTTCAAGACGACGGC    TGCTTTTGAAGCTGTGATGG    I-4L16
16  F09 I   F35C12.1    TTCCAGCTTTTTAAAACACCAAA ACCTCCAAATGTTCAGTTCAAGA I-4L18
16  F10 I   F35C12.2    AGCAGCTCATTTGATGAGAGAAC AGTTGCTCCAATGTTTGATTCAT I-4L20
16  F11 I   F35C12.3    TAAAATCATGTAATTCCGTTGCC TAATGATTTTGGAGATTCATGGG I-4L22
16  F12 I   Y67A6A.1    TGCTGATAACCCCTGATTCTAAA GGTTCTAGCACGAGAGAAACTGA I-4L24
16  G01 I   Y67A6A.2    AAAATGGAGACTGAAACAACGAA ACAATCCAAGAAACAAACTGGAA I-4N02
16  G02 I   K10C3.1 AATGAATCCACGAGCTGTCC    CTTACCGTAGTCGCCGAGAG    I-4N04
16  G03 I   K10C3.2 CATCGTGATGCTGAAAATAAACA CAACTAGACACTCTGTTGCCCTT I-4N06
16  G04 I   K10C3.3 TTGTTACTGCATGTCGTATTTGC CCAGCAAAAAGATGGTTATCAAG I-4N08
16  G05 I   K10C3.4 AAGACTTTCCCGAGCCAAAT    CGACGGGGACTGAAATAAGA    I-4N10
16  G07 I   K10C3.6 ACCAACATCTGGAGCCAGTC    TGTCGTCGAGAATGAACTCG    I-4N14
16  G08 I   T23H4.1 CCAACTCAACGAACTGCAAA    ATTCCAAATTGTTCGGTGGA    I-4N16
16  G09 I   T23H4.2 GACATTCACGAGACCGAACA    AAACACTACGGGGCAATCAG    I-4N18
16  G10 I   T23H4.3 GATGGAGCAAAATGCAGGAT    CATCGGATGGAGTTCCAGAT    I-4N20
16  G11 I   F52F12.1    GATTCTCGTTTCTTGGCTGC    TCCCAGAATCTCCAAGATGG    I-4N22
16  G12 I   F52F12.2    GTGTTGGAGATGCAATGAATGTA ACCTCAACTTTGCTCAGTGACTC I-4N24
16  H01 I   F52F12.3    AAGTCGGTCGAATATCAGCATTA TAAATTCAGACACCAACACAACG I-4P02
16  H02 I   F52F12.4    TTCGGAACCTATCAACAAGAAGA GTGCAATAATTTGGTTCTTCAGC I-4P04
16  H03 I   F52F12.5    AATCTGGAAAAGATTGGGGAATA ACAGCTGTAGTGCAAAGAAAAGG I-4P06
16  H04 I   F52F12.6    GAGAGAATTGTTGGAAGAGAGCA CTTGTGACACGACAACAAACAAT I-4P08
16  H06 I   Y106G6A.1   TCGTCGTCGTCATCAGAATC    AGTTACGCAGGAACATTGGC    I-4P12
16  H07 I   Y106G6A.2   AAAACTTTCTAGAGGCGGGC    CCGGTTGTTGTCAGGAATCT    I-4P14
16  H08 I   Y106G6A.3   GAAAATGCAGATGAGGAAGAAAA AACTTCACACTAAACGACCCAAA I-4P16
16  H09 I   Y106G6A.4   CCGAAAGTTTCCAAAATTCTCTT TTTTCTTCCTCATCTGCATTTTC I-4P18
16  H10 I   Y106G6A.5   AAAAGATAAGTAAAAGTGGGCGG ACATACGCACAAACAGTCACTTG I-4P20
16  H11 I   Y106G6A.a   TGAACGACCTCGTGTAATGTAAG GAAGAATCAGAAGCAGACGAAAA I-4P22
16  H12 I   Y106G6A.b   ACATGGAAAGTACAAGGCTTCAA AAGTTAATCGGTTTGATTTTGCC I-4P24
17  A01 I   Y106G6A.c   GTATGGGGAGAAATGCAGTAAAA GTTTACGAGGAGTTGAGAGCAGA I-5A01
17  A02 I   Y106G6A.d   CCGAAAGTTTCCAAAATTCTCTT TTTTCTTCCTCATCTGCATTTTC I-5A03
17  A03 I   T24D1.1 GGTTCAAAAAGTTCCGTCCA    ACATCTTCCTTTCCCCATCC    I-5A05
17  A04 I   T24D1.2 GGCACTTTTTGCATCCTTGT    TTCCAAAACTGTGAATCCCC    I-5A07
17  A05 I   T24D1.3 CCGCAAACAACGAAGAAAAT    GCCGACGCATACATAATCCT    I-5A09
17  A06 I   T24D1.4 GAGCTTTTGCATCTCCAAGG    TAAATGTTTTCGCTCTCCCG    I-5A11
17  A07 I   T23D8.1 ACGTCACATTCGGTGTTTCA    TGACCAAATTCCACAAACGA    I-5A13
17  A09 I   T23D8.3 CTCCCATGGTTGTGAGTGTG    ACCACTTTTCGGACTTGTCG    I-5A17
17  A10 I   T23D8.4 GATTTTGGCCTGCAATCAAT    TCGGACAGAACAATGGATCA    I-5A19
17  A11 I   T23D8.5 ATGCAACTTAATTTTCAGACCCA AGAACTGTTTTCCCAGTTCATCA I-5A21
17  A12 I   T23D8.6 GCAGAAACGAGATAAATGTGTCC ATCAGGTAAAACGGGCAACTATT I-5A23
17  B01 I   T23D8.7 ACAGGTGAATGCCTGAGAAATTA TTTGCAATCTGTTGTTCATTCAG I-5C01
17  B02 I   T23D8.8 ATGGGGAAGAAAGCTCGTTT    GAATGGTTGGATGATTGGCT    I-5C03
17  B03 I   T23D8.9 GATTTTGGCCTGCAATCAAT    TCGGACAGAACAATGGATCA    I-5C05
17  B04 I   C03C11.1    GATTCGCATGTAGGCATAAAGAC TCGATTCAGAAAAATCTGGAAAA I-5C07
17  B05 I   C03C11.2    ATCTTTGTTGGTGGTCCTCG    CACAGTCTGCTTTCTCGCAG    I-5C09
17  B06 I   F10G8.1 CTTTGGTAAATTATTGGTCGCAG AAGATCTTTTCCCCATCATCAAT I-5C11
17  B07 I   F10G8.2 TTCATAGCACTTGAAGAACGGAT TGAGGAATGATTGAAAAGCTCTC I-5C13
17  B08 I   F10G8.3 AAAGAAGCTCGTCTGTGGGA    CCAGAAACGCGGTTTAACAT    I-5C15
17  B09 I   F10G8.4 AAGGAGGCAAAGAGGGTCAT    TGTGTCGCGTTCGAATGTAT    I-5C17
17  B10 I   F10G8.5 GCTGGTAAGTAGGGAGCAAAAAT ACACCTAGAAGACGAATAAGCCC I-5C19
17  B11 I   F10G8.6 CAAATCAGGGGTCTTGTGCT    ACAGTTGGGGCATACGAAAC    I-5C21
17  B12 I   F10G8.7 TGTTGCAGAAGAAGATGATGAAA CGGAAACAAATCATATTCAGCTC I-5C23
17  C01 I   F10G8.8 TCACGGTCTTAAATGTGCCA    GATGATTCAGCACGACGAAA    I-5E01
17  C02 I   F10G8.9 CAGATATAAAATGCGTGGAGGAG TGCTCATATGAAACGATCGAGTA I-5E03
17  C03 I   B0379.1 CAAAATGGACATCAGCTCCTTAC AAGATGGAAGCAAATCAATGAAA I-5E05
17  C04 I   B0379.2 GGATTATGACATGGAGCATTGAT TGATCCCTTGATCGAATAGAAAA I-5E07
17  C05 I   B0379.3 ACATTCAACATGATTGCGGA    CTTTTCGAAGGAGGTTGCTG    I-5E09
17  C06 I   B0379.4 TTAAATCCAAACCCCGTTTAAGT AACTGCGCGTATTCAAGGTAATA I-5E11
17  C08 I   B0379.6 GGTGTTACGAGAGGAAGGAGTTT AAACAGAGTTTTCCATCCACAGA I-5E15
17  C09 I   B0379.7 GCTAGGTGAGCGTCTTGACC    CGCCGAAGGACAATGTTTAT    I-5E17
17  C12 I   Y106G6D.3   AGGCACGTACACCTGAAACC    AAGTCGAGTTCGAGACGGAA    I-5E23
17  D01 I   Y106G6D.4   GAACTTCCCTCTCAACAGCG    TTTGGACCATGAAGCCTCTC    I-5G01
17  D02 I   Y106G6D.5   ACATTCAATCGGCGAGTTTC    CTCGCAAACACGAAAGATGA    I-5G03
17  D03 I   Y106G6D.6   ATAAAATGGGTTTCAAGGGTTGT ATTTTCCATATCCCAAGCTGTTT I-5G05
17  D04 I   Y106G6D.7   ACCGGGAGAACTCTTCGATT    GATTTTGACACGCCAGCATA    I-5G07
17  D05 I   F16C3.1 ACGGTTATCATTTCATGGGC    CCGTCGGTTTCAGTTGTTTT    I-5G09
17  D06 I   F16C3.2 TAGAATCTGTATGGCAGGCATTT TTTTAACAACTATCCCATCCGTG I-5G11
17  D07 I   C25A1.1 GTCAAGAAGCTTGGGAAAAGATT ACGCAGGATTTTCAGGTATTGTA I-5G13
17  D08 I   C25A1.2 TTCAGAAAACAGGAAATTTGGAA GGCATCAAAAACTGACAAAAGAC I-5G15
17  D09 I   C25A1.3 TTCGTTATTCCCTGTTTTTGAGA AAATCCAATTTTTCAGCAACAAA I-5G17
17  D10 I   C25A1.4 TTTTGCTCATGAAGGAGAGAGAC AAACATTTTCAGTTGGCTTTCAA I-5G19
17  D11 I   C25A1.5 AATCGTTTGGCTGGAGAAGA    CCGAAGCCTGAAAAATGAAA    I-5G21
17  D12 I   C25A1.6 GATTCACTTTTCTCACGATCCAC ACCCTGTAAACCTGACAGAATCA I-5G23
17  E01 I   C25A1.7 GGTAGCAAAATTGACACGAGAAC AAGTATCAATCTTTGGACCAGCA I-5I01
17  E03 I   C25A1.9 ACGAACAGTCATTCACGCTG    GGCCGAAATGAGTGGTTAGA    I-5I05
17  E04 I   C25A1.10    GAAACGCTATCCTTTGTCATTTG AGCTGTTACAACCAAAGTTGCTC I-5I07
17  E05 I   C25A1.11    AGATTCCACCAATATCTTCCGAT GAATGGCAGTATCACACATGAAA I-5I09
17  E06 I   C25A1.12    TAAACGAAACGCCTACGTTTTTA CAACGACAAAAACTGCATTAACA I-5I11
17  E07 I   C25A1.14    TTGGAGACCCCATTCAGAAC    GGAAAGTTGAAGCATCGGAA    I-5I13
17  E08 I   C25A1.15    GTGCAATGGATCGAGAGTAAATC AGTGGAAAAGTCGATCTGAAACA I-5I15
17  E09 I   Y106G6E.1   TCTCCGATCCTTCTGATAAATGA TCGGTAGGTAACTGTGTCATGTG I-5I17
17  E10 I   Y106G6E.2   TTTCTGCCACACATTTCCAA    CGTCTCATAGAAGGCTTCCG    I-5I19
17  E11 I   Y106G6E.3   GATCCAAATTTTCCCCAGTTTAC TCTGAAAACTTGCTCACACAAAA I-5I21
17  E12 I   Y106G6E.4   AAAACCATTTGAGGAATGTCTGA ACAGGCCACTAACAGTTTTCTGA I-5I23
17  F02 I   Y106G6E.6   TCATCACAGATACGGAAATGATG ACTTTCTGATCGGACGTTATTCA I-5K03
17  F04 I   ZC247.2 AACCGGGATGTTGTATGGAA    AGCGATTAGGTCCGCTAACA    I-5K07
17  F05 I   ZC247.3 AAGAGGTGTGAGCATGTGATTTT TCAATAGCTCTCATTCTTCAGGC I-5K09
17  F07 I   T20F10.1    CAATGAAACTTTTCCAAATGCTC ACAACTACCGTACTCACCTGCAT I-5K13
17  F08 I   T20F10.2    CATTCGTCAGCCTATCAAAAATC ATTATGTCTCCTTGTCGTCTTGC I-5K15
17  F09 I   T20F10.3    TGCGTACAGAACACAAAGCC    TTTGAGTAACTGGGGGCAAG    I-5K17
17  F10 I   T20F10.4    TGGATTCCAGCAAACTAAACACT TAAGCATTTTTCCATCTTCAGGA I-5K19
17  F11 I   Y106G6G.1   GATGGATAACAAAGTGAGCGAAC GATCAATCTTCTCTTCTGGAGCA I-5K21
17  F12 I   Y106G6G.2   AATCGTGAAGGTTTTTCATAGCA TCAGAGTGAAAGAAACACTGCAA I-5K23
17  G01 I   Y106G6G.3   AAAAAGTTCAGCGTCAAAAGTTG TTTCAGGTCTTGAATCTCGATGT I-5M01
17  G02 I   Y106G6G.4   AGTTGAATTGGCAACAATAGCAT TTACCATAACCCCTTTCACCTTT I-5M03
17  G03 I   Y106G6G.5   TGTTAACTTTAAGCAGCGACACA CTGACCACTTGGAAGAAATATGC I-5M05
17  G05 I   ZC434.2 TCACTGTAAAGCCCCAATAAAAA TCAGCGTTCTCTTCGTTAAAATC I-5M09
17  G09 I   ZC434.6 CACACATTCATCCAATTCGC    TTGACCAAGATGTGAGCAGC    I-5M17
17  G12 I   ZC434.9 CGACGAAGATCGAATGGAAT    TCTTTTGCGGTTGGGATAAG    I-5M23
17  H01 I   F45H11.1    CTTGTCATTTTCTCGTGTTTTCC ACGTTGTCACTGGATCAGAATTT I-5O01
17  H02 I   F45H11.2    AAAGTACAACCAGCGTTACCAAA ATATTCTCATGCTCTCTCGTTCG I-5O03
17  H03 I   F45H11.3    AACTGCAGCTTTCAGGCAGT    AGAAGACCGGTTCCCAGACT    I-5O05
17  H04 I   F45H11.4    GAGCCACAGATGCGGATAAT    CTTGGCCCTTGTTCTAGCAG    I-5O07
17  H05 I   F25D7.1 GGCAAGGCAATACAAGGAAA    TTCTCGGGATCCCTATTGTG    I-5O09
17  H06 I   F25D7.2 CATTTGATGATCGCACAACC    GAGGGATGACGGTGAGAGAA    I-5O11
17  H07 I   F25D7.3 GGGAGTCAAGATTTCCAGCA    AGATTTCCATAACCCGACCC    I-5O13
17  H08 I   F25D7.4 GGAGCTCTAGTCGGAGCCTT    CAGAAAAGCGCGAAAAACTC    I-5O15
17  H09 I   F25D7.5 CTTGAATTTGATGGCCGAAT    TCTCACACTCGTGGGAATCA    I-5O17
17  H10 I   Y106G6H.1   CTTCAAGATCTCATCAAAATCCG GGAATATCTAATCCCTGGAATGC I-5O19
17  H11 I   Y106G6H.2   ACCTGTTGCATCGGATTAGC    CATGGACACCATGAACTTCG    I-5O21
17  H12 I   Y106G6H.3   TTTTTGAGCAGTTTAAATTGGGA TCAATGTTGTTTCCGTTGTAGTG I-5O23
18  A01 I   Y106G6H.4   TTTTGGATCTTCAGCCAGTGTAT AGCTGTCTCTTTCGATCATCAAC I-5A02
18  A02 I   Y106G6H.5   ATCACATTTCCGTCGAGGTC    AATCGCCTATCACCTAGCGA    I-5A04
18  A03 I   Y106G6H.6   CGCTTGAACAACTTCATATTTCC CTTGCAGAGCTTCTGAGAAAAAG I-5A06
18  A04 I   Y106G6H.7   ACATGCGGAATTTGGAGTTC    CTGCTGGTGTCATTGGAGAA    I-5A08
18  A05 I   Y106G6H.8   GATTTAGTTGAACGCATTTTTGC AAGCGAAATATTGGCACTGATTA I-5A10
18  A06 I   Y106G6H.9   GTGGCTCTTGTCCCATCATT    CTGCAACAATGCCAATTCAC    I-5A12
18  A07 I   Y106G6H.10  AGCACATCGTATTCATTCATTCC CACCCTAAAAGTTTGTCATCTCG I-5A14
18  A08 I   Y106G6H.12  ACAATTTTGGTCTCCGAACG    CAATGCAAGCACTTTCCTCA    I-5A16
18  A09 I   Y106G6H.13  TTATAGGTGTGATGCGAGGTCTT TTCTCTAATTTTGCGGCTGAATA I-5A18
18  A10 I   Y106G6H.14  CAGCATCCGAGTCTGACAAA    GAATGTCATCAGCTCGACCA    I-5A20
18  A11 I   Y106G6H.15  GTCGAATGTCGGTTTCTATGAAG TACCTGTTTCAGAATGGAATCGT I-5A22
18  A12 I   Y106G6H.16  AACAATTGAAATTGAATCAACGG CGATCTTTTCCATGCTTATTTTG I-5A24
18  B01 I   F37D6.1 CTCACGAGCCCTTCAAAAAC    AGTCATACCACTTCCCGTCG    I-5C02
18  B03 I   F37D6.3 TATTTACGAAGCTAAAATGCCCA AAATTGCAAAAGTCGTCTGAAAA I-5C06
18  B04 I   F37D6.4 TTCGGCATATGAAACAAAGAAGT TCAAATTCCATTGGATCAATTTC I-5C08
18  B05 I   F37D6.6 TTTTATAAATTAACAGAGCGCGG TCGATTTGTGGAATTAGTCCTGT I-5C10
18  B06 I   F37D6.7 AAATCGATCGTCCAATGAGTATG GTATTAATGCGAATGAGACCTCG I-5C12
18  B07 I   F59C6.1 TTGGATTCAAGTCCGGAGAC    TTTGCGGACCAAACATTACA    I-5C14
18  B08 I   F59C6.2 ATAATTGGAAGCACAACCAGAGA GGTTCCATCAAAGTGATTCTGAG I-5C16
18  B09 I   F59C6.3 CATACTCTCGTTTCTTCCTCGAA AGAAAAAGGGATCATACCTGCTC I-5C18
18  B10 I   F59C6.4 TAGTTTTTCCGTTTATTTTGCGA AACGAAGAAACGTTGAAAATTGA I-5C20
18  B11 I   F59C6.5 GAAGGCTTAGTGGAGCAACG    TCGATCCAGGATTCTCTCGT    I-5C22
18  B12 I   F59C6.6 ATCATTTCGGACAATTTAGAGCA GGACAAACGAGAAAGGAGAATTT I-5C24
18  C01 I   F59C6.7 CTTGATTGCCAAAATTCAATCTC CTTTGAGAGATTTGGGGAACTTT I-5E02
18  C02 I   F59C6.8 AGTCCGGGATTAAGTTGAAAGAC TTCAAGTGATAAGGGTCGAAAAA I-5E04
18  C03 I   F59C6.9 TCCAATTTGCTCACTGCTTG    ATTTCAGGGAATCGCAACTG    I-5E06
18  C04 I   F59C6.10    ATGACGAGGTATGAACGAAAAGA AGAGAAGAAGGATAATCAACCCG I-5E08
18  C05 I   F25H2.1 CCAATTTCATGGTGGGGTAG    CGTGGTTTTCCACGAAACTT    I-5E10
18  C06 I   F25H2.2 CAGGTCATTTTTAGCGCACA    TAACCTTCAAGTTCCCGTGC    I-5E12
18  C07 I   F25H2.3 AACATGTCTACTCCCGTGCC    CCCACTCAGGAAAACATCGT    I-5E14
18  C08 I   F25H2.4 CCTACTCGACAATCATCCTTCAC AAAACGGAAGGGGATTAAACATA I-5E16
18  C09 I   F25H2.5 TATGTTTAATCCCCTTCCGTTTT ACATAATTCTCGCAAAAGGTTCA I-5E18
18  C10 I   F25H2.6 GAAGCTTTTTGCCACGAAAC    GTGCTCATCAACTCGTCGAA    I-5E20
18  C11 I   F25H2.7 AGTGTCAGCAGGCTGATGTG    TTGTGCTCAAAATGTTCCGA    I-5E22
18  C12 I   F25H2.8 GGCTCACCGAAACTGAAGAG    CCAAGTGGAGAGCGAAAAAG    I-5E24
18  D01 I   F25H2.9 CGACTATCCCACCTCTTCCA    GTGCGGACGTATTGAATGTG    I-5G02
18  D02 I   F25H2.10    TGTTGCACTAAAACCACCGA    ATGTTTTGAAGTCCGTTGGC    I-5G04
18  D03 I   F25H2.11    GTAATTTCAGTTACTGGCCCCAT TGTTGCAATCGATATGTGATAGG I-5G06
18  D04 I   F25H2.12    TTTCAGTTCACATTGGCTGC    ATCGAACTGAGAGCTTCGGA    I-5G08
18  D05 I   F25H2.13    AATTTGACGGTACGGCTGAG    CAGCAACATCTTGAGCGTGT    I-5G10
18  D06 I   T22A3.2 ATCGTCAGCAATTTTTCTTTTGA TCAAACAACATTTCAGAATGCAC I-5G12
18  D07 I   T22A3.3 CGCTCAATCAACCTTCCAAT    TCGAGTTGAGCAAACCACAG    I-5G14
18  D08 I   T22A3.4 TGAGCGAATTCTGTGCAAAC    TTGGATCAAATGATGCTGGA    I-5G16
18  D09 I   T22A3.5 TTCTCCGAATCTTGTTCAAATGT ATCCTTCCCATCATCATCTTTTT I-5G18
18  D10 I   T22A3.6 TTCAACCATGTCGTCCTTCA    GCGCCTTTATACACCACGTT    I-5G20
18  D11 I   T22A3.7 TATTTCAGGGCGATTTCCAG    GAACATGAAAGAAAGGGGCA    I-5G22
18  D12 I   T22A3.8 GAACTCAGGAGAGCGTGGTC    TGGTTTCGGGAATCCAATAA    I-5G24
18  E01 I   C43H8.1 TTGGTTTCAACCGTTCTGATATT AAGGAATTAAGCGAGAAAAGGTG I-5I02
18  E02 I   C43H8.2 GCACTTGAATTCTCCAAATGTTC TGAGGATTGATGAGAAATGGAAT I-5I04
18  E03 I   C43H8.3 CCAATCACTTCATTCTTTATCGG AAATTGATACAGTGAGCGACGTT I-5I06
18  E04 I   B0511.1 GGTCATTAATTGTGTTTCCCAAA CATCTCGATCCATAATTTTCAGC I-5I08
18  E05 I   B0511.2 TCCATGTCCCGACTGAAAAT    TGGCTGATTGAGCAGTTGAC    I-5I10
18  E06 I   B0511.3 GTCTGCGATACACAGCTTTTCTT GCACCTTTGCAACATTATCAAAT I-5I12
18  E07 I   B0511.4 AAACGAAAGCTTTTGCTCCA    ACAGGAACAATCGGAGTTGC    I-5I14
18  E08 I   B0511.5 AGACCGGCTACCGTATTTTTAAG GAGGGTTTGTTTTGATACGAGAA I-5I16
18  E09 I   B0511.6 AAGAAGAAGGTGCTCAAGCG    GAAATTTCGAACCGCCATTA    I-5I18
18  E10 I   B0511.7 GAGATCTGGTGCAGCATTCA    GTTGATTTCGCTGTTGAGCA    I-5I20
18  E11 I   B0511.8 ACGCTGTGAAAAATGCACTG    ATGCATCTGGAGCAGGAGTT    I-5I22
18  E12 I   B0511.9 CCTAAACACAACCCTGACCAGTA TGTGAGGAAAAACACTTCCATCT I-5I24
18  F01 I   B0511.10    CAATTGAAGGGCGATTTGTT    GACTCCGTTGTTGCCATTTT    I-5K02
18  F02 I   B0511.11    ACATTGATTGGGGCTTTGAG    ATTTGAAGCCGAATGAGGTG    I-5K04
18  F03 I   B0511.12    AATTGGAGATGAAGCATCCG    GGCATTCCCATTCACAAGTT    I-5K06
18  F04 I   C34B2.1 TGAATTTTGAGAGCAAAAATGGT CAACGACACTTTTAGATTTTCGG I-5K08
18  F05 I   C34B2.2 TAGAAATTGATAAGTCGGGCAAA ATGCATAAGTGAGATGTGGCTTT I-5K10
18  F06 I   C34B2.3 GGGAGATGCAATTGGAAAGA    TGTGTAGTTCGGAGTGTCGG    I-5K12
18  F07 I   C34B2.4 GGAAATCAATCTGTAGTGCCTTG TTGGTTTTCAATTTTTCTTGGAA I-5K14
18  F09 I   C34B2.6 AAATTTCACCAGTCATCGCC    CATCTCTCGCCACAGAACAA    I-5K18
18  F10 I   C34B2.7 ACCCTCTCCTCGTGATCCTT    CGCACCGAAAGTGTGAACTA    I-5K20
18  F11 I   C34B2.8 GTTGAGGTGAAACCAAAAATGAG AGAAAACAAGCGATAAATGCAAA I-5K22
18  F12 I   C34B2.9 AAATTTAGTGTTTTGGGGTCGTT TTGCAAAGCTATGGTATTTGGTT I-5K24
18  G01 I   C34B2.10    GGGAGTAGGATAGGAGGATTCAA TATTCCGAATTCGTTTTGCTTTA I-5M02
18  G02 I   B0205.1 TACACATCGAACGACGGAAA    ATTTGCTCGGTGCTGAAACT    I-5M04
18  G03 I   B0205.2 ATGTCCCGCCTAATTATCCC    TTTTCCCAACCAGCAAGAAC    I-5M06
18  G04 I   B0205.3 TGGAATTCTGTCAATGGCAA    GAGCTCCATCCACATCCATT    I-5M08
18  G05 I   B0205.4 GCGCGGAAATTCAAAAATTA    GGCATGAAGTAGGCAGGTTC    I-5M10
18  G06 I   B0205.5 ATTAGTTGTTGAAAAGCATTGCG TCTAATAAGCCGGTGTGTAAGGA I-5M12
18  G09 I   B0205.8 TTCGCCTACTACTTTGAGTCCTG CTTTTTCGAACGCTCTTCAATTA I-5M18
18  G12 I   R13H8.1 AGTACAGCAATTCCCAAATGAAA AATTGGATTTCGAAGAAGTGGAT I-5M24
18  H01 I   R13H8.2 ATCCCCTCCTCTTACTCCTTCTT TTTCCGAATATCTTTGAACAGGA I-5O02
18  H02 I   F55A3.1 CGTACTTCCCATTTCGCATT    CTTCGTCACAACTGCTCCAA    I-5O04
18  H03 I   F55A3.2 AAATTTCCAGATCTCCGCCT    GCTCCGACACTTCGAGAATC    I-5O06
18  H04 I   F55A3.3 CGTTTCGAAATTATGCCGTT    TTACTTTCTGCGTTTGTGCG    I-5O08
18  H05 I   F55A3.5 TCGCGTAATTGAACCAAATAAGT AATCGATGAGCTGTTTGATTTGT I-5O10
18  H06 I   F55A3.6 AAAATGCCGAAACTAAAATCACA AGGAATTGTATGATCCCAAAGGT I-5O12
18  H07 I   F55A3.7 CCGAGCTTTCATGATTCCAT    GAGCCGATGGTCTAGATTCG    I-5O14
18  H08 I   C35E7.1 CTAAAGCGGTACGGTCAATGTAG TGGAGTTAAGGTCAGTGGGAGTA I-5O16
18  H09 I   C35E7.2 CGCATGGCTTGAGTCTGATA    CGGGGTGCTCTAGAAAGTTG    I-5O18
18  H10 I   C35E7.3 CAGTTCAAAGAAGCCCCAAA    ACGGCAAAAATCCATGTCTC    I-5O20
18  H11 I   C35E7.4 GATAAGGGCAACCGAGTGAA    CTGGAGGCGTCTTCTTGAAC    I-5O22
18  H12 I   C35E7.5 AAGCATTCAACGAAAGGGTG    CAAATTTGTGGATGAAGGGG    I-5O24
19  A01 I   C35E7.6 ACGTACTCGTTCAAATCCCG    GACGCGCACTGTATAAGGGT    I-5B01
19  A02 I   C35E7.7 TTGTCTTTCAATTCAACCGAGAT AGTAAGAGACAGCGCTGAGAAAA I-5B03
19  A03 I   C35E7.8 AGACATCCCTGAAGACGTAATGA TGGATCTAAGCGGATACTCAAAA I-5B05
19  A04 I   C35E7.9 ATCACCATTGCTGGATGGAT    TGCCTTGTTTCGAGTGAGTG    I-5B07
19  A05 I   C35E7.10    TGGTACCTTCTTTTTCAGATCCA CATTCAGGTGAGTTGTGCTACTG I-5B09
19  A06 I   T27C10.1    TCTCACGTTTTTCCAGACAATTT GAAGTACAGACAAGGGTGAATCG I-5B11
19  A07 I   T27C10.2    TAGGAATCGCCACCTCATTC    TGTGCGTGTTTCCATTTTGT    I-5B13
19  A08 I   T27C10.3    TTTTCGATTACCGATTTTAGCAA ATTTTAATGGTTCACGGAGGAAT I-5B15
19  A10 I   T27C10.5    AAGTGCCCGGTTTCATGTAG    CCCGGATCAGTTAAAACGAA    I-5B19
19  A11 I   T27C10.6    ACAGATTTTCCAACGCCATC    TGTGTCCAGCGTTGAAAGAG    I-5B21
19  A12 I   F49D11.1    TTTCGGTTTTCGAATGGTTC    AGCTTCCTTCAATTTTGCGA    I-5B23
19  B01 I   F49D11.2    CATCACCAGAATCTCAGCGA    AGCGCACCTTCCCTAATTTT    I-5D01
19  B02 I   F49D11.3    ACTATCACTGCCTGCCGACT    GACTGGCTTCTGACGACCTC    I-5D03
19  B03 I   F49D11.4    ATCCGTCAAAAGGTCACAAGTAA CCATACAACGAATTCCACACTTT I-5D05
19  B05 I   F49D11.6    TGATATTGGTTTTTGGTCCGTAG CCCCCAATTTCTCAGAATAAAAC I-5D09
19  B07 I   F49D11.8    AGTGAATTGGGAACAGAAAGTGA GCCACCTCCTTTGTTTTAAGTTT I-5D13
19  B08 I   F49D11.9    CATGGCCTAGCAATCCAGTT    TGCGATTTCTGATGCTTTTG    I-5D15
19  B09 I   Y95D11A.a   CCCTTCTTGGCTTTTTGTAATCT TATTCAAAGTTCCTGTGCGATTT I-5D17
19  B10 I   Y95D11A.b   ATGGAGCGAATAAAACACTGAAA GTGCAATGTATTGGGTTACACCT I-5D19
19  B11 I   Y95D11A.c   CCCTATTTCGCGAATCTACTTTT GAATCTAATGAACATGCCGTAGC I-5D21
19  B12 I   Y52B11A.1   CCAAAATCGTACTATTCCTGCTG ATTCTGCTGTTCTCATGTCGTTT I-5D23
19  C01 I   Y52B11A.2   TTACCATCACATTATCCGCTTTC GCATAACTCGATCACATGGAAAT I-5F01
19  C03 I   Y52B11A.4   ATCTCCGAATAGCACTGTGAAAA GTCTAGCCCTCCGTTAACAATTT I-5F05
19  C04 I   Y52B11A.5   TCTATAAAAATCGGCGAAAGTCA CAAAGGAATTGGATCACTTTGAG I-5F07
19  C05 I   Y52B11A.7   GTGACCCACTTCCATACATCATT TGAAGTGACCAATGAAATTGTTG I-5F09
19  C06 I   Y52B11A.8   CGACCTCTATTTGGGTTACCTCT TAGACAAACAAGAAAATGGCACA I-5F11
19  C07 I   Y52B11A.9   AATCACCTTAACAACAATCCCCT AGCTTTTTCAAGCTTTTTCACCT I-5F13
19  C08 I   Y52B11A.10  TTTCGATTAATCTTTTTCAGCGA CTACACATTTTTCAGCCTCAACC I-5F15
19  C10 I   W02B9.1 CTTGCATGTACTTCAAAAATCCC TATTTCTGTGAATCAGGAGGGAA I-5F19
19  C11 I   Y52B11B.1   AATTTTCAGATCTCTTTCCCGTC TAAAATGGATGATATTGAACGGC I-5F21
19  C12 I   Y52B11B.2   ATGTGCCAAATTTCGTAGCC    TCCAGAACAAACGGAAAACC    I-5F23
19  D01 I   ZK39.1  GAAATCTCGAGCCAAGCATC    TAACCCAATTCCACGGAGAG    I-5H01
19  D02 I   ZK39.2  GCCAATGTTAGAATTAACCTCCC CTTCTACTTGGCTTCTTTCCACA I-5H03
19  D03 I   ZK39.3  ATGTGCAGATCTTTGATAGGGAA CTTTTCTTTCCACACACGTAACC I-5H05
19  D05 I   ZK39.5  TATATCGGCCTGAAAGATCAAAA TTGGATTTCCTCAAAAGCTCATA I-5H09
19  D06 I   ZK39.6  ATTTTGTTTTCTGGTGGGAAAAT ATTAGGCTTCTCAATTAGGTCGC I-5H11
19  D07 I   ZK39.7  GACAACTCGGATTTCAACTCATC TAATTTTCAGGTGATTACCACGG I-5H13
19  D08 I   ZK39.8  TAATGAGACAGAACTCAGTGCGA CCATTGATTTCGATTCAAGTAGC I-5H15
19  D09 I   Y52B11C.1   CTATTTTATGAATTCTTCCGGGG AATGCTCCCATTAATACTGCTCA I-5H17
19  D10 I   F28D9.1 TTCTTCTCCTTCTTTGCCTTCTT TTTTACCTTCAAATTCGCAAAAA I-5H19
19  D11 I   F28D9.2 TCAATCCAATATCTGGTAATCGC ATGGTAATTGGACAACCTGACAC I-5H21
19  D12 I   F28D9.3 AAAGGCACGAGTTGAATTGG    CCCCCTCGAATTTTTGATTT    I-5H23
19  E01 I   W06H12.1    TTTCGCACTGTTTTTCAATTTTT AGTCACCGGATGCTAAACTACAA I-5J01
19  E03 I   Y53H1A.b    TGCATTGCAGTATTGCTACCTAA TTTAAACAAGTTCGGACGAAAAA I-5J05
19  E05 I   Y53H1A.d    TCCTGTCCAAACTACATGCTTTT TCGAATTTGACCGAAATTTTCTA I-5J09
19  E06 I   Y53H1D.a    TCTAGGTTCTTTCGTTTCACTCG GATGAAGCTACAAACATCGGAAG I-5J11
19  E08 I   F46A8.2 CCAAAACATTCCTGTTCGCT    TGGTAGACGATGAAGCGTTG    I-5J15
19  E09 I   F46A8.3 TTTCCGATGTTGCTCTACTGATT TAAACTTTGAGACTGAAGTCGGC I-5J17
19  E11 I   F46A8.5 ATCGGACTATTCTGAACCACAAA GCGTTTTAATTAGGCGTAGGTTT I-5J21
19  E12 I   F46A8.6 GGGGAAATTTGATTTTCTGTAGG GTGACCAACCACGTGTCTATTTT I-5J23
19  F01 I   F46A8.7 CTCCCCAAGCTACTATTCCATCT AGTCATCCGAGTGTGTGTCCTAT I-5L01
19  F02 I   F46A8.9 ATCCACGGGCTGAATAAATAAAT GATCCTCGAAGTATGTGAAATCG I-5L03
19  F04 I   F36D1.1 ACTACTCCCGACTTCTCACTTCC AATTATCGATTTTCTCCGTTTCC I-5L07
19  F05 I   F36D1.2 GTACATACCTTCCGACTCTCGTG TTTATTGCCCTACTGCTTCTCTG I-5L09
19  F06 I   F36D1.3 CTGAAAATAAATTCCGCTTTCAA TGACATTTCCGCTTTGTAGTTTT I-5L11
19  F07 I   F36D1.4 AAATCCAATCATTCCCATTTTCT CTTACCCATTTGCTCAACAGTTC I-5L13
19  F08 I   F36D1.5 CCTATTCGTTTTCCTAGCCATTT TGGAAAAACATTCAATAACCGAG I-5L15
19  F09 I   F36D1.6 CTGCGGAAGAACACATTAGAAGT TCACGTGCCCATTAAACTTTATC I-5L17
19  F10 I   F36D1.7 TATTGAACCCCCATACACAATTC TTCACATTCAGCAAAAATTCCTT I-5L19
19  F11 I   F36D1.8 GCGTCATTCTGTATCTTTTCCAC ATCCAAATCGGCGATAGTAATTT I-5L21
19  F12 I   Y53H1B.a    TTTTTCCAAAATTTCAGCCTTTT CAAGGTAAGCTTTTTCCGAATTT I-5L23
19  G01 I   Y53H1B.b    TTCTGCAGATTGGTATTGGTTCT CCACTACCCTACTCCCATATTCC I-5N01
19  G03 I   Y53H1B.d    AGTACCCCGACTCACTATTCCTC TTGTAACCCAAATCTTTGCAAGT I-5N05
19  G04 I   H25P06.1    CTGCAACCATTGTACCAACTGTA ATGATTTTCTTTTGCAGAACGTG I-5N07
19  G05 I   H25P06.2a   GACAAACACCAAATGGAACAAAT ACACTTTCTCTCTGCACAAAAGG I-5N09
19  G06 I   H25P06.4    TTCCCGAATCAGTCAAAAGTTTA ACCTAAGCTTTCTTGGAAACCAC I-5N11
19  G07 I   M04D5.1 AATATGGGCATGATGTGGGT    CGGAAGTTTGAATTCGTGGT    I-5N13
19  G08 I   M04D5.2 TTTCGAGTTATCCAGCATGATTT TCTCTCATACCACGATGAAGGAT I-5N15
19  G09 I   F56G4.1 CTCTCAAAACCAATGCTAACACC TCAACAAGACACTGATTTCCCTT I-5N17
19  G10 I   F56G4.2 GGAAAAATGGGAGTTCGTGA    CTTCGAAGCTAACCCAGACG    I-5N19
19  G11 I   F56G4.3 TACAATAGCCGCATTAGGGG    GGAAAAATGGGAGTTCGTGA    I-5N21
19  G12 I   F56G4.4 CGCATTTTTCGTTTTAATATTGC AATCTCGATTTTTCGTCCATTTT I-5N23
19  H02 I   F56G4.6 CAGCTTCTCCTTACTCAAATCCA ACAACTTTCAAGCTTCGTTTCAG I-5P03
19  H03 I   Y53H1C.a    TTTTTCCAGGTAACTCAACGAAA TTTCCTCCAAGTAAACCCATTTT I-5P05
19  H04 I   Y53H1C.b    ATTCTAGGCCATCAGGCTAAAAC CCACCAATCTAAAAATCTTGCAG I-5P07
19  H06 I   Y53H1C.d    ATTAGCATGACCAAAACCTCTGA TCTCACGTTCATTTGGATTCTTT I-5P11
19  H07 I   C27C7.1 ATCCACTGAATCACCTCTCAAAA CATACAGTTAAGGATGGCCTGAG I-5P13
19  H08 I   C27C7.2 GAAAACTTGCAAACTTTGTGCTT TAACTACTCACTCACCCGGAAAA I-5P15
19  H09 I   C27C7.3 TGTTAGCTTTCAAAATGGGAAAA TCATTTTGGATTCCTTCTGAAAA I-5P17
19  H11 I   C27C7.5 CCACCTCTGTTCTGATGGATAAC TTGCAATGAAGGCTTTGATATTT I-5P21
19  H12 I   C27C7.7 GCGTCGGAAAATGATGAGAT    TCGAGCTCACTCTCTGCTCA    I-5P23
20  A02 I   ZK1025.2    CACATTTCTCTTTTTATCGCCAC GGTCTAACAAACAATGTGGAAGC I-5B04
20  A03 I   ZK1025.3    ACAGAATTCAACAGCTACCCAGA TACCGATGATATCTCTGCACCTT I-5B06
20  A04 I   ZK1025.4    TTCATTCCAGAAAAGTCATTCGT CAGATAAGAACGCAGAAATACGG I-5B08
20  A05 I   ZK1025.5    TGGAACCCTACTTCTCAACTCAA TTGATATCTGTGAAACCCATTCC I-5B10
20  A06 I   ZK1025.6    AGCTTTAGCCTGAACTTATGCCT CCTTCCTCAATTTAACTCGACCT I-5B12
20  A07 I   ZK1025.7    ATTTGCCATTGAGGAAATCG    AAAACTAAGCTCACGGCGAA    I-5B14
20  A08 I   ZK1025.8    GGTCTAACAAACAATGTGGAAGC CACATTTCTCTTTTTATCGCCAC I-5B16
20  A09 I   ZK1025.9    AATTTCAGATTCCAGATGCAAAA GGATGGAAACATGAGAGATTCTG I-5B18
20  A10 I   K08C9.1 GACAGATCAAGTTAATTTTGCCG GATTTTCATTCATCGGATTTTCA I-5B20
20  A11 I   K08C9.2 GTCAACCCAAAAATTGCAATAAA ACAACGAGTTTACCATGCTCATT I-5B22
20  B01 I   K08C9.5 CAAACCACCCGTCTGCTTAT    CAAGCCATGGAGCAATTTTT    I-5D02
20  B02 I   K08C9.6 GATCATCTTTCTTTGCCATTTTG TTCTAGTCGAAAATTGCGCTAAC I-5D04
20  B03 I   K08C9.7 GTTGTTCCCACCTATTCTAACCC ATTATCGATTTTCGCAAGTTTCA I-5D06
20  B04 I   F32B4.1 TGCCCCATCAACTAGACACA    TTCCACACATCCAGATTCCA    I-5D08
20  B06 I   F32B4.3 TCTTCAAAATTTTCTGGTTCCAA GTTGAGCAGTTAACGGAGAGAAA I-5D12
20  B07 I   F32B4.4 GATCAGAGCCGAAAAAGCAC    TGGAGTTGCAGCATTTTGAG    I-5D14
20  B09 I   F32B4.6 GCTGGAGATCATCGGAAAAA    CTGGAACAGAGTCGGACCAT    I-5D18
20  B10 I   F32B4.7 CTCATTTCTCATCTTTTCTGCGT AAAGGGAACTTTGTCTCTATCCG I-5D20
20  B12 I   F15D3.1 AGCAATGTCCACGTCATCAA    AATGGAAGGGAAATTGGACC    I-5D24
20  C01 I   F15D3.2 ATTTTGGACAATTGAAGCACACT ATTTTCTCCCTCTTGGTCTTCAC I-5F02
20  C02 I   F15D3.4 ATTTTGTTGGCAAATGTGAGACT TCCTAGATAGGCAGGCAAACATA I-5F04
20  C03 I   F15D3.5 GTGCAAAATTAACAGGCTTATCG ATTTTCGATGTTTCCCTGATTTT I-5F06
20  C04 I   F15D3.6 GAAGGGAAGAATTGTCTGGAACT TCGACGAAAAGCTGACATATACA I-5F08
20  C07 I   F15D3.9 AGCAATGTCCACGTCATCAA    AATGGAAGGGAAATTGGACC    I-5F14
20  C08 I   F15D3.10    ATCCAACGGAGAGCTTCTGA    GTAAGTGTCAATGGAGCGCA    I-5F16
20  C10 I   C17D12.2    AAAAGACAAAATGGACGACAAGA AAATTTCACGACTTCTTCAACCA I-5F20
20  C11 I   C17D12.3    ATGCTTCAAACTCACCCCAG    CGCGAACAATTTTACCGATT    I-5F22
20  C12 I   C17D12.4    AGGCCATATACTTCGGTTCATTT AAACTTGACACACACTCTGACGA I-5F24
20  D01 I   C17D12.5    GAAAACTTGCTTTGACGTGACTC TTCAAACAATTAAGCTTGGCAAT I-5H02
20  D02 I   C17D12.6    TCACACTCACACGAGAAGCC    GCGCTAAAACGTATGCACAA    I-5H04
20  D03 I   C17D12.7    GACCAATCTTGAGCAAAAATCAC AGCTGAAAATGCTAAAAATTCCC I-5H06
20  D04 I   Y47H9A.1    ATTATCTCCTTCTTGACCTTGGG AACTCACCCCAGTAGGCTTTAAC I-5H08
20  D05 I   W04G5.1 GTGAACCCATCGTTCGTTTT    ACAAGCTTTTGCTTCGAGGA    I-5H10
20  D06 I   W04G5.2 AACCAGTTCAAATCTGTCGAAAA GCATTGACAAATAAAGTTCTGCC I-5H12
20  D07 I   W04G5.3 TATGGTGGCATGTTTGTGTATGT TTTTCGATGGACCTGAAAAATAA I-5H14
20  D08 I   W04G5.4 ACTCCCGTGTGCTACCATTC    GCCAGTGCATCTCAACTGAA    I-5H16
20  D09 I   W04G5.5 GCTTACAGAACGCCTCCAAG    ATCCCGCTTAAGTTCCGTTT    I-5H18
20  D10 I   W04G5.6 ATAACATCGTTGTTCATTCGCTT GAAGAATTAAAAGTGATGTGCGG I-5H20
20  D11 I   W04G5.7 GGCCCTTCCTTATAACTCGC    GCGCAGGGATCATAGACAAT    I-5H22
20  D12 I   W04G5.8 TGACTCATAGCAAAATGACTGGA ATTGTCAGCGATCATCTTTGATT I-5H24
20  E01 I   W04G5.9 AAACGGCTTTGTACGAATAATGA TTGTCCACTACCCGAGAATAAGA I-5J02
20  E02 I   F11A6.1 CGAAAAGATGATCCTAACCACAG CCGAAATTGTACCGTAACAAGAG I-5J04
20  E03 I   F11A6.2 ACTAACAAATGGGGCAGCAC    TTTTGTGCAAGCTCACGAAG    I-5J06
20  E04 I   T22H2.1 CTTTTTCAGACCTACTCCAGCAA ACGTTCTCCTGCTTTCTTTAGGT I-5J08
20  E05 I   T22H2.2 TTTGGCTTTGTAACCACATTCTT CCTCAATCGGTAGCATTCAATAG I-5J10
20  E06 I   T22H2.3 TTTCCAATTTTATTGCACCAATC GAATCATGTGCTTTGATTTGACA I-5J12
20  E07 I   T22H2.4 CCAGTGGAAGTAGAACAATTTCG GATTGGTGCAATAAAATTGGAAA I-5J14
20  E08 I   T22H2.5 TGAGCAAAAATACACATTTCGTG GCAGCAACCAGTAATAAACCAAC I-5J16
20  E09 I   T22H2.6 GCCAAGCCAAATTAACCAAA    GCTCAATGGACAACACATCG    I-5J18
20  E10 I   F35E2.1 CAATTGTAGGGAAAACTCACCAA CAGTCAAAACTTTTCAGCGATCT I-5J20
20  E11 I   F35E2.2 AAATCCATTTGTAGACGATCCCT AAAGTAATATAGGGGGTCACCGA I-5J22
20  E12 I   F35E2.3 GTAGGTAGGCGTAAATGGGATTC TTTATTCCAACAAAAATCCAACG I-5J24
20  F01 I   F35E2.4 AATATAGTGCAAACCTTCAGCCA ATGACCAAAATTGACAAGAAGGA I-5L02
20  F02 I   F35E2.5 CTGGTCAATGAACATCACCG    ATGTCGGCCGCTACAAATAG    I-5L04
20  F03 I   F35E2.6 TTGCCATTAGCACCACTCAG    GCTGCACCAAAGTTTAAGCC    I-5L06
20  F04 I   F35E2.7 TGAAATTGCATTGGTTTCCA    CCGCCCACTGGTATATTTTG    I-5L08
20  F05 I   F35E2.8 GCCTGAGAGAACCTGCAAAG    TTTCAAGTGAAGGTGTCCCC    I-5L10
20  F06 I   F35E2.9 ACAAATTTACCTGATGCGGC    TTTTCCACATCACCAATCCA    I-5L12
20  F07 I   Y47H9B.1    CAGACAGTGGGACAACAATATGA CAGTCGATTTGAATCTCTTCTGG I-5L14
20  F08 I   Y47H9B.2    TTTCAAACGTGTGAGTTCAAAAA ACAAGGTAGGCAGGCATAATGTA I-5L16
20  F09 I   ZK1151.1    GAGCCATGAGCACTTGATGA    GCAACTCGAACGACCTTCTC    I-5L18
20  F10 I   ZK1151.2    TTGTTCATGGCAATCGTGTT    GGAGATGATGGAGAATCGGA    I-5L20
20  F12 I   F53B8.1 ATTCAGGGATCTTCAGGGCT    TTCTCCGATCATCACCATCA    I-5L24
20  G01 I   T02G6.1 GAGGACGTCGGAGGTAAATCTAT GAGCATGTTTGTGTGGTGAATAA I-5N02
20  G05 I   T02G6.5 CCGGCATATCGCAAAATAGT    AGCCAGGCCTAGTCAACCTT    I-5N10
20  G06 I   T02G6.6 GCCCATACCTTGTCTTGGAA    GTTACATTTGCCCAGGCTGT    I-5N12
20  G07 I   T02G6.7 CTGTTGGCTAACGTGGATCA    TGTCCGTACAAATTGCGGTA    I-5N14
20  G08 I   Y47H9C.1    ACTATATCAACAGAGGCCGCATA TATTTAAAAGCGACTTCATGGGA I-5N16
20  G10 I   Y47H9C.3    CACCATAAACATTTTTACGCCAT CTCCTGTAAGACGGCAAGAGATA I-5N20
20  G11 I   Y47H9C.4    CGGGCAGATACATAGTCCGT    AACTGTGAGAAGCAGGCGAT    I-5N22
20  H01 I   Y47H9C.6    AAATATGATAAAGCTGCGTCGAA ATTTTAAGAAATTTTTCAGGCGG I-5P02
20  H02 I   Y47H9C.7    TTGAATTCCTTCCAAAATGAGAA GTACAGATTCAAAATGAGCTCGG I-5P04
20  H03 I   Y47H9C.8    GCGCTCCACGACTAACTTTC    TTTCCCAATGAAATTCGAGG    I-5P06
20  H04 I   Y47H9C.9    AAATGCCTAGATAGTCGAGGACC CAGCTGTTTCCATCTAATTCCAC I-5P08
20  H05 I   Y47H9C.10   TTGTGAAGTTCTCGGTGACG    GCCAGAATATTTCGGGTTGA    I-5P10
20  H06 I   Y47H9C.11   GAAACGGGTCCAAAAGACAA    GCAACGTTTCGGTTGAAAAT    I-5P12
20  H07 I   Y47H9C.12   CAGTTTTTATCGCAATTTTCGTC TCAACACAAACCTGTGAGAGCTA I-5P14
20  H08 I   R09B3.1 CACTGCGTTTGACCTGAAAA    ATTTGTCATCCTTCCATCCG    I-5P16
20  H09 I   R09B3.2 AAATAGAGAAACTTCCCCGAATG AAAATCTGTCGAAATCGATGCTA I-5P18
20  H10 I   R09B3.3 TAGCATCGATTTCGACAGATTTT ATCGTCATGTCTGGATTCTCTGT I-5P20
20  H11 I   R09B3.4 ATTTTCATCGATTTTTGACCCTT ATCAAAATCAATTTCATAGGGGG I-5P22
20  H12 I   R09B3.5 AGATTGGCTTGATCTTGAAGTGA CCCGGTTTTATTTAATGGATGTT I-5P24
21  A01 I   R06C1.1 AACATCCATTAAATAAAACCGGG ATGGAGTCGATGACGTCACTTAT I-6A01
21  A03 I   R06C1.3 AACGGTTTGGAGATTTTCTCTTC TAATTTCATTGATTTTGGCTGCT I-6A05
21  A04 I   R06C1.4 AATATCCCTCCCGTAAACCTACA TGCACGAAGATAGAATTTTTGGT I-6A07
21  A05 I   R06C1.6 CAAAAGTCATCTCCACCACTCTC AGTTCGAAATTTTGTGGGTTTTT I-6A09
21  A06 I   Y53C10A.1   TCGTATTGAAAGGCGATCATAGT TTATCTTCGGTTAAAACGGGATT I-6A11
21  A07 I   Y53C10A.2   AATCCCGTTTTAACCGAAGATAA AAGCAGCTTGAATCAAATCAGAC I-6A13
21  A08 I   Y53C10A.3   TAAATTCAGAAAAACCGCAAAAA TTCCCCTTTAGAGTCCAAAACTC I-6A15
21  A09 I   Y53C10A.4   CTCGTCATACCCACCATTTTTAG TTTCTGTGAAGATCCTCCATCAT I-6A17
21  A10 I   Y53C10A.5   GATCTAGGGCTTCTCTGATTGGT GGTACTTGGGGGAGTAATGTAGG I-6A19
21  A11 I   Y53C10A.6   GGAAACATCATTTGAGACACGTT TCAGTTTTCTCCTTCCAAAATCA I-6A21
21  A12 I   Y53C10A.7   TTATTATGAAAGTGGATCCGCAC GCACAAGACAAATCGAGTAATCC I-6A23
21  B01 I   Y53C10A.8   CGGAGAAAAAGTGATTTGAATTG CTTGCCAAAAGCTTAACAACATT I-6C01
21  B02 I   Y53C10A.9   AAAAAGACACTTCAAAGTGCAGC GAGCAAACCGTCTTACAAACATC I-6C03
21  B03 I   Y53C10A.10  TCCAGTAGGTAATCAGGTCAGGA CTCAAGGTCTACAGCGTCAGATT I-6C05
21  B04 I   Y53C10A.11  ATGTTTTTCCGCTGTTTGTTAGA ACATTCAAATCGCTGATGAAACT I-6C07
21  B05 I   Y53C10A.12  TCTAGAAAATTCCGGGAAAAACT GGTGTGCTGGAAATAGACTTTTG I-6C09
21  B08 I   Y47H10A.c   TTCAGAAAAACTAAAGTCCAGCG CGAGATATAAACGGTCAAAGTCG I-6C15
21  B09 I   Y47H10A.d   CTGGGGTACCCATAAAAATCTGT TTTGTTTGTTTATTCGTTGAGCA I-6C17
21  B10 I   Y47H10A.e   ATACACGTTCCCGTACACAAAAC CGGATTTTGTAACCAATAAGCAG I-6C19
21  B11 I   Y47H10A.f   AAAACGTAGCAGTCACCATTGTT GGTTCATGAGCACACCTAAAGTC I-6C21
21  B12 I   Y47H10A.g   GTGTACAAACTTCTTGGAATCCG TTAAAGGGCCTATCACTTTCAGC I-6C23
21  C01 I   M01G12.1    GGCGCCGATATAATTGCTAA    CTGCTGCGTTTTTCGTATCA    I-6E01
21  C02 I   M01G12.2    TAAAGTGTACCAGTAGGCGCATT CCTACAAGCATGCCTACAAAAAC I-6E03
21  C04 I   M01G12.4    ACCAAGAGGAAACAGTGAAATGA ATGAAGAGGAAGACAATTCGACA I-6E07
21  C06 I   M01G12.6    TCACCTGCTTTTCCATTTCC    CTGGCTCCATTTGCATTTCT    I-6E11
21  C07 I   M01G12.7    CCTTGTTCACAACCTCCGAT    GACTTCCCAACTGACTTCGC    I-6E13
21  C08 I   M01G12.9    TTTGCATTAGGAGGGAATCG    ACCAAAAACTTGCAACAGGG    I-6E15
21  C09 I   M01G12.10   ATCTGCAAAACCATCAGAAAGAC ATTTCTTTAACAAGTAACCCGGC I-6E17
21  C10 I   M01G12.11   TTTCTGACACTTCCTGGGTAAAA CTGCCCCATATCAAACGTAAATA I-6E19
21  C12 I   M01G12.13   GCGAACTCTGAAATGAAAAGAGA TGATACCTTCAATTGCTTCGATT I-6E23
21  D01 I   M01G12.14   CTGATAATGGAGGCGGAGAA    AACCGATTCCTCATCCCTCT    I-6G01
21  D02 I   F15H9.1 CACTGGCACTGTCCAGAAAA    ACCTGGAGAGCCAAACACAC    I-6G03
21  D03 I   F15H9.2 TAGTTTGGTTTCAATCTCCGAAA AAAACAACTTACCTTGCAATCCA I-6G05
21  D04 I   F15H9.3 GCGGAAATTTTTCTTGGACA    ACTGGCGGTTTCAATACAGG    I-6G07
21  D05 I   F15H9.4 ACTGGCGGTTTCAATACAGG    CTTGCGACTGAAACGACTGA    I-6G09
21  D07 I   C15C6.2 ACCTCAAGGCTACCAAATCTTTC GTCCACCACTGATTTTCTCTGTC I-6G13
21  D08 I   C15C6.3 CAAATTCTCAATTTTCAGAACCG TCTTTGACGAGATCGTTTGATTT I-6G15
21  D09 I   C15C6.4 AAAACCGATTTAATTCCGAAAAA GAGACGCAGACATCTCAGCTAAT I-6G17
21  D10 I   R05D7.1 CTTTTGACAAGATAACCCACGAG ATATTGACGGAAAATGGACAATG I-6G19
21  D11 I   R05D7.2 GTGTGAAATGATGACGAGTGTGT AATTTTGCAGATTCACGAGAAAA I-6G21
21  D12 I   R05D7.3 CTGCCTGCCTAGATACCCTAGAT CATGATTATGAAACGCTCAACAA I-6G23
21  E02 I   R05D7.5 GGGCAAATTATAAAATGGGAAAA GTTTAGTTGTAGGTTTACGGGGG I-6I03
21  E05 I   F14B6.3 TCACCGAATCCGAATCTCTC    GCTATGGGACACCCCCTAAT    I-6I09
21  E06 I   F14B6.4 TATTTCAAGCAAAAACCCGC    TATGGAGGAAACATGTCGCA    I-6I11
21  E08 I   F14B6.6 AAACTCAACCGCCGATTATG    TACTCCGGATCATTTAGCGG    I-6I15
21  E09 I   F41D3.1 CCTTAGAAACCCAGCTTCCC    TGCTCCCCGATTAATGTCTC    I-6I17
21  E10 I   F41D3.2 TGCGTCTATGAGAGCGACAC    AGCATATGCCTCCAAACCAC    I-6I19
21  E11 I   F41D3.3 ACCCTGCAGCATGAGGTACT    GATGTCTAGGCGTAGGCGAG    I-6I21
21  E12 I   F41D3.4 CGACAACATCGGATTACCCT    TGGCTTCCATTTCTACCCAG    I-6I23
21  F01 I   F41D3.5 CGTGCTCAGTGTGTAGGGAA    TTTATCCCGACTCCTCATCG    I-6K01
21  F02 I   F41D3.6 AATCCACCAGCCGAATGTAG    GCCGTCACCTCACTTCTGAT    I-6K03
21  F03 I   F41D3.7 AAATTTAGACGATCAATGAGGCA TATGGCAATTTTCAGATCAGCTT I-6K05
21  F04 I   F41D3.8 CGACTTTCCGATACATTCTTCAC AATGCTGATCAGTTAAAGGTGGA I-6K07
21  F05 I   F41D3.9 TCCGGTAGTCTTGGAAATCG    AATCCCGCTGCATTAAGAGA    I-6K09
21  F06 I   F41D3.10    GAGCCCGTAAATCGACACAT    TGCTACTGAAGCGAGCTGAA    I-6K11
21  F07 I   F41D3.11    TCAGGATGCCACACCATAGA    AATGAACAATGCCACGTTGA    I-6K13
21  F08 I   F56H6.1 CGGAGCATAGGAAAGCTGAC    CCAGCTTTGGGTGGAGAATA    I-6K15
21  F09 I   F56H6.2 AACCAAAGCTTCCCCCTAAA    GCACCAATGTATGTTGCGTC    I-6K17
21  F10 I   F56H6.3 GTGAAATGAAGTGCGAGAGGTAG TTGACACTAGCAATGACGAAAAA I-6K19
21  F11 I   F56H6.4 CACAGATGAGCAAGACGTGTAAG TTGAAACTTCAGATCCAACGAAT I-6K21
21  F12 I   F56H6.5 CGATATCGCTAGCCACCATT    TCACTCATAACGGAAGTGCG    I-6K23
21  G01 I   F56H6.6 ACATCTCAAACTTCCCGCAC    GGGCCTATATCATTCGGGAT    I-6M01
21  G02 I   F56H6.7 GGTATGGGATTGATCCAACG    CCGAGCTAGCTGTGAACCTC    I-6M03
21  G03 I   F56H6.8 CTGTACCGGACTATTTTGAAACG GTCATTTCAATGCCTTTTCTCTG I-6M05
21  G04 I   F56H6.9 AACGGTTTTTGCAAGACAATCTA AACCGGTAAGGATTAAAGAGTCG I-6M07
21  G05 I   F56H6.10    CACTTATCCGGACTGACCGT    TGCCAGATGTTGAAGACTGC    I-6M09
21  G06 I   F56H6.11    CAGTGTTTATCAGCTGTGCAGTC GCCAATCAGAATCATTTTGTAGC I-6M11
21  G07 I   F56H6.12    CTAATTTCAGCTTTCTATCGCCA AAATTAGCAATTTCGCATTTTGA I-6M13
21  G08 I   C47F8.1 GGCATCGATAGGCACCTAAA    TCAAATTTCAGTGTCGCCAG    I-6M15
21  G09 I   C47F8.2 ACCGGAAACACTTCAAAACG    AGTCTGAAACGCAAGGGAGA    I-6M17
21  G10 I   C47F8.3 CTCCTGATTCCGAGCTTCTG    TGTCCTCGAAGAGCATTGTG    I-6M19
21  G11 I   C47F8.4 CTTCCATAGGGATTTTGGCA    TTGAATTCCCCATCTCAAGC    I-6M21
21  G12 I   C47F8.5 ATCATGCAAATTCAAAAGGAAAA GGACTAGAAATCGTGACCATGAG I-6M23
21  H01 I   C47F8.6 CTGCACAGTTCACCGATTACATA GAGCAAAACGTCTTCTACCTGAA I-6O01
21  H02 I   C47F8.7 TTCAGAAAATCGAAAATGGAGAA ACATGTATCCCGAGAGGTACTGA I-6O03
21  H03 I   C47F8.8 GCAGTTCTGGAAAATTGGGA    ATTATTTCCTGCACGGCTTG    I-6O05
21  H04 I   T09E11.1    GTGTTGATTTTGTGGACCCC    CATCACGGACAGAAAGAGCA    I-6O07
21  H05 I   T09E11.2    CGTCTATCAATTGTGGGGCT    TTTCGAGATGTTCCTTCGCT    I-6O09
21  H08 I   T09E11.5    TGATCTATGCGCGTTTTCAC    AAACGCCAGAAAAATCATGG    I-6O15
21  H09 I   T09E11.6    GATCAGGCTGCCCTACTCAC    TTTCTTCCCAGTTTTGGGTG    I-6O17
21  H10 I   T09E11.7    CCAAAGTTTCTTCAAAGCGG    ATGCATATACCGGCCAATGT    I-6O19
21  H11 I   T09E11.8    GCATAGCTACACGTGGCAAA    CCTGGTTCGTAAGTCGGAAA    I-6O21
21  H12 I   T09E11.9    AACGGCAACTGCCTAGTTTG    ATGGTAGAAAACCCGAACCC    I-6O23
22  A01 I   T09E11.10   GGCTCCTTTGTCGGTTCATA    AATGTTTGCGAAAGGAATGG    I-6A02
22  A02 I   T09E11.11   GACTACTCGCGTGCCTATCC    ACAATCCCAAGATCACTGGC    I-6A04
22  A04 I   T15D6.2 GAAAAGCGGGAGAGGAGACT    GATCTCCTGCCTGCAAACTC    I-6A08
22  A05 I   T15D6.3 GTTGAGACATGGAACGGCTT    TGTGGTGCCACATTTTGTCT    I-6A10
22  A07 I   T15D6.5 TTCGTGAAGTGGGTTGTTGA    AGCGTACACCGGATATTTCG    I-6A14
22  A08 I   T15D6.6 TTGATTTGAATGCTGCGAAC    GCTGATCCAATATGCCCAGT    I-6A16
22  A09 I   T15D6.7 CAAAACCTGAATGCGGCTAT    ATCCAAATTTTTCCGCTTCC    I-6A18
22  A10 I   T15D6.8 TTTTTGGGGTGTATCAAGCC    TAAAATGGAAAAGTTGCCGC    I-6A20
22  A11 I   T15D6.9 ACCCGAAATTTGTGAGCAAC    TTGCCGGAAACTTTCAATTC    I-6A22
22  A12 I   T15D6.10    CCCGCATATCGTATCTTGCT    ATTAATTTGAGCGTCGTGCC    I-6A24
22  B01 I   T15D6.11    TCCTCCTCCGTTTCATTTTG    CACTTTTGCTCCTCGCTTTC    I-6C02
22  B02 I   T15D6.12    ATCCGCAACTGACCCAATAG    AGACCCGATTTTTGCCTTTT    I-6C04
22  B03 I   E03H4.1 ATGGGTGCCCTTTTAGAGGT    TTGGTCATTCAGCAATGGAA    I-6C06
22  B04 I   E03H4.2 AAAATTTTGTTCACGTCGGC    GTACCATAGCATGGGCGTTT    I-6C08
22  B05 I   E03H4.3 TCCTCTGCCCAATCATAAGG    TTGAACAAGTTTGCCGTTTG    I-6C10
22  B07 I   E03H4.5 AAGCCATGCTTTTATGTGGC    TCTTTTGCATACTCGCAACG    I-6C14
22  B08 I   E03H4.6 AACGTATTGCAAAACCCTCG    GCTGGGAAAGTGAGACAAGC    I-6C16
22  B09 I   E03H4.7 CCACGGCTCAAGATTTCATT    TCTACCGGATCCACTCCATC    I-6C18
22  B10 I   E03H4.8 TCACGTTGAGATCCTTGTCG    GCCAGACGGGATTTTGTCTA    I-6C20
22  B11 I   E03H4.10    CGAAATGACCGTTGACATTG    ATTCATAAACGCCCACCTTG    I-6C22
22  B12 I   E03H4.11    ATCGAAGAGGCAAGTCAGGA    TCGTTGTGCCATGCAATTAT    I-6C24
22  C01 I   E03H4.12    GACTCTGGATCTTGCTTTTGAGA TCTCTGTAAAACCAAACACCGTT I-6E02
22  C02 I   E03H4.13    GCAATGTGATGAGATCGTGG    ATGTGTGCAGTCAGGGATGA    I-6E04
22  C03 I   C54C8.1 GCTGGAATGAAAAGGAGCTG    CCATGTCGTGGTACATTTGC    I-6E06
22  C04 I   C54C8.2 CCACTTTGCATTCCGAATCT    AAAACTGCCCACATCGTTTC    I-6E08
22  C05 I   C54C8.3 GAATTCCGGCAAGTTTTTGA    ATTGCAAGGGAAAATTGCAC    I-6E10
22  C06 I   C54C8.4 TGTGGAGTGCTACGCAAAAG    AAGCGGCAGATTTTGGACTA    I-6E12
22  C07 I   C54C8.5 AAACGGATCACAAGACTGCC    CACAAAATAGCCCAGCGAAT    I-6E14
22  C09 I   C54C8.7 GAGCCAAAAATCACAGAGATCAT AGCATTCATACTTGTCTTCCCAA I-6E18
22  C10 I   C54C8.9 GTTGGGAAGACAAGTATGAATGC ATGCTTCGTGTTTTTGACTGTTT I-6E20
22  C11 I   C54C8.11    AAACAGTCAAAAACACGAAGCAT TTGGCGTTTTCAAAAATAAAAGA I-6E22
22  C12 I   T27F6.1 ATAGCGAACATTGGTCAGGC    CGTCCAGAAACCGAAAATGT    I-6E24
22  D01 I   T27F6.2 CCATATTTCCCCAACACTGG    TACGGTTGCTGAAAGCTCCT    I-6G02
22  D02 I   T27F6.3 ACGACGTTGAAACCAGGAAC    TTTGCGGACCAAACATTACA    I-6G04
22  D03 I   T27F6.4 TCCAAAACTCTACATGGATCACC TGAAACAGAAGTTGGGGTAAGAA I-6G06
22  D04 I   T27F6.5 CGCGGGAAATCTGAATTTTA    TGCTGATGAGATCCGAGTTG    I-6G08
22  D05 I   T27F6.6 AGATTTGAATATGGAACCGTGTG GGGAAATTTGAATTTTTGGGTTA I-6G10
22  D06 I   T27F6.7 ATCTACCTGAAGATTAGGCCACC AAAAACGGCAAGGTAAGAAGAAC I-6G12
22  D07 I   T27F6.8 TAAGCTTAACAGCCCTCCGA    TGATCGGTAAGAGGAGGTGG    I-6G14
22  D08 I   K11D2.1 ACGTCATTAGCATCTGAAACCAT GTCTAGGTGAAATTCGTTGATCG I-6G16
22  D09 I   K11D2.2 CAGATCGCTACAGCCAACAA    GGAGTTCGACCCACTCAAAA    I-6G18
22  D10 I   K11D2.3 ATTTTCGCATTTTTCAGACGATA TAGCTCATAAGCTCAAATGCTCC I-6G20
22  D11 I   K11D2.4 AACGTCATCTATCGACTGAGAGC TTCGGTGCAGAAAATAGGAATAA I-6G22
22  D12 I   W02D9.1 CGCGGCCATCATATTATTCT    TGATAATCGAAATGTGCGGA    I-6G24
22  E01 I   W02D9.2 GCAACGGAATATCGGAGTGT    GAAGTCGCTTTTTGTCAGGC    I-6I02
22  E02 I   W02D9.3 GACGTCGAAGAGGATGAAGC    ATTTGCTGCTTTCTAGGCCA    I-6I04
22  E03 I   W02D9.4 ATAATTTTGCACAAAGTCGTGGT ATTTGTGGATATCCGTTTACGTG I-6I06
22  E04 I   W02D9.5 AACGCAATTGATTTGACAAAGTT AAGCGTATTTCAGATTGGTTCAA I-6I08
22  E05 I   W02D9.6 AATATGACGGGATGTTGTGAATC CACATCACTCCAAACAAAACAAA I-6I10
22  E06 I   W02D9.7 TGTGACGTAGATACTCCCCACTT CCAATTGAACTTTCAGACGATTC I-6I12
22  E07 I   W02D9.8 GTTGAATCTTGCTCCAAAACATC CAGGACCACACAACATTATGAGA I-6I14
22  E08 I   W02D9.9 CAAGACAATGTTAAGTAACGCCC AATCATCATAGTGACGGAGGCTA I-6I16
22  E09 I   W02D9.10    TTTGTTGAGGGTGAGAAGACATT GGTTTATTATGAACAACGGTGGA I-6I18
22  E10 I   C49G9.1 ATTACAGAATTTTATGGGTGGGG AACACCGGTTCCTATTTTTGAAT I-6I20
22  E11 I   F33E2.2 TGTATTTCCTCCTCCATCGC    TTCGACGCTATCTCCGAACT    I-6I22
22  E12 I   F33E2.3 CATGGTTAAAAGCGTGCTGA    TTTCACAGACCACATCGGAA    I-6I24
22  F01 I   F33E2.4 TTGTTCCAGCATTCAAGCTATTT CCATTCGGAAAGTGATAGTTGAC I-6K02
22  F03 I   F33E2.6 GGTTCATCCGTATCACCACC    ATCGGATCGACTTGATTTGG    I-6K06
22  F04 I   T07D10.1    AAATCGATAACTCCTTTTGCCTC TTCTCAAAACCAACGGAAAAATA I-6K08
22  F05 I   T07D10.2    CTGGTCACCCTTTTCGGTAA    GTCAAGGCACCCAAATCAGT    I-6K10
22  F06 I   T07D10.3    CAAGTTGGGTTTTTGGCAGT    CCATTTTCCACGTGTAGCCT    I-6K12
22  F07 I   T07D10.4    GGCCAACAATACTGGCATCT    GGAGCAACTCTTGTTCAGGC    I-6K14
22  F09 I   H16D19.1    GGAGCAACTCTTGTTCAGGC    GGCCAACAATACTGGCATCT    I-6K18
22  F10 I   H16D19.2    AGCGTCTTCTCACAATCCGT    ACTGTACCATAAGCCGGTCG    I-6K20
22  F12 I   H16D19.4    TTTCGAATAAATTCCGTAGACGA TTCAACACCAAGGTGAAGAGTTT I-6K24
22  G01 I   H28O16.1    GACGTGGACAACGTGAATTG    TGTGGGGAGATTTGTCCTTC    I-6M02
22  G02 I   H28O16.2    AATCGATTTATGACCGACACAAG AACTTCAGGTTTGTCCCAAAAAT I-6M04
22  G03 I   T26E3.1 CAAACTTTTTCGGTGAACAAAAC GCAGTCTGCGTCTCGTATCTAAT I-6M06
22  G04 I   T26E3.2 TCTTGAGATTACCAACTCCTCCA TTTACAAATCACGCTCACCCTAT I-6M08
22  G05 I   T26E3.3 CGAAAAATCCAAATTTTCAGATG GTGGTTTTTGTGCCATAAGTGAT I-6M10
22  G06 I   T26E3.4 AAAATCTCGGAATGGTTATGGTT ATGGGGATTTTAGCGAATTTTTA I-6M12
22  G07 I   T26E3.5 CGTCGGATATGTTGTTCTCTAGG ACATAGAGCGTCTTACCATTCCA I-6M14
22  G08 I   T26E3.6 AAGATGTTCAGCATCGCATATTT CTTCGCGCTACTACTCAAATTGT I-6M16
22  G09 I   T26E3.7 GCTCGAACTGATATTTGTATGGC ATTTATCTCTTGGTGTATGCGGA I-6M18
22  G10 I   T26E3.8 GCAAACATATATTTCCCCACAAA ATTGGATCAATAAAAGTGCGAGA I-6M20
22  G11 I   T26E3.9 TGAAGGTATCGTCAATGCCA    CGGGTTATGCTTGGGTTAGA    I-6M22
22  G12 I   F28C12.1    TCATTCTTCCTTTCCATTCTCAA GGAAAGAACGGAGCAATTTTATT I-6M24
22  H01 I   F28C12.2    TGGAGGCTGTGTGATTTCAG    CCGCAATTCGATTTTTCCTA    I-6O02
22  H02 I   F28C12.3    CCTCACCAATGCCTTGACTT    CACCGTCTGGGAACAGATTT    I-6O04
22  H03 I   F28C12.4    TTAAGAAGCTAAAGCCCCAATTC GGTGAAATCCATCCTTGTTTGTA I-6O06
22  H04 I   F28C12.5    CGCACACCCCTATTTCCTTA    TTTTCGGCTTTTCAGACACC    I-6O08
22  H05 I   F28C12.6    CGAGGCAATATCGAACCAAT    AGCCACTTGGGAGAGATGAA    I-6O10
22  H06 I   F28C12.7    CGAAGCTTCCTTTTTGCATC    CAATATGCTCTCCGGCATCT    I-6O12
22  H07 I   T06G6.1 CTAGCAATTCAAGCTCTTTGGAA ATATTCCCAACTCTTCTTCAGCC I-6O14
22  H08 I   T06G6.2 AAATACCTTCCTTGTTTTCTCGC TCTTAGATGGTGAAACGGTAGGA I-6O16
22  H09 I   T06G6.3 CCAACTCAAAGCCTTGCTTC    TGCAAAAGGAATGTCAACCA    I-6O18
22  H10 I   T06G6.4 TCTCTGATCCCATTTTCAGTTGT TGATCTAAGACACGCAAGAGTGA I-6O20
22  H11 I   T06G6.5 TTCCAGATTCTCTTCAAAAACGA AAAAGTTATACGAGAAGCCAGCC I-6O22
22  H12 I   T06G6.6 TACCAGCACTTCCCAAAACC    TGGCTCAATGCCTTCTTTCT    I-6O24
23  A01 I   T06G6.7 ACCTACGCATTCTCACCAGG    CTACCTTGCCGCATTTTGAT    I-6B01
23  A02 I   T06G6.8 TGTGCTCAACTATTGCTCGG    AAGCTCTCGGAGCACAAAAA    I-6B03
23  A03 I   T06G6.9 AAATCTCTGCGTCTCAATGTCTC AAAAACGGGGAAAATTGTGTAAT I-6B05
23  A04 I   T06G6.11    AGTTTTAGATGGTCTTGGGGAAG TCAATCCAGGACTTTCCTGTAGA I-6B07
23  A05 I   W02A11.1    GCAATTTTTCTCACGAAATTCAA TAATTTTACAGATGGGGTCAACG I-6B09
23  A06 I   W02A11.2    GAGTTCAGCGCATTTGATTTAGT ATGGGGAAACATCAGGTTTTTAT I-6B11
23  A07 I   W02A11.3    CAGCAAATTTTGAACTGAAATCC TCGAAAGCTTAACGTTTTCTCAG I-6B13
23  A08 I   W02A11.4    CTAGAATAGCTGCTAAAACGGCA CAGCATCATAATCCACACTTTCA I-6B15
23  A09 I   W02A11.5    GGACACGAAATCCAAAATGAATA CAATATTCCAAACGCCATTTTTA I-6B17
23  A10 I   W02A11.6    TTCAAAAGAAGCTCCAAACTCAG CCCTTATATACCGGGAATACTGC I-6B19
23  A11 I   W02A11.8    CGGGTATGCTGATGTTGATG    AAGAGCTCCGCCATTACAGA    I-6B21
23  A12 I   B0019.1 TAAAAATGGTTGAGGCGCTATTA ATTGCTTCATTTTCAGGATCTCA I-6B23
23  B01 I   B0019.2 TTCGAAACAAAGGTCATATTGCT TCTTCTGGAACTCTTTCATCGAG I-6D01
23  B03 I   Y18D10A.1   CATCATCAGAAGTTGTTGAGCTG ATTTTTCAGACCCTCGATCTACC I-6D05
23  B04 I   Y18D10A.2   ACCTCGAAAAATAAGCGAAAAAC ATTAAAATTTGCATTCGGTTCAA I-6D07
23  B06 I   Y18D10A.4   TACTTGGGAGGTTGTGTCTGTCT GAAAATTCGTGGTGGTTACAAAA I-6D11
23  B07 I   Y18D10A.5   GCAATCAAGAAAGTTCTTCAGGA AGCAATTTAGTGTTGGGAAAACA I-6D13
23  B08 I   Y18D10A.6   GAGGCTCTTGATCTATCGGGTAT AACTCGTTTGTCGATGAATCACT I-6D15
23  B09 I   Y18D10A.7   CTTCTAAAAATGGGTAGCCGAGT GCCTGTGTCAGGAAAATTTGTAG I-6D17
23  B10 I   Y18D10A.8   ACTCTCCAAACTTTTTCCAGACC ATAAACTCACCCTCATAGGGCTC I-6D19
23  B11 I   Y18D10A.9   TCTCTGCACCACTAACATCTTCA TTTATTCGCAATTTTCCTTCAAA I-6D21
23  B12 I   Y18D10A.10  TAGGAATGAGATCCATCCTGCTA GGGTACTTTTCCACATGCATAGA I-6D23
23  C01 I   Y18D10A.11  TACGGTTATGGGTATGAACAAGG TTTTCGTCACCTAAATTCTCCAA I-6F01
23  C02 I   Y18D10A.12  CTGGAATGTGAATCGGAAACTAC GGGTCCGAAGGTATCATAAAATC I-6F03
23  C03 I   Y18D10A.13  CAACATGACTGACAAGGATCTGA TGGTGATTGTTGTCAAGTATTCG I-6F05
23  C04 I   Y18D10A.14  AAAATCCACGAAAAATCGCTAAT GTCCAAAAATTCCAAGTTCTTCC I-6F07
23  C06 I   Y18D10A.16  CCAATTAGGCGAAAAGTTCAATA AAATCGGCAGAAGAAATAAAAGG I-6F11
23  C07 I   Y18D10A.17  TTGCTCTTCGTCTTTCTTCAAAC TTGTTCTGACGATAACCTCCATT I-6F13
23  C08 I   Y18D10A.18  TTGAAGAGACAGCGAATAGTTCC CAAATTGGATTCCATGAAATTGT I-6F15
23  C09 I   Y18D10A.19  CCAAGAATCTGCTCTTTTTCTGA AAAGTACGCAGCATGTATCCAAT I-6F17
23  C10 I   Y18D10A.20  CTCCTCCAAAACACAAAAATGTC AGAGAAAAGCGGGAATAAATACG I-6F19
23  C11 I   Y18D10A.21  CGTCGAATAATACATTAGCCAGC ATAATCTTTCAACATGAGCGGAA I-6F21
23  C12 I   Y18D10A.23  ATCCGAATTCTGGAAATGGTTAT ATACACTGGAATTCAGCTTGGAG I-6F23
23  D01 I   F08A8.1 GCACAGATTTATGGGGGAGA    TGATCTTTGCATGTGGTGGT    I-6H01
23  D02 I   F08A8.2 CGATTTCCGTCAAGAGCTTC    ATGGGAATAGACGATGCTGC    I-6H03
23  D03 I   F08A8.3 GTCAAAGAATGAACCGCCAT    CATGTTCACCACAAGCCATC    I-6H05
23  D04 I   F08A8.4 TAGTTGGAGATATTGGCCCG    AAGGGGACCGCTAGTAAGGA    I-6H07
23  D05 I   F08A8.5 ACCCGTTCATGAGATTTTCG    CGTCATGTATCCAAACGTGC    I-6H09
23  D06 I   F08A8.6 GAACCTGAGATTTTGAGGGAACT TTTTTCCCACTTCTACGTGTGTT I-6H11
23  D07 I   C47B2.1 CAGCTTTGCAGACGAATCAA    GGCTCATCTCGTGGAATTGT    I-6H13
23  D08 I   C47B2.2 TAGTCTCTGAGCGTACCCTATCG CAAACATGTACAAGCCGACAGTA I-6H15
23  D09 I   C47B2.3 TTTGGAACGACGTCTCCTCT    TTGGGCTCACTTTCGTCTCT    I-6H17
23  D10 I   C47B2.4 GGCCTGGAATTTGTAGACGA    GTCGTTGCGATGACTTTGAA    I-6H19
23  D11 I   C47B2.5 ACGAAGGATCGAACGATGTC    GGTGGGAAAACAATGAATGG    I-6H21
23  D12 I   C47B2.6 TGTGATTGTTTCCAGAACCTCTT TACGTACATTTTAGCGTCTGGGT I-6H23
23  E01 I   C47B2.7 CAATATTTAGCGCGAAACCAATA GTGAGCATTAATCCTGGAATTTG I-6J01
23  E02 I   C47B2.8 ATGATCAACTCTTCTCGTTCAGC GGGGGTAATGTGAAGCCTAATAC I-6J03
23  E03 I   CC4.2   GTATCACATCTCGTGTCCAATGA TTCCAGCTCCATTTTCTTCAATA I-6J05
23  E04 I   CC4.3   TCCGAGGATATTCGAATTTTACA TCAAATCCTTTCTCAATTTTCCA I-6J07
23  E06 I   W05B5.2 ATTTAAGGAGCAAACGGAGAAAC CATTTTCTGAAATTATCAAGCCG I-6J11
23  E08 I   Y26D4A.1    GAAAAAGAGAAGAATGACAGCGA AATGCTCCAAATTTTCTGTTCAA I-6J15
23  E09 I   Y26D4A.2    TTTTGTTTCAGGAAATGCAAACT GCTCAAAAGTACTTGCAGGAAAA I-6J17
23  E10 I   Y26D4A.3    TAGGTGTTGTAAAGCTTGTCCGT CTAGTGGAGAAGCACAGTGGAGT I-6J19
23  E11 I   Y26D4A.4    TCAACTTTTCAGCTACCAAGGAC TATTTTACCGCCAATGACAATTC I-6J21
23  F01 I   Y26D4A.6    AGATTTCACCACAAACCAAGAGA ATTGATGCAGTGGTCTTGAGAAT I-6L01
23  F02 I   Y26D4A.8    CATTTTACACGAATGCAGAATGA CTTGTTAAAAAGTGGGTCAAACG I-6L03
23  F03 I   Y26D4A.9    ATGAAAGAATCGGTGTCTTGGTA GTAAACATGCACCATCTGGTTTT I-6L05
23  F05 I   C17H1.1 CTAGGTGGTCACCTCCGAAA    TCAGGAACGAAAAGAAGCGT    I-6L09
23  F06 I   C17H1.2 GGAGATTTGGGTATATTTGGAGC TCAGTTTTGACCATGAGGAAGTT I-6L11
23  F08 I   C17H1.4 CGATTGCGTTTACAACATGG    TCCATTGATTTTCCAGGAGC    I-6L15
23  F09 I   C17H1.5 CGGCATACAGCCTAGCTTTC    CGGCTCCATTGAATTGATTT    I-6L17
23  F10 I   C17H1.6 GATTCCGAACAACATGCCTT    CGAAGCAATTCAGAGGGAAG    I-6L19
23  F11 I   C17H1.7 TTCCCTATCCAGCTTTCCCT    GCAATCGTCAGCGTATGAGA    I-6L21
23  G01 I   F22G12.1    TCATTTTGAGGGTTTTTGCC    GGCACGCGATCAAATAACTT    I-6N01
23  G03 I   F22G12.3    ATCGATAGGAAAATCGCCCT    TCCCTTTGTCCACCTGATTC    I-6N05
23  G04 I   F22G12.4    AAAAGCGGTGTTGTTCCATC    GACCCCTCATTTTCAGACGA    I-6N07
23  G05 I   F22G12.5    CACCGTCACTGTCCACAATC    CCAAGCTACAGCACTCCACA    I-6N09
23  G06 I   F17B5.1 CCAAACACAACACATCGACC    TGGATGTTGGTGCCTGATAA    I-6N11
23  G07 I   F17B5.2 GGTCCTCAAGTGTACGCGAT    GGCTACCGCTATTGAAACCA    I-6N13
23  G08 I   F17B5.3 ATCTCACCGACGATTTCCTG    TTCACTCTGTGCAGTTTCCG    I-6N15
23  G09 I   F17B5.4 AATCCCTCGCCCTTACAACT    AATCCGCAGTTTTGTCCAAG    I-6N17
23  G10 I   F17B5.5 AATTTGATGGTGGTAAAGGAGGT TGATCGCAATACAATGAGTTCAC I-6N19
23  G11 I   ZK1225.1    AGTAGGCTCAGTCGCCACAT    CCCACAGGTTCAAAATCGTT    I-6N21
23  G12 I   ZK1225.2    AAACTGGTTTTGTTTTGCCG    ACTCGTGATCAACCTGTCCC    I-6N23
23  H01 I   ZK1225.3    AAATGGTAGTCGGTTGGTGC    AGAATTCGAGTTCGGCTCAA    I-6P01
23  H02 I   ZK1225.4    TTGTCATTTCCAGGTGTCCA    TACCCAATCGAGGATAACGC    I-6P03
23  H03 I   ZK1225.5    GATTGCGTGCTTCTTCATCA    TGGTGGCTCTTCACTTGTTG    I-6P05
23  H04 I   ZK1225.6    CCATATCCAATCATTCCCTTACA TGAGTAATCGGGATTCGAATAGA I-6P07
23  H07 I   ZK1053.3    AATGATTAACTCAAACGCTCCAA CAAAAACGTTCGAAGTATGATCC I-6P13
23  H09 I   ZK1053.5    AGCTCGATGAGCCGAGTAAA    CGCGTTTGCAAAATGTCTTA    I-6P17
23  H10 I   ZK1053.6    CTCGTCCTAATGCCACCACT    ATGCAGGAACCCTACACAGG    I-6P19
23  H11 I   F44F1.1 TTGGAAGGAATGATTCGAGG    TTGGGAAATCCACAATCTCC    I-6P21
23  H12 I   F44F1.2 GGTGAATACAAAGATTCACTCGC ACGAATGAATCAAAATTGTACGG I-6P23
24  A01 I   F44F1.3 ACTTTCAGATATGGGCAGCG    GTTCCATGCAACTACTGCGA    I-6B02
24  A02 I   F44F1.4 GTGCTGCTGGAAGAACAACA    TGACGTTACCGAGAAGGACC    I-6B04
24  A03 I   F44F1.5 TGCGTTGATGAACTTTCCTG    ACTTGCATTGCCCCAGTAAG    I-6B06
24  A04 I   F44F1.6 CTCGATGCCTGGACTTTAGC    ATTGCAGGTTGGAAAGGATG    I-6B08
24  A05 I   F44F1.7 AACTACCCAGACATCACCGC    TGGGTTGAATGCGTACTTGA    I-6B10
24  A06 I   M01E5.1 AGGGATTCAAACCCATTTCC    CTACTCACACCCAACGCAGA    I-6B12
24  A07 I   M01E5.2 GGATTCAAGGTCAACGGAAA    AATTTTCAGCCAGTCGCAGT    I-6B14
24  A08 I   M01E5.3 CGCCTTCTTTTCACTGATCC    CAACATAATCATTGCACCGC    I-6B16
24  A09 I   M01E5.4 ATATTTTAAGCCGAGCAACATCA GACCACATCAGCCAAGAATAGAC I-6B18
24  A10 I   M01E5.5 GGATCACGAGTATTCGACAAAAG CGTCAGCTTTATCAGTTGCTCTT I-6B20
24  A11 I   M01E5.6 GGAATGTTTTCACCGCAACT    GAAAACGGATGCTGGTGATT    I-6B22
24  A12 I   T04D3.1 TCGAATTGACTGGTGCTCTG    CGCGCAACTTATCATTCTGA    I-6B24
24  B01 I   T04D3.2 GTTCGTGGAGGTCAGCTTTC    TGATCCGTTGCTTCTCACTG    I-6D02
24  B02 I   T04D3.3 TCTCACAGTTCACCTGACGC    TGAAGTTCGTGAGTGGCTTG    I-6D04
24  B03 I   T04D3.4 AGATAAACCCCTTCAACTTCCAG GAAATTTCAACTCACTTGCATCC I-6D06
24  B04 I   T04D3.5 AATGAAATTAAATTCGGAGCGAT AAGGATGCAAGCAATTCAAAATA I-6D08
24  B05 I   T04D3.7 TCGAGACCCATCAGGGTTAC    AACGAAGAAGACGAGGACGA    I-6D10
24  B06 I   W08E3.1 TTTTCAAACGGTTCTTGTGACTT TGGGAAAAATGATAGAAACATGC I-6D12
24  B07 I   W08E3.2 TGGGGTTTTTGCATCAGATT    TTTTTGTCCCAACCAAGCTC    I-6D14
24  B08 I   W08E3.3 CTTCAATTCATTGATGGTCCACT ACTAAACAGGAAATTTGGGAACC I-6D16
24  B09 I   W08E3.4 ATAGAACACCGGCGATATACAGA AAATGCTCCAACTCGATATTTCA I-6D18
24  B10 I   Y40B1A.1    CAGCATATCTGAATCAATTTCCC CGGAAAAATACACGAAAAATGAG I-6D20
24  B11 I   Y40B1A.2    ATGAGCTCCAGTGGAAAAATGTA AGGGATGAATTCTAAGGTGAAGC I-6D22
24  C01 I   Y40B1A.4    TCCGAATAAATTAAAAAGCGACA TTTCAGGAAATCTTCACTTCCAA I-6F02
24  C02 I   C01A2.1 ATCCACTGAATTGCCTCCAG    TTGAATGGGAGCCTCGATAC    I-6F04
24  C03 I   C01A2.2 TCGCACTAGATTTTCAGGACATT TTTGAAACTGAACTTTCGGGTAA I-6F06
24  C04 I   C01A2.3 TCAGAGTTCCAACACTTCATCCT AATTGGGAAATTTCGTGGATAGT I-6F08
24  C05 I   C01A2.4 AGTGCTGGAAACCTTTGTGG    ATTTTCCCACCTAAAACCCG    I-6F10
24  C06 I   C01A2.5 CAGATTTTCGCTTTTCTCCG    GGCGTCGTTTCGTCAGTTAT    I-6F12
24  C07 I   C01A2.6 AAGCCACTACCTACGACAACAAA CACCATGTCTATTTACCCTGAGC I-6F14
24  C09 I   W05H12.2    CACGCGTTCTGCTATATGGA    CTCCATTGCGTACCCATTCT    I-6F18
24  C10 I   Y40B1B.3    CACCCCTGTTTTGAAGGCTA    TTATGACTCAAGCCACGCTG    I-6F20
24  C11 I   Y40B1B.4    TTACAGGAGAAGATCCACTTCCA ACGAAAAATCCAATTTTCCCTAA I-6F22
24  C12 I   Y40B1B.5    AAAAACTCACTTTTCACGACGAA CAGAAATGTTGTGTGCTTTTTGA I-6F24
24  D01 I   Y40B1B.6    ATCGAAAACGAAAAAGTGAAACA TAAAACATGCTCAAATCCGCTAT I-6H02
24  D02 I   Y40B1B.7    AATTTGAGGCCTAGAACCATAGC CTAAAACCCCCGAAAATAATGAC I-6H04
24  D03 I   Y40B1B.8    TCCAGTAGTACAATCCTCCCAGA ATTTTTCGATTTTCAAAGCTTCC I-6H06
24  D04 I   Y48G10A.a   TGATTCTTCCGATCTTTGATGTT CACCATAAACATTTTTACGCCAT I-6H08
24  D05 I   Y48G10A.b   TCAATTGCGACAACATCAGTTAC GGTGGACAGTGAGTTTTTCAGAC I-6H10
24  D07 I   Y48G10A.d   GGAACTCTTTGGCATTTTTCTTT TGGAATTCAGTAGACTTCCCAAA I-6H14
24  D08 I   Y48G10A.e   CAAAATTGTGTTAAAAATGGGGA ATTTTCTTTGGTTTTTAGCAGCC I-6H16
24  D09 I   Y48G10A.f   TCGATGGAAAAACGTAAGAAAAA GATCATTAAATCTGGAGGACACG I-6H18
24  D11 I   Y48G10B.b   TCGTTCTCTACGTCTCCACTCTC CCAACTTGAATCTGTCGATTTTC I-6H22
24  D12 I   Y87G2A.a    GGGGACCTTCTCCTGTAAGAATA AGGCATGCCAAATAGGATAAAAT I-6H24
24  E01 I   Y87G2A.b    TAGCAAAAACACTGCGTACAAGA TTGTTCAATTGTTTCAAGACGTG I-6J02
24  E03 I   Y87G2A.d    GAAAAACGGTCATTATGCAAGAG TTGCGCATTCCTAGTGTATTTTT I-6J06
24  E04 I   Y87G2A.e    TCCAATTTTATGTAACGCAGCTT CGAATCATTCCAGACGTATTCTC I-6J08
24  E05 I   Y87G2A.f    ATTTGTGTAGTTTTTGAAGCGGA CCATTTTTCTCGGATTTTTATGA I-6J10
24  E06 I   Y87G2A.g    CCCGCAAGTTCATAAAAATGATA ACATTTTCAGCACAAAAGAAAGC I-6J12
24  E07 I   Y87G2A.h    AATGGTTCGAGAGTGGAGAAGAT ATTTTACTCGGCTGCACTTTGTA I-6J14
24  E09 I   Y87G2A.j    CAAAATCGATACAAAGAGATCGG TTAAGGAAGATGGGTGACTACGA I-6J18
24  E11 I   Y87G2A.l    AGTTATATGCCTTCAATGCCTCA GGAAATCTCGACGAAAAAGAGAT I-6J22
24  F01 I   Y87G2A.n    CAAAAAGTTTCATTTCTTGGCAG GTATCGACATTCGAAAGAAGTGG I-6L02
24  F04 I   Y87G2A.q    CAGAATTTTGAGAAAATCCAACG CCTCAACGAATCAGAAAATTCAC I-6L08
24  F06 I   Y87G2A.s    AGTGCCTTATTGAATGCCTGATA ATGCGTTATTTTAAATCGCTGAA I-6L12
24  F07 I   Y87G2A.u    CTCTACCCCTTTCTGATCCCTTA AAATGACAATATCGCTGCTTGAT I-6L14
24  F08 I   Y87G2A.v    ATTGGAATCCTTTTCCGTACAAT GGTGTAATTTATGCAAACACCGT I-6L16
24  F09 I   Y87G2A.w    ACCAATGGTTTTGAGTATGATGC CCCCCGTCAAATAATTCTCTACT I-6L18
24  F11 I   Y87G2A.y    TCTACCAAGTCGGTTTTTCTACG GCATTTCAAAAGAAAAAGTCGAA I-6L22
24  F12 I   Y6B3A.1 TCTGTTAGCCTCAACCAACTTTC GAGCATCACTTATTCTCGCTGTT I-6L24
24  G01 I   W09C5.1 TCAAATTTTCGAGCGCTTTT    CTCACGGGATTTCGTGATTT    I-6N02
24  G02 I   W09C5.2 AGCATCTTCATGGACGTGTTAAT CATTTACAACGGGGAAAATTGTA I-6N04
24  G06 I   W09C5.7 GACTCACAAAACGGGACGAT    TAATTAGCGGTGGGCGATAC    I-6N12
24  G07 I   W09C5.8 GCTTGAATGTTTGACGAGAGAGT AGATTTTGCCAAGTTTTATGCAA I-6N14
24  G08 I   W09C5.9 TAATAATTTTGGGCAATGTGGAC CTGGCAACATACAAGACTTACCC I-6N16
24  G09 I   W04A4.1 ACGGCATACCAAAGATCAGG    GACAAAGCTGCATCTCCTCC    I-6N18
24  G10 I   W04A4.2 TGCAACATGTGATCCTTACAGTC TATCACACGAGGAATTGCTTTTT I-6N20
24  G11 I   W04A4.3 TACGCATATAGGTAGGTGCGAAT TCCGAAGTACAACACACTACGAA I-6N22
24  G12 I   W04A4.4 TACGAATTTCCTTCCATTTCTCA AATTCCGAAGAGATGGTACACAA I-6N24
24  H01 I   W04A4.5 CCAAAATGCGTAGACTTTTTCAC CCTTCTGATTGGAGCATATTTTG I-6P02
24  H02 I   W04A4.6 TCATAAAGCTTCAAACCCCG    GGGCAAGTGAGAGGTGAGAG    I-6P04
24  H03 I   Y6B3B.1 GGAAGATCAGAGCTCATTTCAGA AAGAAAGATATCGGAAAGATCGG I-6P06
24  H04 I   Y6B3B.3 AGTCACCACAACCTTGACTGAAT CCTTCTTTTGCTTCTTCTTCTCC I-6P08
24  H05 I   Y6B3B.4 GAACCAACTACAGTACACCCAGC TTGGCGGAATTTCCTATATTTTT I-6P10
24  H06 I   Y6B3B.5 TCTGGTAGCCTCAACCAATTTTA GATCGCTTCAAAATTCATGTTTC I-6P12
24  H08 I   Y6B3B.7 CCGAAATATCTTGAAGGTTTGTG CCTGGGATTCTCTCTTTTCACTT I-6P16
24  H09 I   Y6B3B.8 CACCATAAACATTTTTACGCCAT CTCCTGTAAGACGGCAAGAGATA I-6P18
24  H10 I   Y6B3B.9 AACTGCACGGAATTAGACAAAAA AGTAGTATCTGCGTCTCTCACGC I-6P20
24  H11 I   Y6B3B.10    GAATTTTGTGGAAAAATCACTGG TCCGAACTCTACACCGTATTGAT I-6P22
24  H12 I   Y6B3B.11    TTTTTCGATTTTTCGATTTTCAA GCCGATGTATATTCAAATCGTGT I-6P24
25  A01 I   Y37H9A.1    GTGAAGAGTTGAGTCAGCAGGTT CCCAAATTTCACTCCAACACTAA I-7A01
25  A02 I   Y37H9A.2    TTGATTTCTGCTCCGGTTTC    GTCGCGTAAGCCTATCAAGG    I-7A03
25  A03 I   Y37H9A.3    TTGAAAAATTTCCGGAGAAAAAT TTGCAATAAAATTCGGCTACCTA I-7A05
25  A04 I   Y37H9A.6    TGAAATTATCGGTGAAAAATCGT CTTTTTGTCGTGTGCTCCTATTT I-7A07
25  A05 I   W09G3.1 AACTAGTTTTGAAAGTTGCAGCG AACAATGTACCAAAATCCGACAC I-7A09
25  A06 I   W09G3.2 TATAGCCGTAAAGCCTCTTCCTC AAACCGATTTCTTCGAATTTTTC I-7A11
25  A07 I   W09G3.3 CTGTAGCTCCAGAAGTACGCAAT AGATTTTCCTCCCAAAAATTGAA I-7A13
25  A08 I   W09G3.4 AGGGAAATAGTGACCCAGAGAAG AACACAGAGAAAGGCGTCTAGTG I-7A15
25  A10 I   W04A8.1 TTTTGCGAGGATTTTTGAGC    GCAAAACCGAGCTCCTACAG    I-7A19
25  A11 I   W04A8.2 ACACGAAATACTGTGTTGTGACG GTCTAGATTCATTGGTCGTCCTG I-7A21
25  A12 I   W04A8.3 TTCCGAAAGCAGTAAAATACCAA TGAAAAACGGAAAATCTCGTAAA I-7A23
25  B01 I   W04A8.4 GGTTTTTGATTTCATCGGTTGTA TCGTTCGAGAATTACCACAATCT I-7C01
25  B02 I   W04A8.5 TTGCCGAAAATTTCCAAGAC    CCTGGCAGTGAGCAGATGTA    I-7C03
25  B03 I   W04A8.6 GGTAAATCCAATTGCAACCAATA CGACTTTTATCGCAATTTTTCAC I-7C05
25  B04 I   W04A8.7 TTCAGACAATTTTCGGTCATCTT GCTCTAACATTCCTCAATTTCCA I-7C07
25  B05 I   Y71A12B.a   ACGGAAATTGAATATGATCAACG TCACTCGAATACACATTTTGGTG I-7C09
25  B06 I   Y71A12B.b   CATATGATTCGAGCTTTTTCAGG TTGTTCGGATACATTTCTTCCAG I-7C11
25  B07 I   Y71A12B.c   CTGGAAGAAATGTATCCGAACAA GATGATGATTCAACAGATGCAGA I-7C13
25  B09 I   ZC334.2 GTAGCGTTTCACAGAGCCTAAAA CTTTAAGCTTAGTTGTCCAGCCA I-7C17
25  B10 I   ZC334.3 GCGTCTGTAAAGAAAAAGCAAAA ACCCGTTCTGACTACGTTTGTAA I-7C19
25  B11 I   ZC334.4 ACTCTGTTTGTTGCACTGGATTT CATACAACGAAGAGTTAAACGGG I-7C21
25  B12 I   ZC334.5 ACCAAGTAGTTGCTCTTGCAGAC AGACTTATGATTGCGTTGCAAAT I-7C23
25  C01 I   Y71A12C.1   GTTCTGCCCTTCCAAATTGA    CTTTGCTTTTCCGTCCTCTG    I-7E01
25  C02 I   Y71A12C.2   CATGAAAACTTTTTAGCCGTGTC ATCTCTTCCACATTCTCCATCAA I-7E03
25  C03 I   F47G4.1 GAACAGCACCACATAAGTATCCC TTGAAATTGGTCAAATCTCCACT I-7E05
25  C04 I   F47G4.2 CTTCAAAGTCCGCAGCTACC    AACCTAATCGCCTCTCGGAT    I-7E07
25  C05 I   F47G4.3 AATAACTCCGGAGAGGACTATCG ATTTCCAGCTCGTCAATAAAACA I-7E09
25  C06 I   F47G4.4 GGGTCGAGTTTGAGAATGGA    CAAAGCCACCTCGAACATTT    I-7E11
25  C07 I   F47G4.5 TGAATACAAGCCTTCGCCTT    AATCCTCTCCAAGTCCCGTT    I-7E13
25  C08 I   F47G4.6 ATCCTCAGTTTTCCTCACACAAA CTGGAAATTGAAAAATGTTGAGC I-7E15
25  C09 I   F47G4.7 ACCTTCCGAGTCTGCGAGTA    CAGAGACAACCCCACCCTAA    I-7E17
25  C10 I   F47G4.8 CAGAGGTCGACTGAACAACTCTT TAGCTTCCCGCATATAAAACAAA I-7E19
25  C11 I   Y63D3A.1    CACCCCAATATCTTTCCACAATA TTGATAAGGAGCAAGGTTGATGT I-7E21
25  C12 I   Y63D3A.2    AAATCGTGAAATTTCGAACAGAA GACTTTTAGTCCGTAACGGCTTT I-7E23
25  D01 I   Y63D3A.3    CCTAAAAGGTATTCACGTTGTGC ATACCAATAGCCATGCTCAAGAA I-7G01
25  D03 I   Y63D3A.5    CAGCTAGCGAAAAACGAATTTTA ATTAATTACTGCTGATACGGCGA I-7G05
25  D04 I   Y63D3A.6a   TGGAAAATTGTCAAAGCTTCAGT AATGATAAGGGAAAAGAGCAACC I-7G07
25  D05 I   Y63D3A.7    TGGTTTTTCGTTTGAAAATATCG AAAATACCCGGAAAATTCAAAAA I-7G09
25  D06 I   Y63D3A.8    CTTTCCCAAAACTCCTGAAAAGT AAATCCAAAATTTCGAACCTCAT I-7G11
25  D07 I   Y63D3A.9    ACTTCCAATATTCAATGCCCTTT TCCTTCATTCTTCTACCAAACCA I-7G13
25  D08 I   K03D10.1    GGTATCATGATTGATCGGGG    CGCTTTTCAAGCCAACTTTC    I-7G15
25  D09 I   K03D10.3    ATTTTCAGGTTACGAGCTATCCC GTTTTCGAGGAGGGAAATTAAAA I-7G17
25  D10 I   C37A5.1 TTATCCCAGTTTACCCATCTCCT CCAAGCGTACAATAATCCGATAC I-7G19
25  D12 I   C37A5.4 TAACTTGGATTGAGGTAGGCAAA AAAAGATAGCTGGGACAAAAAGG I-7G23
25  E01 I   C37A5.7 CCCAATTTCCGCTTATTCAA    CAAAATTGATGGAAAACGGG    I-7I01
25  E02 I   C37A5.8 CCACAATGGAAATAACTTCAAGG AAGAAAAGTCTCAGATTTCGGCT I-7I03
25  E03 I   C37A5.9 GGACCTGTGTTCTGTTTTGTAGG ATTCCCAAAAAGGATCAACAAAT I-7I05
25  E04 I   C37A5.10    ATTAAGAATGCATAGGTTTCGCA TTCACTCATCAATCGTTGTCATC I-7I07
25  E05 I   ZK849.1 AGGCAGGGGTACTGTAGTAAAGG ATTTCCTCCAACTCATTGGATTT I-7I09
25  E06 I   ZK849.2 ACCTCATAATCAGATGGCACATT ATCATTGGAGAAAGACTTCGACA I-7I11
25  E08 I   ZK849.5 CCGCAATTATCGTAGATCAAAAC ATTTCAGGCCTCCATAAAACACT I-7I15
25  E09 I   C49A1.1 AAAAGACGCAGACTTTTCAACTG TTTGTAGATCAAACCGTAATGGG I-7I17
25  E10 I   C49A1.2 AATCACGCCAGTTATCGTCC    TTGTGATTTTCCAGCTGTGC    I-7I19
25  E11 I   C49A1.3 TCCAAATGTTGTCTTGTGAACAG AATTATTCTCGATGAAGTTGGCA I-7I21
25  F01 I   C49A1.5 ATCCAACTTCCAAATCGTGAGTA TCAATCTTCCACAAATCCCTAGA I-7K01
25  F02 I   C49A1.6 GCATTCTGACAAAACTCGCA    GGTGCATCATCAGTCCCTCT    I-7K03
25  F03 I   C49A1.8 GGACGACGAGACGAGTTAGC    CCAGCCATTCCCTCAAATTA    I-7K05
25  F04 I   C49A1.9 GTTTTCGGGAGCACAGAGTC    ACTTTGCCGTGTTTCAATCC    I-7K07
25  F06 I   K04H8.1 CGCACCCAGATTATGGTTTT    AGGAAAATTCCCCCAATCAC    I-7K11
25  F07 I   K04H8.2 GCAAATATTTTTACAAAGCGCAC ACAAAATCCCTTTCAGTTTCGTT I-7K13
25  F08 I   K04H8.3 CTCTGAAACCCTTTGAAAACCTT AGAGAATCAGAAATTTGATGGCA I-7K15
25  F09 I   F09C3.1 ATCTCGCTGGAAAAGCAAAA    GCTCTTCGGAAATACGCTTG    I-7K17
25  F10 I   F09C3.2 TGATCAAATGTGGAAGTTCACTG TCCGAATTCTTCAGGTAAAACAA I-7K19
25  F11 I   F09C3.3 AATCCTGGCTTTCTTTCCGT    TCTCATTTGCGTCGAAACAG    I-7K21
25  F12 I   F09C3.4 AAGGCGGGATCAAAAACTCT    CACCAAACAACTTGACACCG    I-7K23
25  G01 I   F49B2.1 CCCTTCTAGCTCATTTCCCC    ACCAACAAAATGGCAAAAGC    I-7M01
25  G02 I   F49B2.2 TTGCATCGAAAAAGTGCTTG    GAATCGAAACTTCCTGCCTG    I-7M03
25  G03 I   F49B2.3 TTACTCCCAAACGCTCTTTTGTA CCTACTCCCCGTACCTTATTGAC I-7M05
25  G05 I   F49B2.5 AGGAGATCTCATAAAACGAAGGG ATAGGCACCCAAAAGTTTCTCTC I-7M09
25  G06 I   F49B2.6 GTTGCGAAACATGTCCAATG    TGGCCCCTTCTATTAGCCTT    I-7M11
25  G07 I   Y105E8A.a   GCATTACAGGGTCTTACAGCATC AGAACAACTCAGAACTACGCAGG I-7M13
25  G08 I   Y105E8A.b   GGATGTTATCAGCCAAATGTTGT ACATTTCCTGGTTATCCGAACTT I-7M15
25  G09 I   Y105E8A.c   TTTTTCAAAATACCGCTGTGAAT CTCCATCGGATTGTAAGAATTTG I-7M17
25  H03 I   Y105E8C.d   GGATTAAAGAAAGTGGTAGCCGT TTAATTTTGAATTTTCGGGGAAT I-7O05
25  H04 I   Y105E8C.e   CAAAAATTGCCTGCAAATTAAAA GCGCATCTGGAATTAAGAAATTA I-7O07
25  H05 I   Y105E8C.f   AGTTCTGCTTCATATGCCTCAAG AGGGGAAATGAGAGAAAAATGAG I-7O09
25  H08 I   Y105E8C.i   CAGGTGTCCTCATTATGTTTTCC ATCGTCGAAACAGAGTAAACGAG I-7O15
25  H09 I   Y105E8C.j   TCGAATCCATTGGTAAATGATCT TTTTCGGCATTTTTCAGAATTTA I-7O17
25  H10 I   Y105E8C.k   TTTCCACTTCTCCCTGTTGAATA CGTGACGACGGTCTTTTATACTC I-7O19
25  H11 I   Y105E8C.l   AATCAAGACAGACTGTGCCAAAT ATTCGTGAAAATTCGAGTCAAAA I-7O21
26  A01 I   Y105E8C.n   TATTCAAAAGGAATCGTCCAAGA GCAGTGTTGTCACTGATTTTTCA I-7A02
26  A02 I   Y105E8C.o   TTAAATCGAAAAGAGAAGCGAAA TTTGAAGAGATATAGGTTTGCGG I-7A04
26  A03 I   Y105E8C.p   ATGTCGATAACTCCACATCCAAC CTAGCCTCACGAAACTATGATCG I-7A06
26  A04 I   Y105E8C.q   GTTTCTTTCGCAGAAAATTTGAA TACGGCATAAATTCGGTCTAAAA I-7A08
26  A05 I   Y105E8C.r   CTAAGACCTTTTAAGCTACGGGC ACTAACCAAAACCCCTTATTCCA I-7A10
26  A06 I   Y105E8C.s   AAGACGAGATCGTTAATGGAACA TAAAATACGCTTGCTCGCTTTAG I-7A12
26  A10 I   Y105E8D.c   TTGAATTTTGCCTAAAAAGGACA ATAAAAATTGAAAATCGGGGGTA I-7A20
26  A11 I   Y105E8D.d   AACAGAGGTGGGTGGATATTTTT AAGCATTCTTCAATTTTGGCATA I-7A22
26  B02 I   Y105E8B.a   TCGTCTGGCTAAAGGTAAAAACA TTAAAGCTATACTGGCAAAACGC I-7C04
26  B03 I   Y105E8B.b   GTTTTGTGTTCCCGCAATAAATA GAGGAGCTTTTCCGTCATAAAAT I-7C06
26  B06 I   Y105E8B.e   TCCCATGATCTTCCATTTTCTTA CTAAATTTCAAATGGGGAAAAGG I-7C12
26  B07 I   Y105E8B.f   GGAGATCAAACAATTCAGCAAAG ATCAAACCCTTCAGAAGTTCTCC I-7C14
26  B08 I   Y105E8B.g   ATTTGCCAACAAAAATGAGAAGA GTGCAATGGCTCCAGAATACTAC I-7C16
26  B09 I   Y54E5A.1    TGTAATGAGTGGGTTTTGGAAAT GTCGAGATGATTTTATTTGGACG I-7C18
26  B10 I   Y54E5A.2    CCATGGTTTTGTTGTTCAATTTT TTTTCAACTTTTTGCTCTTTTGC I-7C20
26  B12 I   Y54E5A.4    TCAAGACGTTCAAGCGTTAAAAT GTGGGATAAATGCCCTAAAACTC I-7C24
26  C01 I   Y54E5A.5    AAGAGCTGGAAAACTCGAGAAAT AAAATGACTGACTACGGAGATGC I-7E02
26  C02 I   Y54E5A.6    TGTGATTTTCAATGTGTTTTCCA CGATTGCATTGCTCATTTTTAAT I-7E04
26  C03 I   Y54E5A.7    GTAACCGTAGCCGAGGACAA    TTTTTCATGGATTTCGGCTC    I-7E06
26  C04 I   Y54E5A.8    TTTCGGCACTTTCTGTTGTTATT CACAAATTGGATTTTTGGAACAT I-7E08
26  C05 I   K05C4.1 GGATCGGATCAGACATCAAATAC TCAGAATCGAACTCCAAAGATGT I-7E10
26  C06 I   K05C4.2 AATGGGGGAAAATTGAAAAATAA TGATGAATGTGTAGAGTTGGTCG I-7E12
26  C07 I   K05C4.3 ACCGCCATAAAACGTCTCAC    CAATTGACGCAACAAAATCG    I-7E14
26  C08 I   K05C4.4 GGATGCCCGCTAATAATTCA    ACTGTTCAAGCAATGGTCCC    I-7E16
26  C09 I   K05C4.5 TTTGGCCGTTTATTTGATTATTG TTTTTGGTGTGAATATTTTTGCC I-7E18
26  C10 I   K05C4.6 TTCCGGTGGTTCAAAGTTTC    GATGGCAGCTGAATCTCCTC    I-7E20
26  C11 I   K05C4.7 GCGTACTACAAGCTGTGCCA    TTTATATGCCTGTGCGGTGA    I-7E22
26  C12 I   K05C4.8 AAAAGGTGTATGTTCGAAGACGA TTGAAATCGGTAGGGATAGGTCT I-7E24
26  D01 I   K05C4.9 CAAAGGATAGGCCCATCAAA    CACAACTTATGCAAGCGGAA    I-7G02
26  D03 I   K05C4.11    GGAGTTGCCGTTATTTTTCTTTT AAATACTGTCACCAGGCTATCCA I-7G06
26  D04 I   F39B2.1 GCCTATGAAGTTCTGCTCGG    GATCCATCACGCCAACTTTT    I-7G08
26  D05 I   F39B2.2 TGATTTTTCGGATTTTAAAGCAA AAAGTTCGAGGGGAAAGCTACTA I-7G10
26  D06 I   F39B2.3 GATATGCCCAGGCTTGAAAA    GAGCCAGTCCTAATTGCTCG    I-7G12
26  D07 I   F39B2.4 CGCAGTGAACACTGAGGAAA    GTCCAAGCTAGCCGACATTC    I-7G14
26  D08 I   F39B2.5 AATTTTTCTGGAAAGAAACCGAG GTGGAGTACACGACTTCCGTAAA I-7G16
26  D09 I   F39B2.6 TTCATGTTTTCGCCAGATTAGTT TTTAATCGGTTCATCTTTCATCG I-7G18
26  D10 I   F39B2.7 ATCAAAAGGTGAAAACGGGTAAT GAACTCAATCGAATGATCAAAGC I-7G20
26  D11 I   F39B2.8 GTTTGCCACCGTCCATATCT    CGGTGAGCATGATGGTATTG    I-7G22
26  D12 I   F39B2.9 GTTTCGTCCCCTCTTCATTACTT ATCTGGCGAAAACATGAACTAAA I-7G24
26  E01 I   F39B2.10    AAACGAACTCTTTCCAGGCA    TAAAATGGCGCTCAAATTCC    I-7I02
26  E02 I   F39B2.11    TTACACATTTGGCCGTCAGA    GATTTTGTCGTCTCGTGGGT    I-7I04
26  E03 I   K11B4.1 AAAATGTTTTTCACACCGGC    CTCGGATTGGGTGGAGACTA    I-7I06
26  E05 I   Y54E5B.1    TATTTCTGGTTTCGAGAGATTGC TCTATCGCAATTTTCTGCTTCTC I-7I10
26  E06 I   Y54E5B.2    TGTTCCACGTGAATTTCCAA    AGGAGCGCAGTTGCATTATT    I-7I12
26  E07 I   Y54E5B.3    AATGCTTCCTGGTTTTGGTG    ACACTCGGTGGTCCATCTTC    I-7I14
26  E08 I   Y54E5B.4    ACTCATCAGGAATGTCAGATGCT TACTCGGATTCTTACTGCACGTT I-7I16
26  E09 I   F32A7.1 TTTATCCCTTGGGTGCTCTG    TCGTCGTTGTTCGGTATTGA    I-7I18
26  E10 I   F32A7.2 GTATCGATTGTCGGCGTTTT    GACCCATTCAGAGCCAGAAC    I-7I20
26  E11 I   F32A7.3 TGCTTCTCCTTGAGCTCCTC    ATTTGAAGATGATCCGTGCC    I-7I22
26  F01 I   F32A7.5 GAGGAAACGAGGCTGAAGTG    GTGGCTCTGGCTTCTTGAAC    I-7K02
26  F02 I   F32A7.6 CCCCAATCCTGATCTTTTGA    ATTTTCAGCAAACCACTGGC    I-7K04
26  F04 I   F11C3.1 ACTCTCTCATACCCCTCTGCTCT GTCACCTCATGCTTGGAATCTAC I-7K08
26  F07 I   ZK270.1 TTCAGGACCTCGATTTGTCC    AGAGAATTGAAGCGAACCGA    I-7K14
26  F08 I   ZK270.2 GACGAATTTCCTTCTTTTCTGGT GAAACTTCCAACTTTCGGATTCT I-7K16
26  F09 I   F21F12.1    TCCATTTATCCTTATCACGATGG AGCTTGAAAATATGGCGTAAACA I-7K18
26  F10 I   ZK909.1 AGTACCCTCCTTGGCGTTTT    TTCATTCCCCATTTCACCAT    I-7K20
26  F12 I   ZK909.3 TTCCATGCCAAAAATGTTTAAGT CAATGCCGATTCAATTTGTTAAT I-7K24
26  G01 I   ZK909.4 ATTGTGCAAACATTTGACCTCTT ATTTGAACTTAAGACCACGCAAA I-7M02
26  G03 I   ZK337.1 TGAAATCGAAAGAAACGCTACTC GTCTCCAAATGGACCTCTTCTTT I-7M06
26  G04 I   ZK337.2 TTCCAAAACTTTAAGCGGACATA CAACCTTGACCAAATTTTCTCTG I-7M08
26  G05 I   ZK337.4 CAAAAACTCATTTGGCATAAAGC AGTGATTGCTGAATTTCCAAAAA I-7M10
26  G06 I   F33H2.1 CTCTGCTTGCGAGAATTGTG    CGCGGTGAAAATTTGTTTTT    I-7M12
26  G07 I   F33H2.2 TTCGCGATAATATTCCCTGG    AGGAGGTGTGGATTGTCAGG    I-7M14
26  G08 I   F33H2.3 TTTCTTGGCAGTGTATCGATTTT TTAGGTTGAGATGATGAGTCCGT I-7M16
26  G09 I   F33H2.5 TCAAAAATCCACGTCCATCA    ATTCTGCTCCTTCCCTCCAT    I-7M18
26  G10 I   F33H2.6 AGATAGCCATGTGGCATAGAAAA ATTTACGGGATTTTTCACCATCT I-7M20
26  G11 I   F33H2.7 TAACTAACCTGTTCAAAGGGCAA CAACGAAAAGATTGGAAAAGTTG I-7M22
26  G12 I   F33H2.8 GTGACCTCCACACTGCTCAA    CACACCTCCGAGAATTCGAT    I-7M24
26  H02 I   F31C3.2 TATTCTCGGAGATCAAGAAGCTG TTTAGATGTTGAGTTGAGCGTGA I-7O04
26  H03 I   F31C3.3 AAAACACCGAAAAATCCACG    AATAACCGCTACATCACGGC    I-7O06
26  H04 I   F31C3.4 CCCGGGATGAGAAAGTACAA    TCTCGTTCATCTCGTGCATC    I-7O08
26  H05 I   F31C3.5 TTTGCCGAGAGAAAATCAATAAA TTCGAGAATTTGTCAGGATTTGT I-7O10
26  H06 I   F31C3.6 TCCCGCTATCCACTGATTTC    TTCAGGTTTACGTTCCGTCC    I-7O12
26  H09 I   Y18H1A_67.c CATGTTAACTTGTCGTTGTGGAA AAAATGATTGGAAACGGAGAAAT I-7O18
26  H10 I   Y18H1A_67.d TCTGAAATTTTCCAGCTTCTCTG AATATGTGAGCTCATTGCGTTTT I-7O20
26  H12 I   Y18H1A_67.f AAAAATTTCCCAACAACGAAAGT AAATGAGTGAAAAATCGCAAAAA I-7O24
27  A01 I   Y18H1A_67.g CACGCACAATCAAATAATTTTCA TGTACACAGGGTTCTGTTCTTCC I-7B01
27  A03 I   Y18H1A_67.i AAATTTTGGTGGGAAATTCAGAT TTTAATTCGATTTGGAGCAGTGT I-7B05
27  A04 I   Y18H1A_67.j AGTACGGTTTTGAGGGGTTAGAG ACCTGTTGCCTGTTGAATACACT I-7B07
27  A05 I   Y18H1A_67.k AATACGAGGAAACGAAGGAAATC AAGTGGCCTAGCTTTCAACTCTT I-7B09
27  A07 I   Y18H1A_67.m TAGCAGGTTTTAGCAGAAAAACG GGAAAATCGAGTGAAAACAAGTG I-7B13
27  A08 I   Y18H1A_67.n CAGTCTACCCGAAAAATTTGATG GTCGTGTTGAGACCGTATTTAGG I-7B15
27  A09 I   Y18H1A_68.a TGTTTCTTCCTATTTTCCACGAA CTGGAGCAGTCACTTCTACGATT I-7B17
27  A12 I   Y18H1A_68.d AAATAATCGTTAATTTTCCCCGA ACACTGAATGAAGACACCAGGAT I-7B23
27  B02 I   Y18H1A_68.f ATCGATTTTCTGTGATTGCAGTT AAACCCAACTTTAAAAAGCGAAC I-7D03
27  B03 I   Y18H1A_68.g AAAAATTTCCCATTTTCTCCAAA TTTGACCGGTAACTTATTGTGCT I-7D05
27  B04 I   Y18H1A_68.h ATCGCAGCTATTCAACATGATTT ACGGTTAATAATGGGCGATAAGT I-7D07
27  B07 I   Y34D9A_150.c    TTGGTTTTTGCAATTTTCTGTCT ATTTGAATTTTTGGCGGTACTTT I-7D13
27  B08 I   Y34D9A_150.d    CATTTTCTTCAGTTTTTGCTGCT CTCGGGTTGTGTCATTGAATTAT I-7D15
27  B09 I   Y34D9A_151.a    GCCGTGAATTCTCACAAAATAAG ATGCTAATTTGTTGCCTCTTTCA I-7D17
27  B10 I   Y34D9A_151.b    GCTTAAAAACCCTAAAACCTCCA TTAGAAGCTAAACTTCGACACGG I-7D19
27  B12 I   Y34D9A_151.d    TTTTAGTTTTCGGCAAAATTTCA GAAGCAGCCGAACTACTACAAGA I-7D23
27  C01 I   Y34D9A_151.e    TCTGAAAAATTGCAGAATTCGAT GCTACAGTAATCTTAAAGGCGCA I-7F01
27  C03 I   Y34D9A_152.a    CGTGAAACTCCAAATTAAAGACG TCACTTTTTGACTCCCATCTTGT I-7F05
27  C06 I   Y34D9A_152.d    CTACAACTCGACACACACCTCTG CCTCCTTTATGATGAAAATGCTG I-7F11
27  C07 I   Y34D9A_153.a    CCAACAGAAACAACACACACACT GACGCAGAGTTCTCATCTGATTT I-7F13
27  C08 I   Y34D9A_153.b    AAAACCTCCCAACTTTTCTCAAC GAGTACACGACACTTTCCCAGTC I-7F15
27  C09 I   Y39G10A_228.a   AATTGATTTTGGAAGCCATTTTT AGACACAGAGTCAGCATTCAACA I-7F17
27  C10 I   Y39G10A_229.a   TTCTATCGCATGCCTTAAACATT CTTTTGCAGCTAGTGTGTTGTTG I-7F19
27  C12 I   Y39G10A_236.b   CTCGGAAAGTGTCTTCAGTATCG TTGTGTAGTCGGAATACTGGTCA I-7F23
27  D01 I   Y39G10A_236.c   CTGCCACCGTACTCTACAAAATC AGACCAAGCTGTTGAACACAAAG I-7H01
27  D02 I   Y39G10A_236.d   ATATCAATAACGCACCAAAATGG GCCAATTTTAATACATGGTGCAT I-7H03
27  D03 I   Y39G10A_236.e   CTGCCACCGTACTCTACAAAATC AGAATTATACCTGAGCAGCGACA I-7H05
27  D04 I   Y39G10A_237.a   TTAGCTCAAAAAGCTCAAAAACG ACTAAGGTAACTGGCCTCGAAAC I-7H07
27  D05 I   Y39G10A_237.b   TTTTAAACGATTTCGAACCTGAA ATTTCTGATGAGTGCTGGTGATT I-7H09
27  D06 I   Y39G10A_240.a   GAAAACTCAACGCTTCACACTCT CCATTGTCAAATTTTTGAGCTTC I-7H11
27  D08 I   Y39G10A_241.b   CCTTATTGCAACATAACTCTGGC TCCTGCTATTCACAGGGAATTTA I-7H15
27  D09 I   Y39G10A_243.a   GTTCCATTAAAACTGGCTCCTTT CGTGCTGACCTTTCTTATCTCAT I-7H17
27  D11 I   Y39G10A_243.c   TTTCACCATTTCAGAAACTCGAT ATCTTTCACAAGACGACAAAAGC I-7H21
27  E02 I   Y39G10A_244.c   CATTCAAAAGTCTTGCAAAAACC GCAGGTTTTCTAATCAATTGTCG I-7J03
27  E03 I   Y39G10A_246.a   TTGTTATTCTTCGTCGACCATCT GAGGATCAAGAGCCGGTAAGTAT I-7J05
27  E04 I   Y39G10A_246.b   AATTTCAGGACAAATTTTGAGCA CATAAACGGTAGTAAAGGCATCG I-7J07
27  E05 I   Y39G10A_246.c   CAAAACCGGTGTAGACAACAAAT CTCGACAAGCCACGATTAATATC I-7J09
27  E06 I   Y39G10A_246.d   GCAATCACCTAATCGTCATCTTC CCTCGATCGGATAAAACATACAC I-7J11
27  E07 I   Y39G10A_246.e   AAGATGAACGAAAGTGCTCGTAG TGTTAGTCTTGTCTAGGCTTCGG I-7J13
27  E08 I   Y39G10A_246.f   AAAATGGTCCAAAACTACCGAAT CGCGGGAATAGTTTGGTAATAAT I-7J15
27  E10 I   Y39G10A_246.h   GTCGCCTACATAGTGGAATTGTC ATGTTAACAAGCCAGGATCTGAA I-7J19
27  E11 I   Y39G10A_246.i   CAATTCCCGTTATAACACTCCAA TTGATGGACTCTTTTTCCACACT I-7J21
27  E12 I   Y39G10A_246.j   AAAGTTTTAATTTCCAGCAAGCC GAACAATTGAGCACAACAATTCA I-7J23
27  F01 I   Y39G10A_246.k   CCCTTAAAAGTGGGAAGTTAGGA AAAAGGTGAACGGGAAAAGATAG I-7L01
27  F02 I   Y39G10B_248.b   CAACTTTCCGAATTTCAGCTCTA TTGCACTTTGCACTTAGGATACA I-7L03
27  F03 I   Y39G10B_248.c   CCCAGATTTACATATGGAATGGA CACCAATAGCATTTGAGACCTTC I-7L05
27  F06 I   Y47G6A_240.a    ATTCAGCAGTTATCCAACTCCAA TCTCTTTTAGCAAAAATGCAAGC I-7L11
27  F07 I   Y47G6A_240.b    AGTTCAAAACGCAAGGTAATCAA AGACCATCTGGATGCTGAAATTA I-7L13
27  F08 I   Y47G6A_240.c    CGCTCCTTTTGATTAGATGATTG GAAAATTGTCGCTTTTTCCTTTT I-7L15
27  F10 I   Y47G6A_241.a    CTCACGGTTTCTTCAATATCTGG GATCTTACGGGTGATTCTAGCCT I-7L19
27  F11 I   Y47G6A_241.b    AAAATTTTCGGCTAGAAAAATGC TATGCCATATGATCGCTGTGTAG I-7L21
27  F12 I   Y47G6A_242.b    AAAACTTGAGCATTTCTCAGTCG TTCCAAGAGAATTGATCAGGAAA I-7L23
27  G01 I   Y47G6A_242.c    AGAAACAGGAAAATCCTCCTACG TTCAATTCATTCAATGCTTCCTT I-7N01
27  G02 I   Y47G6A_243.a    GATCCCCCGAAAATGATTTATTA ATTGACAAATTTTCCTTCGATCA I-7N03
27  G03 I   Y47G6A_243.b    TTTCTGTCAAAAAGTCCCAAAAA TAAGTGGGGCCAGTAGTCTATGA I-7N05
27  G04 I   Y47G6A_245.a    CCCAAAATATCTCAAATTCACCA TAGGCAAAATTGTAGGCATGAGT I-7N07
27  G05 I   Y47G6A_245.b    CCAACAAAGATGTAGAAGCATCC ATTCCTACCACATTTCCCTGAAT I-7N09
27  G06 I   Y47G6A_245.c    TGAAAATTCGGCAAAAAGTTAGA CGATTCTGGAATTGAAGTCTACG I-7N11
27  G07 I   Y47G6A_245.d    TCGTCTATTTTTCCGCATTTTTA GGAAGTCGCAGCACTATGTATTT I-7N13
27  G09 I   Y47G6A_245.f    TTTTTCCTAGATTCAAAGGGGAG TGATATTCAGATGGCGAAAAAGT I-7N17
27  G10 I   Y47G6A_245.g    TAAAAACATGGAGGAATTCGAGA TGAAGCTCTCAACATCACAGAGA I-7N19
27  G11 I   Y47G6A_245.h    ACTTCAATACACCAAACGCAACT AATTTCAACTGCAACTTGCTCTC I-7N21
27  G12 I   Y47G6A_245.i    TCGAAAAGTTGTGGAAAGTTGTT AGAAGTCGTCGAACTTGATTCTG I-7N23
27  H01 I   Y47G6A_245.j    TAAGAAAGTTTCCCCTAAATGCC ACAACAACGAACAATGGAAAAAT I-7P01
27  H02 I   Y47G6A_245.k    TACTGCCTCAGCTTATGCTTTTC ATTCCTACCACATTTCCCTGAAT I-7P03
27  H03 I   Y47G6A_246.a    CTGCTAGCCATATCTTTTGCACT CGACAAATGGAGAATTAAAGCAC I-7P05
27  H04 I   Y47G6A_246.b    TTCGGACACTAAAATAAAGGCAA ATCAAACATTTCAACGACGAGTT I-7P07
27  H05 I   Y47G6A_246.c    AACTGCGTACAAAACACCAAACT GCATTCTCTGAATGTGCTTCTTT I-7P09
27  H07 I   Y47G6A_247.a    AAAGACGGAAACTCTTAAAACGG GGATCAAGAAGACAATGACAAGG I-7P13
27  H08 I   Y47G6A_247.b    AACTTCGAATCTGGCTCAAAAGT ATTGTGAAACCTGAAAACCTGAA I-7P15
27  H09 I   Y47G6A_247.c    TTCTCTCCATTCTCTCTGTCACC TTTCTATTGGCAGGTATACCGAA I-7P17
27  H11 I   Y47G6A_247.e    TTCAGGCAAATACCAGAAGACAT CCAATTTCGTTTTGATCTACGAG I-7P21
27  H12 I   Y47G6A_247.f    CAATTTAGCTGATTTCTCGCACT GAGTTTTCGTGAAAGCACAGTCT I-7P23
28  A01 I   Y47G6A_247.g    CAATTTAGCTGATTTCTCGCACT GATTTGTGAAGGATTGACAGAGG I-7B02
28  A02 I   Y47G6A_247.h    AACTCGATTTTTCATTTTTGGCT AAAAACCGATTTTCTGAACCAAT I-7B04
28  A03 I   Y47G6A_247.i    TCTACCAATTCCTCATTGCTGTT AATTTCCCAAATTGGTCAGTCTT I-7B06
28  A06 I   Y48G1A_53.a ATTAATCATTGCAAATCCGACTG GCGATAACTACAGAAGCTTGGAA I-7B12
28  A07 I   Y48G1A_53.b TTTCAGACACCCCTTACTCCATA ATTTGAACTTTTGGATCCACTCA I-7B14
28  A09 I   Y48G1A_53.d GCTCCAAGTAGTTGAGTAGCTCG GTATTTTTGCGTGATGAGTCTCC I-7B18
28  A10 I   Y48G1A_53.e AAAATCGATAATTACCGGGAAAA AAAATTTCAAGTGACGCACGTAT I-7B20
28  A12 I   Y48G1A_54.b CTTCATAAACTTGGGTGTCTTCG TCTCCCCAGATTTTTCAGTTACA I-7B24
28  B01 I   Y48G1A_54.c CTTCATAAACTTGGGTGTCTTCG TCTCCCCAGATTTTTCAGTTACA I-7D02
28  B02 I   Y48G1A_54.d GTTGATAAAAAGCAAAAGCAACG TAATTTTTCAGCTTTTCCATCCA I-7D04
28  B04 I   Y48G1B_51.a AATAACACTTCCATCCTGCTCAA CGACTTTCTCTTCAGTTTCCAGA I-7D08
28  B05 I   Y48G1B_55.a AAAAGTTGTTTCGACTTGGATCA AAAGAAGTTCGATCTACTCGGCT I-7D10
28  B06 I   Y48G1B_55.b TAAAAATTTCAAACCCTTTCCGT TCAAAATTTCGCCGTAAAATCTA I-7D12
28  B07 I   Y48G1B_55.c TTGGTAGATCTTGAAAACGTGGT TGTTAAATCGCTTTTTGTGTCAA I-7D14
28  B08 I   Y48G1B_55.d AAAAACACGAAAAATCAGCAAAA ATGAATGCCTGCCTACAAATAGA I-7D16
28  B09 I   Y48G1B_55.e CCAATTTGCTGTCTCCATTAGTC ATCGATCGGTTATTTTACAGGGT I-7D18
28  B10 I   Y48G1C_55.a TACCCTCAATTTCCCAGATTTTT ACAAATTTCCGAACAAAGTTTCA I-7D20
28  B12 I   Y48G1C_55.c ATCCCCATGGATTTTTCTGTACT CGATTTTCACACATTTTCACTCA I-7D24
28  C01 I   Y48G1C_55.d TTTCTATGGGCAAACAATCAATC TCGATAAATCTGGTTTGGAAAAA I-7F02
28  C02 I   Y48G1C_55.e ATCCCCATGGATTTTTCTGTACT CGTTTTTACCCATATCTGTGAGC I-7F04
28  C03 I   Y48G1C_55.f TGTCATGAATGAAGAACATCGTC ATGGTCTTCAACAGAGAAATGGA I-7F06
28  C04 I   Y48G1C_55.g GAATCGTAGAAGCACAGACTCGT ACTAACTCTGTGCCAATCAAAGC I-7F08
28  C05 I   Y48G8A_1975.a   AAAACATTTTGATTTTGGCTGAA CAAAATTTTACAAAACGGACGAG I-7F10
28  C06 I   Y48G8A_2614.a   TTTTGTTTGGTCTGTTTGGTCTT CTGAAAGCTCTGAAAAATAGGCA I-7F12
28  C09 I   Y48G8A_3051.a   ATCAGTTGAGAACTTTGCGTCTC GCCATTTTTCGTAGATCAAACTG I-7F18
28  C10 I   Y48G8A_3051.b   ATTCTAAAGTTGTCAAATTGGCG TATACCACGTGGGAGTGTAGCTT I-7F20
28  C12 I   Y48G8A_3051.d   TCGGTAAAAACTCTTCCATTTCA TATATTTGAATTACCGCGCAAGT I-7F24
28  D02 I   Y48G8A_3671.a   TATTGATTTTTGGTTTCTTGGGA TTAACCATGCGAAATCAGTTTCT I-7H04
28  D05 I   Y48G8A_3945.b   GACTGAGGGTTCTTTTTCGATTT TCTTTGAAAATGGGATCTACGAA I-7H10
28  D06 I   Y48G8A_3945.c   TACGACCGACTTTCTTGATTACC TTGGACCTGCGTTCTAATTTTTA I-7H12
28  D07 I   Y48G8A_3945.d   CGTTGAAAAACTTGATTGTCTCC TGATTAAAAATTCAAGCGCAGAT I-7H14
28  D08 I   Y48G8A_3945.e   GCGATACTTGTCATCAACAATCA AAGTTTAAGTGATGAGCGTGGAA I-7H16
28  D10 I   Y48G8A_3945.g   GGCAAAAAGCCAGAACTTAAAAT CCTAACGAGACCCAACTTTTCTT I-7H20
28  E02 I   Y50C1_320.a AGCGTACTTTTGTACGTGGGATA GACTTGACACCCTTGATTCTCAC I-7J04
28  E03 I   Y50C1_332.a CCTTGTTAGGCTTAGGAATGGTT AGGAACACTCAGGTGATTTTTGA I-7J06
28  E04 I   Y54E10A_150.b   TGGGTATAAAACAAAACCGAATG CGAAAAATGCCTGAAAACTAAAA I-7J08
28  E05 I   Y54E10A_155.a   CGGCTATATTGCATGAGAAAATC GTCCCCAACAGTTCCATAATACA I-7J10
28  E06 I   Y54E10A_155.b   GAAACAATGGTGAAAAAGTACGC GATCAGCGAAAGTATGGTTTTTG I-7J12
28  E07 I   Y54E10A_155.c   TCAACTCCTTGAGCTTTATCTCG CTACGGCTTTCTCAATTCTTTCA I-7J14
28  E08 I   Y54E10A_155.d   CAAATAAATAAACCGCACCTTGA AGGTCTCGACACGACGATAAATA I-7J16
28  E09 I   Y54E10A_155.e   CAATAAGTGGCGTAATTTTCCAG AATTATTAGCTCCTCCGAACCAG I-7J18
28  E10 I   Y54E10A_156.a   TATGACATTTCGTGACAATCGAG CAGACTGCTGTAACCGACTTTTT I-7J20
28  E12 I   Y54E10A_156.c   GAACTTTTCACATCGATATTCGG ATTACGTTCCATTTTCGGTTTTT I-7J24
28  F03 I   Y54E10A_159.b   AAAAACGATGACAATGGAGAAAA GGATTCTAGCGAAACAAAAACAA I-7L06
28  F04 I   Y54E10A_159.c   TAACGAATTTTGTGGTTCGATTC ATTTTTACAGGGAAAAACGGAAA I-7L08
28  F07 I   Y54E10B_152.b   TATTCCACTATGTGCAGACCCTT GTCCCACTAGAAGAACAGCTGAA I-7L14
28  F09 I   Y54E10B_152.d   AACTGATTTCGCATGGTTAAGAA GAAAATGTACAGACAGACTCGCA I-7L18
28  F10 I   Y54E10B_152.e   ATTTTCAGCTGACGTCACATTTT TCAATTTTTCAGTGTGTTCATCG I-7L20
28  G01 I   Y54E10B_154.c   TCAAATAGTCGAAATTTTGCGTT TGAAGTGCCTTTAGTTTCGAGAG I-7N02
28  G02 I   Y54E10B_159.a   GAATTTTTCGGCTTTCAGAATTT TGAATGTAATCGAAAAACCTGCT I-7N04
28  G03 I   Y54E10B_159.b   AAATTAGTTTTCAGCCCCAGAAG GCAGTAGATCACGAGCTTTTTGT I-7N06
28  G04 I   Y54E10B_159.c   ATGATACAGCGAATCGTTGAAAA TTGGCAAAATAAAAGAAAAACGA I-7N08
28  G06 I   Y54E10B_159.e   AAAAATGGGAAAAATTCGTGATT ACGACTACCTTATGCAGGGTCTT I-7N12
28  G07 I   Y54E10B_159.f   ACGGAATAGCATGAGATAAACGA AACTAGTTTTCCCCATCTCCAAA I-7N14
28  G08 I   Y54E10B_159.g   GGAATTTTCACATTTTCCCATTT CAAAAATTATTTCCTTCTTCCGC I-7N16
28  G09 I   Y54E10B_159.h   AATTGAACAAAATTTCAGCCAGA TTGCCTAATATTCTGCCGATAAA I-7N18
28  G10 I   Y54E10B_159.i   TCACATATGTACACACTTTCGGC TTGCAGTGAGGTTAGGAAATCAT I-7N20
28  G12 I   Y65B4A_173.a    TTAAAAACGACGTATTCAGGCAT CGAAATTCAGTTGATTTTAAGCG I-7N24
28  H01 I   Y65B4A_174.a    AGTGTCTACTGTAGCGTTTTCGG GCCTACTGCCTACTTTGTCTGTG I-7P02
28  H02 I   Y65B4A_174.b    ATTTTTCCTTTCCAGAATCTTCG AATTTGATATTTTTGGGCGATTT I-7P04
28  H03 I   Y65B4A_175.a    TTGGATAAAATTTCGCTGAAAAA GATTGTAGTCCTCTCGGATGATG I-7P06
28  H04 I   Y65B4A_178.a    ATTTATTCACCATTGAAGCGAAA CATAGCGAAAGTATTCTGGGTTG I-7P08
28  H05 I   Y65B4A_179.a    ATTATTTCGACAAAACATGGTGC ATTTCCAAAAAGTTTGCCATTTT I-7P10
28  H06 I   Y65B4A_179.b    CTTAAAAATGTCGGATTTTGTGC ACGAGCTATTTCAAATTTCACCA I-7P12
28  H07 I   Y65B4A_182.a    AATGGGGTGTCCTCTTGTTAAAT TCTCCAAAATTCCAGACAGTCAT I-7P14
28  H08 I   Y65B4A_182.b    TAGCAAAATCGAGCAAATGGTAT AATGAGCTTGAATGAGCTAGACG I-7P16
28  H09 I   Y65B4A_182.c    TTACGGAGAGCACGATTATTGAT GCGTCACTGGCATTTTATTTTAC I-7P18
28  H10 I   Y65B4A_185.a    TCGAGACCGGACAAATATTCTAA TGACTAAGTGCAGTGAGTTTCCA I-7P20
28  H12 I   Y65B4A_185.c    TGAGATTTTGAATTTTGCTCCAT TGACTAAGTGCAGTGAGTTTCCA I-7P24
29  A02 I   Y65B4B_9.b  AAGGTGAGGGAAAATGGAAATAA ACCGGTTTCAATACATTTGTGAC I-8A03
29  A03 I   Y65B4B_10.a GAGTAATGGAACTCCAGCACAAC TCTGAAATCGAAATACTGACGGT I-8A05
29  A04 I   Y65B4B_10.b GGCTTAATTTTGGCTCAGATTTT AAAGTTCTCGATCAATAGAGGGG I-8A07
29  A05 I   Y65B4B_10.c GTACACTTTAAAGGCGCACACAT AAAAAGGGGTGTTTCTCTTTTTG I-8A09
29  A06 I   Y65B4B_10.d GGCTTAATTTTGGCTCAGATTTT AAAGTTCTCGATCAATAGAGGGG I-8A11
29  A07 I   Y65B4B_10.e GAGTAATGGAACTCCAGCACAAC TCTGAAATCGAAATACTGACGGT I-8A13
29  A08 I   Y65B4B_11.a TCCGAATACGTCGAGAATGTACT CCAGAAGGAAAGGAAAGAGAGAG I-8A15
29  A09 I   Y65B4B_12.a AATCTGCAAAAACGTGGAAATTA TACAAACAATACGGGAGAAGCAT I-8A17
29  A10 I   Y65B4B_12.b TGTGATGGAAAATGTCAGATACG AATCAACCCAACAAGTTCATCAT I-8A19
29  A12 I   Y65B4B_13.b GGGAAATTTGTTTCGAATCCTAC GATGTTGAGCTTTGTGGAGTACC I-8A23
29  B01 I   Y65B4B_15.a AAATTGTCTGAAAAATGCGAAAA TTGCAAAAATTCGATTATTACGG I-8C01
29  B02 I   Y65B4B_15.b GTTCCGACAAATGTAATAGCAGC TCCTCATATCAAAATGCCACTCT I-8C03
29  B03 I   Y65B4B_15.c GACCCGATCCAACTTCTTATTCT TATGCGCTTATCTAGCAAAAAGG I-8C05
29  B06 I   Y71F9A_262.b    TCTCCTCTGATGACTAAAGACGC GCCAAAAATGCAAATTAATACCA I-8C11
29  B08 I   Y71F9A_270.a    CGTCTAAGAAAGCCTGATTGAAA AAAGATCGCAAAATTCTGATTGA I-8C15
29  B09 I   Y71F9A_270.b    ACTAGAATCGATCGTGAAAGCAG GTCTATACGTTCAAAATCGTCCG I-8C17
29  B10 I   Y71F9A_279.b    ATTAAATGTGTGGTACGCAATCC TTTCCTAGTCACTCGTTCGAAAA I-8C19
29  B12 I   Y71F9A_282.a    CATCGACTTTAAAATCTGGCAAA GAAAATGGAGGTTTTATTCGGAG I-8C23
29  C01 I   Y71F9A_282.b    GAGGAGCAGTTTTTGACTGGTTA AATGGGGCACATTTAAAGTTTTT I-8E01
29  C02 I   Y71F9A_284.a    GTCTTGATATCTTGATCCCGTTG TCAGCACACTCTTAACTATGCGA I-8E03
29  C03 I   Y71F9A_284.b    CCGATTTTGCAGGTACTAATCTG GCGAAACCTACCATGATAATTGA I-8E05
29  C04 I   Y71F9A_290.a    TTCAGCTGGACTACGAGAAAATC CCTATAGACAATTCTCTCGGCAA I-8E07
29  C05 I   Y71F9A_291.a    TTTACCCAACTCATCACAAATCC AAAAACTATGGTGTTACTGCCGA I-8E09
29  C07 I   Y71F9A_291.c    CTTGCAGATCCAAAAATATCGTC AAAGTTGCAAAAATGTGGAAAAA I-8E13
29  C08 I   Y71F9A_292.b    AGTGCATCCAGACTACTGATGGT ACCTTTGTCTCCCCTTAGAAATG I-8E15
29  C11 I   Y71F9A_294.c    ACCATTCCATCAGTATCACCAAC GTAACCAATCGTGTCATTTGGAT I-8E21
29  C12 I   Y71F9A_294.d    GACATTTCGATGTGTCCTTTCTC GTTTACAAAATGGACAGCTTTGG I-8E23
29  D01 I   Y71F9A_294.e    AGGCTCTTAATTTTTCAGATGGG ATAATTTCGTACCGAAACAACGA I-8G01
29  D02 I   Y71F9A_294.f    CGTCTCTCAAGACAAAACCAATC CGTCATAGAAGGAGACAATGAGC I-8G03
29  D04 I   Y71F9A_295.a    CAATAACTGAGCTCCACTCGTCT GTGATGAGGAAGATGAAAATTCG I-8G07
29  D06 I   Y71F9B_271.a    GGCAAACGTACAAATCTGCTTAT CTGTAATTTTTAAAGGCGCACAC I-8G11
29  D07 I   Y71F9B_272.b    TCGTGTGAAATTTCGATAACCTT CCGCAGAAAATTTGAAACTACAG I-8G13
29  D09 I   Y71F9B_275.b    TCCAACGATCCATTCTTTTTAGA GTTTTCGCTACGAGACCCTATTT I-8G17
29  D10 I   Y71F9B_276.a    CAATTTTTGAGCAATTTTTGGAG AACAAAATTCCTGAGAATGCGTA I-8G19
29  D12 I   Y71F9B_278.a    CCATGCAAGTGACTATGAACAAA AAGATTCCAAAAATGCTAAAGCC I-8G23
29  E01 I   Y71F9B_286.b    TTCGATAGGTGGAAGTTGAAAAA CGTCTGATTTCTATATTTTGGCG I-8I01
29  E02 I   Y71F9B_287.a    ACAAACATTTTGCGTTTGTCTTT AGGCGTGTTTTAAAGCTATTTCC I-8I03
29  E03 I   Y71F9B_287.b    ACGGCAATTCCACTCTTGTATTA AAAACCGAATTTCTTCCAGATGT I-8I05
29  E05 I   Y71F9B_293.a    GCAGAATAATTACCAAGACGGTG ATTGGATGCAAAAACTGAGAAAA I-8I09
29  E06 I   Y71F9B_297.a    AGATTCAGGTCCTTCTTCAGCTT TAAATTTTCGCCAACTCCTCATA I-8I11
29  E08 I   Y71F9B_297.c    TTGAACAATCGGAACATTTCAGT GTTCCTCTCACAAAAAGAGCTGA I-8I15
29  E09 I   Y71F9B_297.d    AAATTTCGCATCTGGGTAAAAAT ATTGTTCAAACGAGTCTCTCACC I-8I17
29  E11 I   Y71G12A.a   TAGCCAAAAATTATTTCATGGGA GACAATTTCCAAGATTTTTGCAG I-8I21
29  E12 I   Y71G12A_187.a   GCCAAGATTTCGTGGTATATTTG GTGATGTACCGTAAATGGAAGGA I-8I23
29  F01 I   Y71G12A_187.b   GTTTTCGAGCGAAATAACTCAGA GAAAATGAGCAAACGACAGAATC I-8K01
29  F03 I   Y71G12A_188.a   ACCAAACATCCTTTGAACAGAAA AAAGAGATCATACCGAAGAAGGG I-8K05
29  F10 I   Y71G12A_195.b   TTCGCTTTTCTTCTGATTTATCG AAACTCTTCACGTTTTCAGCAAG I-8K19
29  F11 I   Y71G12A_195.c   GATGATCTCCTCCTCAGATTGTG ACCTCTGGATCCTTGAACTCTTC I-8K21
29  G01 I   Y71G12A_195.e   ACAATTTCAGTGATAGCATCCGT TAGCCACTCCATTTTCATTCAGT I-8M01
29  G07 I   Y71G12A_200.a   AAAAACCGTAAATTGGCAAAACT CAAAAGACTACGAAAACCTGGTG I-8M13
29  G08 I   Y71G12A_200.b   ACAAAGTTTCAGTAATGCCCAAA TGTCAAATATGTTGCGAAATACG I-8M15
29  G09 I   Y71G12A_201.a   TTCAAGTATTCCAAGTTTTCCGA AAGTGCCAATAAATCCCAATTTT I-8M17
29  G10 I   Y71G12A_201.b   TAACTGGAATGCGTGTACAAATG AATTCCGCTAGTTTTATCCTTCG I-8M19
29  G11 I   Y71G12A_202.a   AAGATCAAGGCTTCACAAACAGA ACTTATGAGGGAAGCCAGAAATC I-8M21
29  H01 I   Y71G12A_202.c   TTTGATAATCTGGGAGCAGTGTT CACAAATCATATCGATTGCTGAA I-8O01
29  H02 I   Y71G12A_202.d   TCCCTTCTGAAAAAGTAGGTTCC AAACTTGAGAGAAAACTGGGTCC I-8O03
29  H03 I   Y71G12A_202.e   GTCTTCTCCATCCACAAAAGATG CAGCTTCCAAAAATCATAATTCG I-8O05
29  H04 I   Y71G12A_203.a   GGAAGCCCAAAGTCTTACAAAAT CAACATTTCCAAAACTCCTCAAC I-8O07
29  H06 I   Y71G12A_203.c   AAATTCTAAAATTGCGGAAAAGC AAGAAGGCGAATGATGATAACAA I-8O11
29  H10 I   Y71G12A_203.g   GTAGGCTAGACGCAGAGAAACAG TCACAATTCCATTGAAGGCTAGT I-8O19
29  H12 I   Y71G12A_205.b   ATGGACTGTGCACTTCTAAGCTC ACTAATCTTGTCGAACCATCGAA I-8O23
31  A01 II  2L52.1  AGTTCAGAAATACGCTCCAACAG TTTGGCGCAGTTATTTGATCTAT II-1A01
31  A02 II  C01B12.1    GGAGACTTCGGAGCACAAAG    GTGGTGTTCTTGGAATTGGG    II-1A03
31  A03 II  C01B12.2    GAAAGCGTCCAAGGAATGTC    ATGAGCTTTGCCCTGAAAGA    II-1A05
31  A04 II  C01B12.3    GGGCTGAGCTTGTAGTTTGG    TCATCATCCTCTCCCAAAGG    II-1A07
31  A05 II  C01B12.4    GTCGAATCGAGTGGTTGGTT    GATCCGGCTTGAAAAATTGA    II-1A09
31  A06 II  C01B12.5    TGTCTTCCAAACAATGCCAA    CAACCGACCTATGCCTGAAT    II-1A11
31  A07 II  C01B12.6    CACCATAAACATTTTTACGCCAT CTCCTGTAAGACGGCAAGAGATA II-1A13
31  A08 II  C01B12.7    AAATTGAATTCCTACCGATCACA ATTGTGAGATGGATTTCCTTCAA II-1A15
31  A09 II  C01B12.8    TTCAATACGAGGCAAACTCAAAT ATTTCATCTAACTTTCGCCCATT II-1A17
31  A10 II  F23F1.1 GAAGGTGCGGTTCATCCTTA    CAACCAAAGCAACAGCAAAA    II-1A19
31  A11 II  F23F1.2 TTAACAGAGCAAAGATTCCTTCG CTTTTGTGCAATGCATTTTTGTA II-1A21
31  A12 II  F23F1.3 AAAACAGCCAAACTTGCACC    CATCATCATCTCGCGAAAAA    II-1A23
31  B01 II  F23F1.4 CGGCAAAATTGTACACATCCTAT TATGCGATCTTCGAATTACACCT II-1C01
31  B02 II  F23F1.5 CGATTTCGCAATTTTTGGTT    TATCACAAATGGGGGACGAT    II-1C03
31  B03 II  F23F1.6 GAGACCATTGAATAAGCCAACAG TTTTATTTTCTCTGGCTTTGCTG II-1C05
31  B04 II  F23F1.7 CAACGCTGAATTTTTCCATTTAG CCTAAGATGACCTTCGTGATGTC II-1C07
31  B05 II  F23F1.8 AAGTCTCTTCGCGTCTCCAA    AATTCATCGTCAAGGCAACC    II-1C09
31  B06 II  C23H3.1 GTGTGACTGCTCTCGGACAA    GCTAGCAACACCCGATGAAT    II-1C11
31  B07 II  C23H3.2 GGCTTGGAATCGTACTGCTC    TGTGTGTGGGTGTGTAGGCT    II-1C13
31  B08 II  C23H3.3 CGCCCTGTTTTATTGGAAAA    GGGCACAGGCAAATCTTAAA    II-1C15
31  B09 II  C23H3.4 TTGTGCGGTTAAGAGTGTGC    TCCGGTTTTTCCAATGACTC    II-1C17
31  B10 II  C23H3.5 CTTATTGTTTGGCACGGGTT    GTGTGCGGGAATTCAAACTT    II-1C19
31  B11 II  C23H3.7 TATTGTGGGTGAGTGTCCGA    TTTGTGGATCAGCCAATGAA    II-1C21
31  B12 II  C23H3.8 CCATGGAGACGGAAGAAAGA    TCCGCTATGCTACGTTTCCT    II-1C23
31  C01 II  C23H3.9 AAGAGTGCGGAATTGGTTTG    CCAACGATTTTGCCTTCTGT    II-1E01
31  C02 II  C50D2.1 TAAACGAGCAAGGAACTGGG    TGATTGGCACTGAGACTTGC    II-1E03
31  C03 II  C50D2.2 ATTGGATTTGACGGACTTGC    GTTCCAGCTCCAGCCACTAC    II-1E05
31  C04 II  C50D2.3 AACAAGTAACGTGGTTCCTTCAA GTTGTTGCGAGAGTTGAATTTCT II-1E07
31  C05 II  C50D2.4 ATCCAAAGTATGAAGCACAGGAA CAGTCGGCTTAAAGTTCAGAAAA II-1E09
31  C06 II  C50D2.5 TTCGAGACTCTTTTTGCCTCTTA TTTCCGACTCAGTTCTCTTTCTG II-1E11
31  C07 II  C50D2.6 TATTTCAGTTCTCTCCGAATCCA ATAAATCATGAGGCGAGATTTCA II-1E13
31  C08 II  C50D2.7 GTCCAGTGGGATCTCTTCCA    CACGACGTGTTCAGAAGGAA    II-1E15
31  C09 II  C50D2.8 CTGCTCTTTGAGCCATGACA    TTTACAGTCATGTCGGCTCG    II-1E17
31  C10 II  K10B4.1 ATTGCCACCAGCCTATGAAG    TCATCATTTGGTGCTTTCCA    II-1E19
31  C11 II  K10B4.2 TGTTCAACGCCACACTTTTC    AGGAGACTCCAGCACTTCCA    II-1E21
31  C12 II  K10B4.3 CGAAGATCGATTGAGGGAAG    TTTCAATGATCTCGATGCCA    II-1E23
31  D01 II  K10B4.4 ATGGTCCCCTAGAATGGTCC    ATTCAGTTTGGCGGTTTCAG    II-1G01
31  D02 II  K10B4.5 ATCCGAAATGGCATGTTCTC    GAACTTTGCTCTTTGCGACC    II-1G03
31  D04 II  T25D3.2 TGGCGCTTCTCAACTTCTTT    TGTTACCTGGGATAAAGCCG    II-1G07
31  D05 II  T25D3.3 CAAAATTGGAGCCAAAGGAA    CACCGTGGGTCTTGAACTTT    II-1G09
31  D06 II  T25D3.4 AAATGTATTTTGCAGGCATCAGT AGGGAACTTGAAGCAAAGCTAGT II-1G11
31  D07 II  T01D1.1 AGATTTGAACATTTTGACGGCTA GCACAGTTTACTGATGCTCTCCT II-1G13
31  D08 II  T01D1.2 TTGTAAAGTTCGCTGACACTCAA GATATATGAAGAGATTCGCACCG II-1G15
31  D09 II  T01D1.3 TTTTGGTATTGAGTCGCAATTTT TCTCCATCATTTATCGTTTTGCT II-1G17
31  D10 II  T01D1.4 ATTGAGTGGAACGATTGTCTGAT AAACCGGAAAAGTATTTCCAAAA II-1G19
31  D11 II  T01D1.5 AGGCAGAGGTACATCATGGG    CATCCAGAAGTCGGGGACTA    II-1G21
31  D12 II  T01D1.6 CCGAACAACTCTGCTGACAA    AACCAGCTCAAACCAACACC    II-1G23
31  E01 II  F48A11.1    ATCCAGTACGATCAAGGTGAAGA ATCATTCCAAAATGATTCCTCCT II-1I01
31  E02 II  F48A11.2    ATCTCTGCTGCTCTAACACCATC ACGGGAAATGAATTGAGGATAAT II-1I03
31  E03 II  F48A11.3    ATTTTGCCATAGTATGACGTGCT GCAGAGAAACTGAAACCACTTGT II-1I05
31  E04 II  F48A11.4    TACAAACTTTTCGTTGTGCACTG ACTTCTAGGCTATGCCCAATTTC II-1I07
31  E05 II  F48A11.5    GTGTCGGCAAAGTTGTGAGA    ACCATTCTACACGGAGCCAC    II-1I09
31  E06 II  F48A11.6    AAAAACCAGAAAAATCGAAGGAC AATGATCATATCGAACCGAGAGA II-1I11
31  E07 II  B0432.1 CACCCAATTATTCATCCACAACT TATGATGATTCCCCAGGTGATAG II-1I13
31  E08 II  B0432.2 GGAGGTCATTATCACTGGAGATG TCAAAGTTTCGTGAGGGAAATAA II-1I15
31  E09 II  B0432.3 CTATTTTCAGGTATTGCAGGCAG GAAACAACTCGAATTTTGAGGAA II-1I17
31  E10 II  B0432.4 GAGTGCCAAATGTCGTGAAA    TTTCCCCAAACATCAAAAGC    II-1I19
31  E11 II  B0432.5 GAAATTCTCGATTTTCGCCA    CTTCTTTGCACAACCCGAAT    II-1I21
31  E12 II  B0432.6 AGTAAGCCAATAAATAGGCGGAG CTCCCAAAATTTCCAGATTATCC II-1I23
31  F03 II  B0432.9 GTTTTGAGGGTTCCGAATGA    ATCCGGCTTATTTCCAGCTT    II-1K05
31  F04 II  B0432.10    AAAGTATGTTCCACGGCGTC    GTAAACTTGCTCTCCGACCG    II-1K07
31  F05 II  B0432.11    TCTGTCGTCATAACTCTTGGGAT AGTTCCCTAATGTTTCTGTGCAA II-1K09
31  F06 II  B0432.12    CGACTTGCAGGAAAATCTCTAAA CACGTGAAGAATGACAATTCAAA II-1K11
31  F07 II  K01A2.1 ACTCCGAGCCAAACGACTAA    AAATTCACATTCCTCGCGTC    II-1K13
31  F08 II  K01A2.2 ACATGCGACAATGCTTTAGATTT CCTTACTGGAGGAAACATCAGAA II-1K15
31  F09 II  K01A2.3 ATTCGAACCGATCAAACGAG    TATTTTCCGTGCAACATCCA    II-1K17
31  F10 II  K01A2.4 GTACAATGCTCCGTACAAAAAGC CACTTACGAAATGAAAAACTCCG II-1K19
31  F11 II  K01A2.5 CAAGAGGCGTTCTCTTAGCAATA TTTTCTGAAATTTTCTTTTGGCA II-1K21
31  F12 II  K01A2.6 TCCAGTTCTTCGTCGTCTTCTAC TGGGTCTTTGATCTTTTAGGACA II-1K23
31  G01 II  K01A2.7 ACTTTCTGGAAACGTCCGTG    GCGGAGTTTGGTCACAATTT    II-1M01
31  G02 II  K01A2.8 TGATTCTTCATACTTTTGCGCTT TAAGCCTAACATCAAAAGCTTCG II-1M03
31  G03 II  K01A2.9 GGAGTGCAGAACTAAATGAATGC AGTTGAACTCATTGTTTTCCCAA II-1M05
31  G05 II  K01A2.11    TTTTATCCATGGCATCTCTGACT GTGTCGATGTGAGTGTTGATGTT II-1M09
31  G06 II  D1069.1 TCGATTTCAAGATTTCCGTCTAA CATATGCCCCACATGTTATTTCT II-1M11
31  G07 II  D1069.2 CGATATCGGCTGAGAGATAGAGA TTTATTATCCATGTGGATCTGGC II-1M13
31  G08 II  D1069.3 CTCCATTGAAAAGTGCCAAATAG TGGAAAATCGCTGAATTTTTAAC II-1M15
31  G09 II  D1069.4 TGACCGAATGTTTGACGGTA    CGACCATGGCTACAGCTACA    II-1M17
31  G10 II  C03H5.1 CTCGGCAAACAGCTACAACA    TGTGCTAACAGGAAACGTGG    II-1M19
31  G11 II  C03H5.2 CTCCAATCTGAAGCTCATCTCAT ACTAATTGCCTGCCAATCATAGA II-1M21
31  G12 II  C03H5.3 TTCCCTCCAAAACGACATTC    TGTTCTGGACACCAGCTTTG    II-1M23
31  H01 II  C03H5.4 GTTTGTTTTCCAATGCTATCTGC GAAAGCCGACCGAATATAAAAGT II-1O01
31  H02 II  C03H5.5 TATGCATGGGAGAGCATTGA    TGGTTAAGAACGTGCTGACG    II-1O03
31  H03 II  C03H5.6 CAAGTTGTCTGCTGCGTCAT    CGTGGTGTGTAGAATGTCCG    II-1O05
31  H04 II  C03H5.7 TTAGCTGTGTACTGTGGGGTTTT AAAAATCCTGGGAAAGGTATCAA II-1O07
31  H05 II  C24H12.1    CAGCGTGCTCAGCTATTGAC    CGAATCCTTTCGCAATTCAT    II-1O09
31  H06 II  C24H12.2    CAGATGATGATTTTCTATTCGGC CAGCAATTGTCACAGTATTCCAA II-1O11
31  H07 II  C24H12.4    GGTAATTCATCATGGCACCC    TTCCAGCTCAAAATCCGTCT    II-1O13
31  H08 II  C24H12.5    CTCTGCGGTGATTCTTGGAT    GAAAAAGCGCGAGAAGCTAA    II-1O15
31  H09 II  C24H12.6    GATCTTCTTGACGCACTTTCAGT TTATATGGCATGATAGATTCCCG II-1O17
31  H10 II  C24H12.7    TAACATCATAGTGTGTTGCCCAG AGTAGCGAAATTGTTTGATTGGA II-1O19
31  H11 II  C24H12.8    ATCCTCGATGAGATTGAAAACAA CCTCTCCTCTTCCTACTCACACA II-1O21
31  H12 II  C24H12.9    CGGCAAAGTTTATTCTCACAATC AGGAAGCGCTTATTTCTGAGTCT II-1O23
32  A01 II  C24H12.10   ACTTTTGGCCAACTTTTCAGTTT GTTGGCTTTACTGTTAACCATCG II-1A02
32  A03 II  W10D9.1 TTTTTAGGGATGCACAGTAGGAA CCAACCAACCATAAACGATAAAA II-1A06
32  A04 II  W10D9.2 TAATTTTCCGAGAAGTGGAACAA GACAAAGACTGAGACAAGCGAAT II-1A08
32  A07 II  W10D9.5 GAAAAACAGGGGAAAATCTAGGA CTGAAAATCCCAATTTAGCACAC II-1A14
32  A08 II  W07E6.1 GAGCGAGTTGGCTCTAATGG    ATCAGTCTCAAGCGGAGGAA    II-1A16
32  A09 II  W07E6.2 TCAGTTTGCGCATTTCAAAG    AATCTCGGTCAGCTTCGTGT    II-1A18
32  A10 II  W07E6.3 TATTTTCAGCCAGAATTCCTTCA TGGTTCAGAAGACAAACTTGGAT II-1A20
32  A11 II  W07E6.4 CGCAAAAACTAGGGCAAATC    CAAAAGAATACGGGCTCCAA    II-1A22
32  A12 II  W07E6.5 ATGCAGGAAATGCAGAATCC    ACATGGGGAAAACAAGCAAG    II-1A24
32  B01 II  W07E6.6 TGATTCTTCCGATCTTTGATGTT CACCATAAACATTTTTACGCCAT II-1C02
32  B02 II  T27A1.1 AACCCCTGCCTAGGTCACTT    CACAATGCCAACACCGTTAG    II-1C04
32  B03 II  T27A1.2 TTTGTTGATCCATCGGGAAT    AAGGATGTGAACAAGTCGCC    II-1C06
32  B04 II  T27A1.3 GTATAGCGCATCTGTTGACCTCT AAAGGTTGGCTAACGGATAATTC II-1C08
32  B05 II  T27A1.4 TTTTGAAAATTTCTCGACTGGAA AGACCCAATCAGAAGGAATAAGC II-1C10
32  B06 II  T27A1.5 AAAACGAGAGCAACGAATGG    TTCCGCTTGATCCATTTTTC    II-1C12
32  B07 II  T27A1.6 TTTCCAATGCAAACCCCTAA    GTGTCAAATTGAAGCGAGCA    II-1C14
32  B08 II  T27A1.7 AATCGGGAGTAAACATGAAGTGA ATGCCAACACCGTTAGAAGAGTA II-1C16
32  B09 II  C09E8.1 TCAGCCAAATTTGAAAACCTTTA AGAAATCAAAGGGATCTTTGGAG II-1C18
32  B10 II  C09E8.2 TTATTTCAATCAACGCAAAACCT ATTTTTGACAACTTACCCCGTTT II-1C20
32  B11 II  C09E8.3 ATTCAGTGGCTCTGCATCATATT TTCTACTCGATTAGTGGTTGGGA II-1C22
32  B12 II  W08F4.1 TGATTTCATGAGTTATTGTTGCG AATTTAAAAACCTCTCTCGTGGG II-1C24
32  C01 II  W08F4.2 AGTCGTTTCGATGAGAGCGT    ATTATGTTCGCGATGGTTCC    II-1E02
32  C02 II  W08F4.3 ACTTTTGTTTTTCTTCTCGGTCC GAAAATTTCGGGTTAGAATGCTT II-1E04
32  C03 II  W08F4.5 TGACTTTGGGAATTTCAAGCTAA AGCTGCTGTTTCAGAAAATTCAC II-1E06
32  C04 II  W08F4.6 ATGAAAGCATTGAGAAAAATGGA TCATGTGAAGCTTAGGGATTTGT II-1E08
32  C05 II  W08F4.7 AAAATATCGATTTTCGGCAAAGT TCCAATTCGGAATAGCATAAAGA II-1E10
32  C06 II  W08F4.8 TCAAAGCACTTTCTCATCTCCTC ATCAGTTTTCTCTCGCTTTTCCT II-1E12
32  C07 II  W08F4.9 CATCACCTCAACCATTTAACCAT TTCAAGTTGACTCCCAAACCTTA II-1E14
32  C08 II  W08F4.10    TTATTTTTCCACAACCAAACACC ATGTTTTAAAGCAATTTCCCCAT II-1E16
32  C10 II  W04H10.1    AACCATTCGAAATCAGTGAAGAA TATCTACAACAAGGCCGCTACTC II-1E20
32  C11 II  W04H10.2    TCAGATTGCGTTTTGTATCCTTT ATTCATCAATGGGTTAGTTGTCG II-1E22
32  C12 II  W04H10.3    GTAACTCCGCCGAAAATTGA    ACTTATCGAAACCGTCCGTG    II-1E24
32  D01 II  W04H10.4    AAGTTGCTTAATTATGCCGATGA TCTTAATTTTGCAAACACCTCGT II-1G02
32  D02 II  T04B8.1 AAAATTTCGGTTTTGTACCGTTT AACTTTTAACGGAAGAAGCCATC II-1G04
32  D03 II  T04B8.2 ACATCTGTTGACCTCGTAAAGGA TAAAGTTTTGTCGTCTGGCATTT II-1G06
32  D04 II  T04B8.3 CTACTGATCCGATCCTTGACATC GGATCCGAAAATGTCTAAAGTCC II-1G08
32  D05 II  T04B8.4 CGAGTAATGCTCTAGGTGTGGTC TTTTAGAAATTTTGGTGGGAGGT II-1G10
32  D06 II  T04B8.5 TTAGACCATTGAATTGGCTGAGT CTTCAAGTACTTCTCCTGGCAAA II-1G12
32  D07 II  K07E8.1 ATTTAAGGTCACTTTCCGGTGAT GGTGTTTGAGAAAGAAGCGACTA II-1G14
32  D08 II  K07E8.3 TAGGCACCCTATGATTCTCGTTA TGGACACTTTCCCTCTTTATTGA II-1G16
32  D09 II  K07E8.5 TAGCGCTTTGACTTGCCTTT    GTCCGTATTGAAGGGGGAAT    II-1G18
32  D10 II  K07E8.6 TTGAGCTAAAAATTCTGGAGCAG ATGTATTCAAGCTGGTTTCCTGA II-1G20
32  D11 II  K07E8.7 TCATACTTCAAGCAGTGCAGGTA ACTCAATTTTCTCACGATTTGGA II-1G22
32  D12 II  K07E8.8 TGGTTGGCAAAGTAGACTCAAAT GCATATTGAAAAGTGTTGAAGCC II-1G24
32  E01 II  K07E8.9 ATAGTTTATGTCGTGAGAGGCCA ACCAACTTTAACCGGAAAGTGAT II-1I02
32  E02 II  K07E8.10    CAGAGCGATAGAAAATCACTGCT AACAACTGCAGAAGAAGAACGAC II-1I04
32  E03 II  K07E8.11    CAGTAGAAGCCGCTTTTTGC    ACAGCAGCTCCCGTTCTCTA    II-1I06
32  E04 II  Y39F10C.1   GGGAATGTAAACGTGGTGTATGT GTTTGAACCATCGAGATCAAGTC II-1I08
32  E05 II  T02H6.1 TGAAGTCGTTTTTCATCGAATTT CTCCGAAACTGAGCACAGTAGTT II-1I10
32  E08 II  T02H6.4 GTTGTTCCGTAGAACAATTCGAG TTCGGTTTATCTGGTTCAGGTTA II-1I16
32  E09 II  T02H6.5 CTTGAAGCTTGTTGCTTGAAAAT TGCCTGTTTGTTTTTGTTTCTTT II-1I18
32  E10 II  T02H6.6 TCAGAATTCGAGAAGATGCTAGG ACTCCCCATATTCTTAGGAACGA II-1I20
32  E11 II  T02H6.7 AGAATATCGGAAAAATAGCGACC TACAATCACAACATGAAAATGCC II-1I22
32  E12 II  T02H6.8 ATGTTAACGTAATGCCAAACTGG CAATTTCCTCGAGAGCAAAGATA II-1I24
32  F01 II  T02H6.9 ACGCCAATTTCTAACTAGCTTCC CACAACACTTTAAGCCAACACTG II-1K02
32  F02 II  T02H6.10    GTTGTAGAGTGTGGCTTCTCGAT GTTTCGCTCAACCACTCTTCTTA II-1K04
32  F03 II  T02H6.11    ACGTGGTTGAGAGAGGTGATTTA GGTTTTCTGACAGTTTTAATGCG II-1K06
32  F04 II  T02H7.1 ATCAGTCTCCTCCTCGTCTTTCT TTGCGTTTTAGTCGTAAATTGGT II-1K08
32  F05 II  T02H7.2 TTCAGATGTCCATGCCAAAA    GCCAAATGAGGGGAGTGATA    II-1K10
32  F06 II  T02H7.3 GAGATATTGCCACTGGTGAACTC AGGACTGATAGTTTGGTGCGATA II-1K12
32  F07 II  T02H7.4 TCTAGGTTTTTCTTCCAGTTCCC TGAATTCCTTCATTTTGTCGTCT II-1K14
32  F09 II  T02H7.6 TTGCGTTTTAGTCGTAAATTGGT ATCAGTCTCCTCCTCGTCTTTCT II-1K18
32  F11 II  T02H7.8 TGAATTCCTTCATTTTGTCGTCT TCTAGGTTTTTCTTCCAGTTCCC II-1K22
32  G01 II  T02H7.10    CCAAAGCGATGACCCAGTAT    TTCACTAGCCTATGCGCCTT    II-1M02
32  G02 II  Y39F10B.a   TTCAAAAGTTCTATTCGTCTCGG ACTAGAATTTATAAGCCACCCGC II-1M04
32  G03 II  Y39F10B.e   GTGGCCTCTACATGAAGAACAAG TCATTTTTCCACGCAATTCTAGT II-1M06
32  G04 II  Y39F10B.f   GCCTTGTTCAAAATTTTCCTTTT GAAATTTTGCCAGAAAATCAGTG II-1M08
32  G05 II  C08G5.1 AATTGTTTTCAAGGGCTTACACA CAGGAGAAGCTATCGAAGATTGA II-1M10
32  G06 II  C08G5.2 TGCGTATTCATAACCATCAACAG TCATTCAACTGTTTTCGAACCTT II-1M12
32  G07 II  C08G5.3 GTCCCACTTGATATTGACCACAT AGTACCTATGCCAAATAAGCGGT II-1M14
32  G08 II  C08G5.4 ACGAGCAAAATACGTAATCCAAA AAATTGACTTTTGTGCTCCGTTA II-1M16
32  G09 II  C08G5.5 ACAACATATTTATGATCAGCGGG TCCAATAGAAATTGCTTCAGCTC II-1M18
32  G10 II  C08G5.6 AGAAAATAAGACGACGGAAAAGG TTTCATGATTTTGTGTTTTGCAG II-1M20
32  G11 II  Y39F10A.1   TTGCTCCGTTTCCATCTCTATAA GTACGAGAAAATCATATGGAGCG II-1M22
32  G12 II  Y39F10A.2   TTCTAACCGGATCTCAAAACGTA GTCACCAGAAACACGTACATCAA II-1M24
32  H01 II  Y39F10A.3   CCCGCAATTAAACAACAAAAATA TGCCAATGGAGCTTAATTTTAGA II-1O02
32  H02 II  Y39F10A.4   TCCGTCGACTATTTGGAAAGTAA TTAATACTTTGTCGCGTATCCGT II-1O04
32  H03 II  F46F5.1 TGTGTGAGTTCTAGCTCCAGTCA GCTTTATTTGTTCATTCATTCGC II-1O06
32  H04 II  F46F5.2 CGTAGCAAGTGACTCACCGA    AAAAGAGTGCTCGAGGCAAA    II-1O08
32  H05 II  F46F5.4 CAAGAAGACGTGCGTCGTAA    GCAATTGTGGTGGTTGTCAC    II-1O10
32  H06 II  F46F5.5 CCAAGTGGAACTATTGCCGT    TTTTCCTTTTTGCAGATGCC    II-1O12
32  H07 II  F46F5.6 AAGATTTGAATCATGGCAAGAAA TCTCCTCTGGAAATATTGGAACA II-1O14
32  H08 II  F46F5.7 CTCCGAGAGAAAGATCACGG    CACCGCGTCTACTGTCGTTA    II-1O16
32  H09 II  F46F5.8 GACGGTGTAAAAACTTCAAATCG TAAAAGGACACCTCTGGTCAAAA II-1O18
32  H10 II  F46F5.9 CTTGGGTTCAGTACCATAAGCAG TGTACCCTATTTGGCAAGACCTA II-1O20
32  H11 II  F46F5.10    AAGCATCTGACCGCTTTGTT    ATTGAAGTCCCGCTTCATTG    II-1O22
32  H12 II  F46F5.11    TTCCACAAATCAGCGTTTCA    TGCTCAATCCCATTTCCTTC    II-1O24
33  A01 II  F46F5.12    TTTCATCCATTTCTTCCCCTTAT TCCGAAATAAAAATAGGCTGGAT II-1B01
33  A02 II  F46F5.13    TTAAAAATGACAGACTCCGCAAT GCAAAAATGATGGTAATGTTCGT II-1B03
33  A03 II  F46F5.14    CGTTTCCTCTATGCCTCTCG    TCCCATTTCTTTTGGTCTGC    II-1B05
33  A04 II  F46F5.15    TACACTTTCGTCTGCGTGAACTA CTGAATTTCAACGGTCTATGGAG II-1B07
33  A05 II  F46F5.16    CATGTTTCGCTGTATTCTTTTCC TATCGTTCCACTGATCTAGGCTC II-1B09
33  A06 II  F46F5.17    TCCGTCGACTATTTGGAAAGTAA TTCACCACAGTGTTCACAAAATC II-1B11
33  A07 II  F28A10.1    GCAGAACTCTAATCCAGCCG    TGGGCTTTTGTGGAATTGAT    II-1B13
33  A08 II  F28A10.2    AAAACACCCGAGAACGTCAG    GTGGGAAGTTGAACGCATTT    II-1B15
33  A09 II  F28A10.3    ACGACGAAGCTTTGTATTAGCTG CTACCTGCCTACACTGCTGAGTT II-1B17
33  A10 II  F28A10.4    ACGGTTGAAGAGCAAACTAACTG CATATTTTCTGGTTCTCCTGCAC II-1B19
33  A11 II  F28A10.5    GGCCAACGGAGTAACTTCAA    TCACGTGAAAACACCCAAAA    II-1B21
33  A12 II  F28A10.6    AACATCTGCAGAGCTCCGTT    GGGATTCGGAGCCATTTATT    II-1B23
33  B01 II  F28A10.7    GTAGAATCATCAGTCAACGGAGC TCTTTAAATGGTTTGGTCTGGAA II-1D01
33  B02 II  F28A10.8    GGCAGTATATAAGCAACAGACGG GTGTGGGATTTGGAACAAAAATA II-1D03
33  B03 II  F28A10.9    AATAATCCAAAGCGAAACTGACA ATAAAACCATCGCAGTTTGAGAA II-1D05
33  B04 II  F28A10.10   TATCGGTTTTTGAGAACTTGCAT ATGAGATTGTTGATTAGCAGGGA II-1D07
33  B05 II  Y46B2A.a    AGTAGTTCCAGGGACTCTCGTTT CGGGAATGTTTATCTCTGTTGAC II-1D09
33  B06 II  Y46B2A.b    CAAATATTCGCTGTCATCATTCA CCCAGATGAACTACGACATCTTC II-1D11
33  B07 II  Y46B2A.c    GTGGTTCAAACTATCTTCCCCTT GTGTGGGTCTGTCCATAGTTTGT II-1D13
33  B08 II  Y46B2A.d    TACAGTCGATGCATCATGTTTTC AAGGGTCCAAGTTTTCAGTTCTC II-1D15
33  B09 II  T07D3.1 TCGGACCCTCTTTCATCATC    CACATCACGAAGTTTGACGG    II-1D17
33  B10 II  T07D3.2 GCACCTAATTTCAGAACAAATGC GAAACTTCCGTTTTCTGAATCCT II-1D19
33  B11 II  T07D3.3 TTACTTTCCAAATAGTCGACGGA GAGATTGTCACCACCAAAAAGAC II-1D21
33  B12 II  T07D3.4 TTTTGGAAGCGCTCAAAGTT    GCTCTGTGTACAGCACGGAA    II-1D23
33  C01 II  T07D3.5 CGCAATCATTCCGGTAATTT    AGGAAATGGTTCGGTGTGAG    II-1F01
33  C02 II  T07D3.6 TGCATCCGAGATACAAGCTG    CGATTTTCTTCCCATTTCCA    II-1F03
33  C03 II  T07D3.7 CCTCTTCAACCCCATCTGAA    TCCTAGGCTCCTATGCCTCA    II-1F05
33  C04 II  T07D3.8 GATTGTTGAGGGATCGAGGA    AGAAATCCGTCGCTTTGAGA    II-1F07
33  C05 II  T07D3.9 TCAGCGTATTGTTCAGCAGC    ATACGTGCACAATTCGGACA    II-1F09
33  C06 II  R07C3.1 CCTACGCCAAATGGTTCAGT    AGGTGCATGGAGTTGGGTAG    II-1F11
33  C07 II  R07C3.2 CTGTCTCACGCCAATTCAAA    GTGCATCGGTAGCCTCAAAT    II-1F13
33  C08 II  R07C3.3 CCTAGGCAGACCTACAACGC    GCTCGTCAGCTCCATAGTCC    II-1F15
33  C09 II  R07C3.4 GAGCCAAGTGCAGGATAAGC    TGGGAGTGAGATGTATGGCA    II-1F17
33  C10 II  R07C3.5 TGGACCAAGACAAGTCTGAAAAT AATTGTTGTGTCCGCTGAAGTAT II-1F19
33  C11 II  R07C3.6 AAGTACCCAACACTCCACCG    ACGAGGTAACATCGATTCGG    II-1F21
33  C12 II  R07C3.7 CAATGTGCATCTTGGCAATC    CAAATCCGCCATGAAAACTT    II-1F23
33  D01 II  R07C3.8 CGAAAAACAAGAGGCTACGG    CGGAAATTTCATAGCGGAAA    II-1H01
33  D02 II  R07C3.9 GTGCCAAATTGACCTTCGAT    TAAAATTGCCTCCGACGAAC    II-1H03
33  D03 II  R07C3.10    GCATCTGGTGTTGACCTTGA    TTCCGGATCTGAAACTGGTC    II-1H05
33  D04 II  R07C3.11    CTTCATTTTCATCCTCCCGA    CCATGCATATTGAGCGATTG    II-1H07
33  D05 II  R07C3.12    AATCGAAGCTGAGCAATGGT    AAAATTTACAGCGACCACCG    II-1H09
33  D06 II  R07C3.13    CTTCAGCTTTACCCGCTTTG    GATGTTTCCGGCAGTGAGTT    II-1H11
33  D07 II  R07C3.14    AGAGGCCCCTTTGTTATAGTGAC CTGAACGAGTGGCTTTAAATACG II-1H13
33  D08 II  C32B5.2 AATCTTTGGAATACTAGCAGGGG CTTTGTGATCATCCAGAAACTCC II-1H15
33  D09 II  C32B5.3 AACAGAGCTGCATATGAATTGGT AAATTATGTCACAATGGGAATCG II-1H17
33  D10 II  C32B5.4 CCATGAACGTACAAATTGCG    AACCTCTGCCTATTGCTCCA    II-1H19
33  D11 II  C32B5.5 TCTCGTCGTTACACCTGCAC    CTCTCCGATTTTGCAGGAAC    II-1H21
33  D12 II  C32B5.6 CAAGAAATTTTTGGACTGTTTGC TGAAAATTAGACGGTTCGAGAAA II-1H23
33  E01 II  C32B5.7 TGGGAATCTGCAATTGTTCA    CATTCACATCTCGTGCCAAC    II-1J01
33  E02 II  C32B5.8 TGCTCATCACTTGGCTCAAC    TCTACCCCTTTCTGACCCCT    II-1J03
33  E03 II  C32B5.9 TTTCCACCAACAATTCAGCA    CGGATCCTCGTTAGGTCTGA    II-1J05
33  E04 II  C32B5.10    GTTGAGGCTTGCTGGAACTC    CAATAAATTGTGCCACAGCG    II-1J07
33  E05 II  C32B5.11    TCTTCTCGCTTTAGGATCCTTCT TCCAAGGTTGAGTTGTTCGTATT II-1J09
33  E06 II  C32B5.12    TCAACGTCAAAATTCACATCAAG CAGTATATGAAGCCGGATTTGAG II-1J11
33  E07 II  C32B5.13    ATTTCCATGCTCTCAAAAATCAA ACCACAATATCAATCGAACAACC II-1J13
33  E08 II  C32B5.14    GGCTCGAAGTGTCGTTTATATTG GACTCCAACTTTTCGTCATGTTC II-1J15
33  E09 II  C32B5.15    CTTGGGTTTGACCAAAATTGATA CTTCATCGACGTGCTTAACTTTT II-1J17
33  E10 II  C32B5.16    TGGCCTGTAAGTAAAGGAACGTA CAAAACGTACGGTATCCCAATAA II-1J19
33  E11 II  F45D11.a    GCAGTTGCTATCGACCTGTAAAA GGATGAGCGAGACATAGAGAAGA II-1J21
33  F01 II  F45D11.c    AATTGATGAATCCTGGACCTTTT ACGTCTTTATGCCTCCTCTCTCT II-1L01
33  F02 II  F45D11.d    AATTGATGAATCCTGGACCTTTT ACGTCTTTATGCCTCCTCTCTCT II-1L03
33  F03 II  F45D11.e    TCAGCTTTCTACTCAACTCGACC CAGGTCCATCTATACAACCCTCA II-1L05
33  F04 II  F45D11.f    TTTCAAACCCTGTATTTGCAGTT TTTTCTTGTTGGAGATCCGATTA II-1L07
33  F06 II  F45D11.i    TTTGAGCTATCAAAGTTCGAAGG GAGAAGCTCGCAGTTTTGAATTA II-1L11
33  F08 II  F45D11.k    TCTGAAGGTCAGCAGACAGTGTA GCGAACAATTTATGTACCGTTTC II-1L15
33  F09 II  F45D11.l    AAAGCTTCACAAAAAGCAACAAC CCTTCTCGATTGCAGCTCTATTA II-1L17
33  F10 II  F45D11.m    TGTTAAGGTCAAGTACGCAATCA AGATGGTGGTGAAGTTCAAGAAA II-1L19
33  F11 II  F45D11.n    ATGCGACTAAACTTCATCTGCTC TCACGAGGAAACTCTCTCATCTC II-1L21
33  F12 II  F45D11.o    ATGCGACTAAACTTCATCTGCTC TCACGAGGAAACTCTCTCATCTC II-1L23
33  G01 II  F45D11.p    TAAGCAATTACTCTTATCGCCGT TAATCACTTTGAGAGGGTTCGTC II-1N01
33  G02 II  F45D11.q    GACGAACCCTCTCAAAGTGATTA TCACGAGGAAACTCTCTCATCTC II-1N03
33  G03 II  F45D11.r    ATGCGACTAAACTTCATCTGCTC TAGAGCATCACTTCATTCTGCAA II-1N05
33  G04 II  F45D11.s    GAATACTTTTTCAGCTCTCGCAA TGGCATTAAGGACATTGTAAACC II-1N07
33  G05 II  M01D1.1 TGACCAATGCTCTTTTGGTTTAT AACTACGGTATAGGGGGTGAAAA II-1N09
33  G06 II  M01D1.2 TCTACAATAGATGCCGATGCTTT AACTGAAAAAGAATTCTAGCGGG II-1N11
33  G07 II  M01D1.3 TTCTCATAGGTCACGTTTTCGAT ATCGCAGATGTTTTAAAGTGCAT II-1N13
33  G08 II  M01D1.4 GGGGAAACTGTCGACGAATA    TTGGTCATTCAGCAATGGAA    II-1N15
33  G10 II  M01D1.6 CTTTCCCAACTCTCGAATTACCT GTTTATATGTAACCAGCCGTTCG II-1N19
33  G11 II  M01D1.7 TCCATACATCTCAATTTTCCACC ACCTCCTACTGACCTCTTCCAAC II-1N21
33  G12 II  M01D1.8 CCGTAACTATGTACCCCGTAACA GCTATCTAGAGCACAGTTTCCCA II-1N23
33  H01 II  M01D1.9 GCCCATCCAAAACTTCAAGA    CTCACGTATTCGCCCTTTTC    II-1P01
33  H02 II  K02E7.1 AATTTCTCAAACATTCCCGAACT TTGAAAATCATGAGCAAACATTG II-1P03
33  H03 II  K02E7.2 GGTTAGTGGAAGGAGCCACA    GCTCCGTCTTTTTGCTTGTC    II-1P05
33  H04 II  K02E7.3 CCCGGAGTCTTCTGATTCAA    CACTGGATCGTCATGATTGG    II-1P07
33  H06 II  K02E7.5 TTTACCTCACATTCATCACATCG AGGTTTTACCGGGAATTCAATAA II-1P11
33  H07 II  K02E7.6 GATGTGGATATGAACAAACCGAT AAACCCTCTCATCTCTTGTTTCC II-1P13
33  H08 II  K02E7.7 AAAAATAGGTGGGAAGGCTTTTT TACACCCCTGGTATTGACTATGG II-1P15
33  H09 II  K02E7.8 CTTTGTGATCATCCAGAAACTCC CTCCAGTTCACCACTATTTCTCG II-1P17
33  H10 II  K02E7.9 CGAAGCTTTCCATCTTCTGG    TTCCCAAGATTTCCAGCAAC    II-1P19
33  H11 II  K02E7.10    TTCCACACGCATTCACATTT    TGCAGATTCCCAATGAACAA    II-1P21
33  H12 II  K02E7.11    AGTTTCCAAAGCAAACAAAATCA TTTTTCCGCGTAGAATGATAGAA II-1P23
34  A01 II  T13B5.1 TGCTCTCCAGTCATCCCTCT    ATTTTGAGATTTAGCCGCGA    II-1B02
34  A02 II  T13B5.3 TGTTACACAATTTCCACTCAACG GATTTTGTATCTGAAATCGCAGG II-1B04
34  A03 II  T13B5.4 GTTTGTTAGGGCCTGGGAAT    GCTCTCGTCGTGGAGGATAC    II-1B06
34  A05 II  T13B5.6 GGATAATCAATAATAGGCTCCGC TCCAATTCTTCCAAACTCCACTA II-1B10
34  A06 II  T13B5.7 TGTGCCTTTAAGTGAAAAAGCTC TCCCAAATGAAAATTCTCTTCAA II-1B12
34  A08 II  W09B6.1 CACAATATTGCGTTCATCGG    TCATGGCGATCCTCTTATCC    II-1B16
34  A09 II  W09B6.2 CCGTATTTTCTATCCCCGATTAC GGCTAGAAGTACAGAAGCCACAA II-1B18
34  A10 II  W09B6.3 TGCAACCCGTTCTTGTAAATAGT TCATAATTTTTGTGATGACAGCG II-1B20
34  A12 II  W09B6.5 TTTTCACTCGAAAAAGGGTACAA TATCCAGATAACTTTCAGGCCAA II-1B24
34  B01 II  T23F4.1 GTGATACGGAGCTATTGGAACTG GAGCGCATTTGACATTTATTTTT II-1D02
34  B02 II  T23F4.2 AATGATTGGAATGGTCAATGTTC CGAATTCTTCTTTTTGTTTCCCT II-1D04
34  B03 II  T23F4.3 TGAACTTTATTATGGGGAAGGGT AAAAAGTATAAAACGCGTCGTGA II-1D06
34  B04 II  T23F4.4 GCGAACTTTTGATCTCTGGC    AAAGGTTTCCAGGGGGTAGA    II-1D08
34  B05 II  Y50F7A.1    GATGTTGCTTGGTAACTTTGAGG TCACTGTTCCGACCTATCTCAAT II-1D10
34  B06 II  Y50F7A.2    AAAATTTCCGAGATTGTAGAGCC GATTGGAAATTTGATGGAATTGA II-1D12
34  B07 II  F53A10.1    TTTTCATTCACTCTTCCACACCT AAAATTCGCTGATTATGGTGAGA II-1D14
34  B08 II  F47F6.1 ATTGTTTCTAGTCTCCCGAGGTC CTCCTAAGCCTACCACCCTAAAA II-1D16
34  B09 II  F47F6.2 GTCCCCTTCTGGTCCTTTTC    TCGAACGGGTTCTTGTCTCT    II-1D18
34  B10 II  F47F6.3 AGTTCAAGACCCCCTCGACT    CGATAGTGGCACGGTAGGAT    II-1D20
34  B11 II  F47F6.4 TCAGTCCAATCATTCATTGTCAG CAAACAGTCCACATAAAGGGAAG II-1D22
34  B12 II  F47F6.5 GTGCAGAAGATCACTGGCAA    CGTAATGACAAAAGACGCGA    II-1D24
34  C01 II  F47F6.7 GGCCATTTCAAGCCAATTTA    TGCTCAAACTGAAACATCCG    II-1F02
34  C03 II  Y57G7A.1    AAAATGCACGCAAAATTATTGAT TGGGTTACTGTAGCTCCAAGTGT II-1F06
34  C04 II  Y57G7A.2    TTTATCCGAACTTTAACAGCGAA GCACAGTAACCATAGTAAAGCCG II-1F08
34  C05 II  Y57G7A.3    TGTATGCAGTAATTGATGGGACA TAACTGCCCATTTTGTCCTTAGA II-1F10
34  C06 II  Y57G7A.4    GAACCCGTGAGATGTCTGGT    AAGCTGATCAAACGCCACTT    II-1F12
34  C07 II  Y57G7A.5    TAATTAATCACGTTTCATTGGGG GATTCAGACGAAATTGATTGAGG II-1F14
34  C08 II  Y57G7A.6    TTCAGTAGCCGCCAGTCTTT    ATCAGTGGCTGGAGAGGCTA    II-1F16
34  C09 II  Y57G7A.7    TGATATAGCAACCGTCTGCG    CGTTTTTCGGTGCTGATTTT    II-1F18
34  C10 II  Y57G7A.8    GTTACCTTTTCCTGGCTCATCTT TTTAATGGAATTTTCCGGTTTTT II-1F20
34  C11 II  Y57G7A.9    TCATTGCAAAAATCAGTTTCAGA AAAATTCCAAAAATGGGCATAAT II-1F22
34  C12 II  Y57G7A.10   TCCATTGAAAATGTATTTGGGTC GGTGTCATTGACTGACTGGAAAT II-1F24
34  D01 II  F56D12.1    CATCACGAATTTCGGCTTTT    GCGTGAAATGGTGACAAATG    II-1H02
34  D02 II  F56D12.2    CGTTGAAATTTTGATTTTTCTGG CAGGTTCCTTTTGTTTTTGACAG II-1H04
34  D03 II  F56D12.3    TAGAAACCTCAAATCGAAACGAA TTTCTACCCCAGAATGTGTTTTG II-1H06
34  D04 II  F56D12.4    AGACCAGAACACCATTTTTCAGA ATATTAAAAGTAGGCGGAGCCTG II-1H08
34  D05 II  F56D12.5    AACATTATTTCAGCCGCCAC    GGAATTACTTGGCACCGAGA    II-1H10
34  D08 II  C13A10.2    ATTTTCGGTAATCAGGGGTAAAA GAAAAATTCGACTTTCTGCTCAA II-1H16
34  D09 II  C13A10.3    TAGGTACAAACTTGCGAACTGGT GACAGCCTGTTTTCATCAAATTC II-1H18
34  D10 II  F54D12.1    CTTTTGTTCAGGCCGTATAGTTG CCGCCATACAGTTTTTATTCAAG II-1H20
34  D11 II  F54D12.2    TGTCGAACAGTGTATAACAACGG ACAATTAATGGAGAGCACAAAGC II-1H22
34  D12 II  F54D12.3    TTCCCAAGCTCCTAGCTCAA    GGCTCCAAAATTGAGCACAT    II-1H24
34  E01 II  F54D12.4    AGAGATGACTGGTACGCAGTAGG TTTCATGTAAATACGGAACCCAC II-1J02
34  E04 II  F54D12.7    CTTTCGACTCTCCCGAAGTG    AAAGTACGCAAACGCCAAAC    II-1J08
34  E05 II  F54D12.8    TTCCTCAAGAGGCAAAATGG    TTTCCCAGGTACAATCCAGC    II-1J10
34  E06 II  H17B01.1a   GTGAACATGACCTTGTATGGGTT CTGAAAACCAAGTCACCTACCAC II-1J12
34  E08 II  H17B01.3    AGACAAGGCTCTGCACGTTT    TTTCAGGTTGGGGATGAGAG    II-1J16
34  E09 II  H17B01.4    AAAAAGGCCAATTCCAAGGT    AGTGCACTCACAAGGACGTG    II-1J18
34  E10 II  K05F6.1 TCCAGATTCGTTTTCTCGCT    GACCTACGGTTCTGTGCGAT    II-1J20
34  E11 II  K05F6.2 ATTGCCAAAAATTCGATTGC    GCACCTGCTGTTGGTCTGTA    II-1J22
34  E12 II  K05F6.3 CTGCCTCCTCTCAGTCTGCT    ATATCGATTCCTCCAGCGTG    II-1J24
34  F01 II  K05F6.4 CAGGCACTGAAGTTATGCCA    ACGATTGTTGCTTTGATCCC    II-1L02
34  F02 II  K05F6.5 AGCGTTCAATCGATTCTGCT    CATGGGAGCCTTCTCATTGT    II-1L04
34  F03 II  K05F6.6 ATTTTGCAACCCTTCACGTC    TTTCCGCACACATGAACATT    II-1L06
34  F04 II  K05F6.7 CCTTAGCCTGAATAGGACGATTT AATATGGAGAGTTGATGGCTTGA II-1L08
34  F05 II  K05F6.8 GACTTGTTTGAAGAAATCGATGG TTGTGTTCTGGTCCGTAAGAGAT II-1L10
34  F06 II  K05F6.9 AGCCGTAGGCTTTTCTGACA    GAACACATGTCTGTGGGTCG    II-1L12
34  F07 II  K05F6.10    TCCAAATCTCAACTGTTTCCTGT CCATTACTTTCCCCTCCAACTAC II-1L14
34  F08 II  T07H3.1 AACAGTACGGCCTGGATGAG    TTCCATTCGAAATCGTAGGC    II-1L16
34  F09 II  T07H3.2 AAACAACCACTTTAACCTCCCAT CAACGGTCAATAGCTTTTTCATC II-1L18
34  F10 II  T07H3.3 GAGGTCGAACTAAACGAATGATG AAAGCTTCTAGCCCCACTTAAAA II-1L20
34  F11 II  T07H3.4 ATGCATTTTCATTCTAAGCCAGA ATTGGCCTGTACTGTTTCACTGT II-1L22
34  G01 II  T07H3.6 AAGAATCAGAAGAAGCGGCA    CTTCAATGCCTAAAGCCAGC    II-1N02
34  G02 II  C08E3.1 TTTTGACCATTTTGGTATTTTGC AACAAACTCCGATACTTTCGTCA II-1N04
34  G03 II  C08E3.2 CAATGTTTTGAAACTCGTCTCCT CGTCCGAGTACTTGCTAGTTGTT II-1N06
34  G04 II  C08E3.3 CTAACTGACCAGTTTTGCCACAT ATAAGTCCAGCAAGCCAATATCA II-1N08
34  G05 II  C08E3.4 TAGCCAAATTTTGTGATGGAGAT ACCGTTAACCGTTCTTTTTCTGT II-1N10
34  G06 II  C08E3.5 GATCTTTTGTCAGGAGTTTGGTG CGAATTTTATTTCAATGAGGCAA II-1N12
34  G07 II  C08E3.6 CAGTTGGGCAAGTTCTGGAT    GCGTCGAACTCCATTTCATT    II-1N14
34  G08 II  C08E3.7 GCTCGTGTGAATAGGGTCGT    GAGATCTTGGCCCATCTGAA    II-1N16
34  G09 II  C08E3.8 CATGGAAAATGGGCAAGAGT    TAAAGCAAATGCTCCCCAAC    II-1N18
34  G10 II  C08E3.9 GAGCTTGTTTCGGGTGTTGT    AATAAGGTCGGGACCCTCAC    II-1N20
34  G11 II  C08E3.10    CGAATCTCAGCATGACCAAA    CGCTCAACATTATCAGCGAA    II-1N22
34  G12 II  C08E3.11    CAGCACCTATTTTGCTCAGAACT ATAAGAAAGACCCGTGAGAGTCC II-1N24
34  H01 II  C08E3.12    CGTGCTTGCACTCTTGTTGT    GAGTCTGGAAGGACTGCGAC    II-1P02
34  H02 II  C08E3.13    AGCAAGGTGACACCATAGTTGTT CGTGACTCATTCATCGTACACAT II-1P04
34  H03 II  ZC204.1 GGCTCATATTTTCCATTTTCCTC TCATTTGTAGCTCTTGTTGGGAT II-1P06
34  H04 II  ZC204.2 GCAACAGCAAAAATTGGATTTAG ACATAGACGGGCATGTATGTAGG II-1P08
34  H05 II  ZC204.3 TCACGTCAAAATGTATGGACAAG TGGACAATTTTTATCGAACATCA II-1P10
34  H06 II  ZC204.4 TAGTTGCCGGCTGTATCCTT    GGGCATTGGAAATTGCTAGA    II-1P12
34  H07 II  ZC204.5 GTAAGGGTGGTGAACGAGGA    ATTCTGATGAAGACACCGGC    II-1P14
34  H08 II  ZC204.6 GAGATCTCGAATAACCCCATACC GCACATAGAAACCAACTCAGGAC II-1P16
34  H09 II  ZC204.7 CCTTGACTGATGGGGAAAGA    ATCCCTTGCCCTTCAAAAGT    II-1P18
34  H10 II  ZC204.8 AGTCGGGAGAAACAGCTCAA    TCAGAGGAGTTCGCTGGATT    II-1P20
34  H11 II  ZC204.9 AGCTCCTTGCACAGTGGTTT    TATCGATCGCCGTATCTTCC    II-1P22
34  H12 II  ZC204.10    ATAACTGGTTCGTGTTCTCTCCA CTTTTCTCTCTCTCCCACTAGCC II-1P24
35  A01 II  ZC204.11    CAACAGAGAAGGTCCTGAGAAGA AATCGAATGGAAAAACCAAACTT II-2A01
35  A02 II  ZC204.12    AGAGCATCATCTGCCGATTT    AAATCTTTCTCGGCCATGTG    II-2A03
35  A03 II  ZC204.13    CTATGGTACCACAATGACCGAAT CTCAAAATTTCCAACCACTTTTG II-2A05
35  A04 II  ZC204.14    TGTACACTATTGCGTACTTTGCG ACCTCAATCTCGCGTATTTCATA II-2A07
35  A05 II  ZC204.15    TTGAAAAACTAGGCCGATGC    AACTGCCGAGTTCATGTTCC    II-2A09
35  A06 II  F58E1.1 TATCAGGCCCCCTTCTCTTT    GAATCCCGTCTTCCTCTTCC    II-2A11
35  A07 II  F58E1.2 AACGCCCTGACTTCTCTGAA    CACTGGACCTCTGCTCATCA    II-2A13
35  A08 II  F58E1.3 ATGTCTGCGGCTCTTTGACT    TCCGACTCGACTGTGAAATG    II-2A15
35  A09 II  F58E1.4 ACAAAAGAATGCCCAGTTCG    CTTGCTGGAAACCACAAACA    II-2A17
35  A10 II  F58E1.5 ATTCCATCAAACCAGCCTTG    ACGACTGCTTTCATCCCATC    II-2A19
35  A11 II  F58E1.6 TCAACGACGTGCTCTTCATC    CGTCTTGTCCATCTGCTTCA    II-2A21
35  A12 II  F58E1.7 TAGTTTTTGGGATTTTGCTTTGA CAGAAGATATTGGAATGTGGCTC II-2A23
35  B01 II  F58E1.8 AGCTCCTGACAGCCACTGTT    CTCCCTATTCTCCGTCTCCC    II-2C01
35  B02 II  F58E1.9 GATGGCTGGAATAGGTCGAA    TTCACTCAAGATGACTGCCG    II-2C03
35  B03 II  F58E1.10    AGCTCCGCAGAGTTGTTCAT    ATCTCCGAACGTTGTCCATC    II-2C05
35  B04 II  F58E1.11    GAGATCCCCGTTTGATCTGA    GTTGTCCATCGATTCGTCCT    II-2C07
35  B05 II  F58E1.12    CCCAGGAACACTCTTGCTTC    CTTCGTCATCTGCTCCACAA    II-2C09
35  B06 II  F58E1.13    TTTTCCCCCTGACTATTCAGATT TTTTTCTCCCGTTTTAAATGTCA II-2C11
35  B07 II  F58E1.14    CTGCTTGGCAGAATGACAAA    ATGGTTGCACCATCTTTTCC    II-2C13
35  B08 II  F45C12.1    AAAATGTTTTGCGATTTCCG    CCTGGTCCCTGCAAGATTTA    II-2C15
35  B09 II  F45C12.2    CAGCCTGTGGGTGTAGGTTATAG GGATCCTTCAACTCTGATCCTTT II-2C17
35  B10 II  F45C12.3    TTTAGGCCTGCAACTGAGGT    TCCTCCAAATCCTCATGCTC    II-2C19
35  B11 II  F45C12.4    TCCCCATGCGATTAGTTTTC    GCCTTCGTTTCAGCAGAGAG    II-2C21
35  B12 II  F45C12.5    AGCGACCTCTGTTGCAGTTT    GCCCAATAGAAAGTTGCTCG    II-2C23
35  C01 II  F45C12.6    CCTGGTGGTCAGTGCCTAGT    CCTTCGTTGAATCCGACAGT    II-2E01
35  C02 II  F45C12.7    CGCCTGGAGAAATTAATGGA    CTTGCCTCTAGCAAAATCCG    II-2E03
35  C03 II  F45C12.8    CGATCTAGTCCCACGCTCTC    AACAACCAACCGCAATCTTC    II-2E05
35  C04 II  F45C12.9    ATAAGACCTGCCTGATATGTGGA AGAGACGCAGACACTGTTGTTTT II-2E07
35  C05 II  F45C12.10   TTCTCAGCCTCTTCATTTTATCG ACTTCCAGGTTGTTGTAGCATGT II-2E09
35  C06 II  F45C12.11   TCCCGACGTTTATGTTACCC    TCAGGTACATGCGGATCAAA    II-2E11
35  C07 II  F45C12.12   TGACGTGCAAAATCGAAGAG    TTTTCCCACCGACTGAGAAC    II-2E13
35  C08 II  F45C12.13   TGTAGTGTTGCTTTGACGCC    CTGCGTCTTCCACAAAACAA    II-2E15
35  C09 II  F45C12.14   AGATGACACCAGGGGATGAG    GATAGCCATCCACCTCTCCA    II-2E17
35  C10 II  F45C12.15   TTGCCACTACTGCACTTTGC    AGAGAGAGAGAGGCGTGTGC    II-2E19
35  C11 II  F45C12.16   CTGATGGCGTTCCATTTTCT    GAAACAAGAGAGATTGCGGC    II-2E21
35  C12 II  K07G6.1 ACCACTTTCATCAATCAGCAAAT TTGAGTTTGTTCCTTGCTTCTTC II-2E23
35  D01 II  F36H5.1 AACCACCAAGAAAAATTGAAGGT TTTCAGGCTCTCCATATCAACAT II-2G01
35  D02 II  F36H5.2 AACCAGGTGGTCAAAGCATC    TCTCTCTCCAGGTCTTCCCA    II-2G03
35  D03 II  F36H5.3 AAGAGCTGTGCACTCCGAAT    AAAATGTGCATTCCGCTTCT    II-2G05
35  D04 II  F36H5.4 GTTACAGCCCGTGTCATCCT    TTTGCTGAACTGTCTCCACG    II-2G07
35  D05 II  F36H5.5 CCAACTCGTCCTCCAAATGT    GTTTCAGTCCGGCTATCCAA    II-2G09
35  D06 II  F36H5.6 TACGGTGAGTTCGCTAGCCT    TTGTTCATCGGACTGGCATA    II-2G11
35  D07 II  F36H5.7 TGACATGAGCACTGTGACGA    GAACGCGATTGGATTTCACT    II-2G13
35  D08 II  F36H5.8 CACAGAGGGAGATAGGCGAG    GCTCGCTTCAAGTTTTCACC    II-2G15
35  D09 II  F36H5.9 ACAAGGAAACGTCCTGTCATAAA AAATTCTATTCATTCCACGCAGA II-2G17
35  D10 II  C08F1.1 TCCCGAATCGAAGAAAGTTG    ACATTTCTGATGGTGTGCGA    II-2G19
35  D11 II  C08F1.3 CCCGTGATTCAGAGGACCTA    TTCGAGGACTCTTTGGCTGT    II-2G21
35  D12 II  C08F1.4 TTCAGGAGGATAGAGTTACAGCG CTTTTACCATTTGCTCCAACAAG II-2G23
35  E01 II  C08F1.5 TAAACTTGGTGATGCCCTCC    TTCAGAAGCAATGCTGATCG    II-2I01
35  E02 II  C08F1.6 GAAACTCGGCGTTTTCAGAC    TTGGATTTTTGGACCTTTCG    II-2I03
35  E03 II  C08F1.7 TATTGCATCCACTGTCGGAA    CGGCTTCTGTACCACCTCAT    II-2I05
35  E04 II  C08F1.8 CAGATTTCCATCACTGGCCT    AGTTGGAATGAGGCATCTGG    II-2I07
35  E05 II  C08F1.9 AGTGTTATCCCAACAAGCCG    AATGCGAAGATCCCTTGATG    II-2I09
35  E06 II  T08E11.1    CGCTGTGATTCTTTTGACGA    GACCACATTGCACTCGAAAA    II-2I11
35  E07 II  T08E11.2    GAAGAATGTGAAGCCAGAAAATG ACCACTGATTTGAGCAATGATTT II-2I13
35  E08 II  T08E11.3    TGAATTTTACCTGCGCTGTG    TTCCTGACTTTCAGAGCCGT    II-2I15
35  E09 II  T08E11.4    TGGCCGTATCATTATGTGGA    CATCCAAAAGCCATCTCCAT    II-2I17
35  E10 II  T08E11.5    GAGAGCGGCGAATTACTGTC    CATCCAAAATGCACGTGTTC    II-2I19
35  E11 II  T08E11.6    TACAGCCCGTGGAATACACA    CGTTTTCTCTCCTCCGTCTG    II-2I21
35  E12 II  T08E11.7    TTCCGAAATTGACCAAAAGC    CTTGAGAGCAGCAGTGGACA    II-2I23
35  F01 II  T08E11.8    ACATCTGTCTTGTAGAGCTTGGC TGATGTGGATGAAGTCGATACTG II-2K01
35  F02 II  C52E2.a CAAATCACACAAAGGCCAATTAT TCTTTGCAATTTTGTTTCTTGGT II-2K03
35  F03 II  C52E2.b GGAACACATAGCTCTGAACTGCT TATTTCCAAGGAGCATGTTGACT II-2K05
35  F04 II  C52E2.c CATGGATTTTCTGCGAGTTAGAA ATTAACAATTTTCGCGTCAAAGA II-2K07
35  F05 II  C52E2.e ACAAGTTTTTGCAGGAAATTCAA TTAAAATTCTTTCGCGATTCAAA II-2K09
35  F06 II  C52E2.f AATTCTGAGCGCAACTCTCATAC CGCCCCAGTACAATATATAACCA II-2K11
35  F07 II  C52E2.g CTAACGATGCCTAGGGAAAATCT TCAATTTCAGATTTCAACCCATC II-2K13
35  F08 II  C52E2.h CACCTCTATTGTCAGTGCTCCAT GCACAAATCAAAACATCAGTTCA II-2K15
35  F09 II  C52E2.i TCCCGGGAGTCTGAATATAAAAT CAAACAAAAATCTCCGAACAAAG II-2K17
35  F10 II  C16C4.1 ACATCTATCGGCTGAGGATTACA CACGTCAAAAACATGCTCATAAA II-2K19
35  F11 II  C16C4.2 ACTCTCCTTGCGCTGAAGAC    TTCGTCTTTTTCTCTGGCGT    II-2K21
35  F12 II  C16C4.3 ATTCCTCAGCTCCTACTTTCCAG AAAATCTCCTCCTTCTTCAATGC II-2K23
35  G01 II  C16C4.4 CCTTGCATATGTTTCTTCAGACC CATGTCATGTGAAAAGTGCTCAT II-2M01
35  G02 II  C16C4.5 TCCGAATCAACGAAACTGTG    CCAGGAATTCCGTCAACTGT    II-2M03
35  G03 II  C16C4.6 GGTGTGAAGGCGATGAAGAT    ACGAAAAATTCAACCCGATG    II-2M05
35  G04 II  C16C4.7 TTTCCAGTTTTTCCAGTTTTTCA AGTTGAATTGATGCGTTTTTGAT II-2M07
35  G05 II  C16C4.8 GCAAAAGAGAAAAGGTTGAATCC ATTCCTGCAAAGAGTTTGTGGTA II-2M09
35  G06 II  C16C4.9 TGTCTTCTCTCTTCTTGCTTGCT TTCTTGCAAAGAGTTCACAATCA II-2M11
35  G07 II  C16C4.10    CCAGGACCAACTTGTTTGCT    GCACGTGGGTTATTTTCGAT    II-2M13
35  G08 II  C16C4.11    AAAGTAAAAGAGAAATGGCCAGG AATTCCTTTTCAATTCACCACCT II-2M15
35  G09 II  C16C4.12    AACCCCTACCAATTTCGACC    TCCAAATCAGCGAAACTGTG    II-2M17
35  G10 II  C16C4.13    CAGCGTACATGGTACATCTTCAA GTACAACATGAATTCCAAAAGCC II-2M19
35  G11 II  C16C4.14    TGAATATTCCTGATCCCCCA    GAGCACCATGGGAAATTTGT    II-2M21
35  H01 II  C16C4.16    CAATTTCTTGAAACTTTTGCACC CTTCAAGATCACCCAAAATTCAG II-2O01
35  H02 II  C46F9.1 TCGAAACTCGGAGAAGGAGA    GGATCCTTCGAGATCCTTCC    II-2O03
35  H03 II  C46F9.2 AGGAATGCTTTGAAGCGAAA    TGAGCCGAACAACGTAATCA    II-2O05
35  H04 II  C46F9.3 CGCAACCAGATTCCGATAAT    GCCATTTCAAGCCACTTCTC    II-2O07
35  H05 II  C46F9.4 TGCTCTGCGAGCAAGAAATA    AAAACGGTGAGAAATGCAGG    II-2O09
35  H06 II  F52C6.1 CGCATTTTTCTTGAATTCTTCAC CCAGTTGCCTGAACTAAACAATC II-2O11
35  H07 II  F52C6.2 GAAAATCCAATTTCTGTCGATTG TCGAGTAAATCCTTGCGAATAAA II-2O13
35  H08 II  F52C6.3 GATTTCTCCCTTGTTTGCTTCTT ACCGGCTGTTTAAAAACCATATT II-2O15
35  H09 II  F52C6.4 GTGCATTGTGTGCAATGTGA    GTGTATCGTGTGCAACTGCC    II-2O17
35  H10 II  F52C6.5 AACATGAATTCCAAAAGCCG    CCTCACACTCGCTTCAAACA    II-2O19
35  H11 II  F52C6.6 AAAACTCCGACAGGGAAAGTAAG AGGCTAAAAATCCGGTGAACTAC II-2O21
35  H12 II  F52C6.7 AGCTTTATTTCGAGGAATTTTGC TTAATTGACGAGCATTGGTTTTT II-2O23
36  A01 II  F52C6.8 ATTGGTTTTCATGAGGCAGG    CAGGCGCAGTTTGTTGAATA    II-2A02
36  A02 II  F52C6.9 ATCAGTGAAGAGCCAGCGAT    TATCGAAATTGGAAGACGGC    II-2A04
36  A03 II  F52C6.10    TTTCAGTTGGATCTCCCGTC    TCTTTACGCCCACTTTCCAG    II-2A06
36  A04 II  F52C6.11    ATCAATGAAGAGCCAGCGAT    TGTGTCGAAGCTGGAAGATG    II-2A08
36  A05 II  F52C6.12    TCGAAAGATGAATCAACGAAAAT CGAAATACTCGATTTTCCCAGTA II-2A10
36  A06 II  F52C6.13    GAGGCTCAACTGAAAATTGAAGA ACACCGAATCAAAGAAAAAGGTT II-2A12
36  A07 II  F52C6.14    GTCCAGCTCCGTCAGAAGAG    AAAAAGATGGGGAGAAGCGT    II-2A14
36  A08 II  ZK250.1 AAAAATGGGCTCTTACGCCT    GGCGATGTATCTACTGGGGA    II-2A16
36  A09 II  ZK250.2 ATCATATCGCTTCGCTAGACTTG GAATAATTGAGGCCAGAGCCTAT II-2A18
36  A10 II  ZK250.3 ACTGCCCGCAAATGTTAAAG    GACTCACAGAGGTCTTCCGC    II-2A20
36  A11 II  ZK250.4 ACTCTGTTTGTTGCACTGGATTT TTAATACTTTGTCGCGTATCCGT II-2A22
36  A12 II  ZK250.5 TATCTTTTTGGCCAGCACTGTAT TGTTCAACATTTTGATTTTGCTG II-2A24
36  B01 II  ZK250.6 TCACCAGAAATCTCTCCTCCATA TGAACAAGGAAGCTCCAAATAAA II-2C02
36  B02 II  ZK250.7 TTATTTTCACGCGAACCTCC    ATCTTGCGGCTTGCTATGTT    II-2C04
36  B03 II  ZK250.8 TGACATGTTCTTGACAGTATGGG AGGATGTATCAAAACTCGACGAA II-2C06
36  B04 II  ZK250.9 GGACAGTGTACATTCGGCCT    CGAGCAATGGTCCAAAACTT    II-2C08
36  B05 II  ZK250.10    GGACAGTGTACATTCGGCCT    CGAGCAATGGTCCAAAACTT    II-2C10
36  B06 II  C40D2.1 TCTTGCTCAGAGTTAGAAGGCTC AGAAATCCTTAATAGCGGGTCTG II-2C12
36  B07 II  C40D2.2 TTTCGAAACTCGGAGAAGGA    AATGTTGAAGCGAGTTTGGG    II-2C14
36  B08 II  C40D2.3 TGAATTCCAAAATCCGGAAG    TCGACCAGGTTCTGGATAGG    II-2C16
36  B10 II  F59H6.1 ATAATTCCTAACCATCAATGGCA GTCGCACTTATTCTTGACGAAAC II-2C20
36  B11 II  F59H6.2 CGAAGAAAGTGTTGCGTAAGTTT TTGAAGATAAGTGGATTCACGGT II-2C22
36  B12 II  F59H6.3 CATCTTAAGTTGTGGCTCCATTC GCGTTTCGAAAATTACGATTATG II-2C24
36  C02 II  F59H6.5 CTGAGATTCCAAATCCTGACAAC AATCCTCAGAAAGATCCCACTTC II-2E04
36  C03 II  F59H6.6 ATGTGAAGATTCTGGACACGACT AAGTTTTAGTTTTGGTTCGCACA II-2E06
36  C04 II  F59H6.7 CTCATTGTTCTAATAAATCGCCG GAACGAAAGATGGAAGAAAAGGT II-2E08
36  C05 II  F59H6.8 TACTTCGATCAGAAACTCTTCGC AAATCAGTTGAGAACTCTGCGTC II-2E10
36  C06 II  F59H6.9 GATGAAAAACTGTCGGAATCAAG GCAAAGAAGAATTTGTTGGTGTC II-2E12
36  C07 II  F59H6.10    TTCCTCGAAAAATCAATGAAAAG ATTCCAGCTCTTCCACACTTACA II-2E14
36  C08 II  F59H6.11    TTTAGAGTTTACACAGACCGGGA GATGCTAACCCACTCATTTTCAG II-2E16
36  C09 II  F59H6.12    ATTCAAAAATTCCCCAAAATCAT GAAGAGATATTGGTTTGGGGTTC II-2E18
36  C10 II  B0047.1 TTGGTTTTTCGGATTTTTCG    TTTCAGGCCAATTCGTTTTC    II-2E20
36  C11 II  B0047.2 TTCTCATTGGACCAAATTGAACT TGGAGATTCAAACGATCAAACTT II-2E22
36  C12 II  B0047.3 CCAGTTTTATTGCGATTTTTGAG TAATTTCAGCAAAAGTAACCGGA II-2E24
36  D01 II  B0047.4 TTTATCTTCAACGGAAAGAACCA CAGAAAACCTATAAACCGCTCCT II-2G02
36  D02 II  B0047.5 CGCCGGAACACTGATATTTT    TGATGCGCATTCAATGATTT    II-2G04
36  D03 II  F07E5.1 CCACCAAAGCACCGTTTATT    AGGTCAATCTGTTGAACGGG    II-2G06
36  D04 II  F07E5.2 ACAACAAAAGCCGGTTTGAC    TACTTTCCCACGCGTAGTCC    II-2G08
36  D06 II  F07E5.5 CCGTACGTAATCTTCTGATCCTG TTTCACGTAATTTTCGCATTTTT II-2G12
36  D07 II  F07E5.6 TGCACAGTTCCAGCTTCATC    ATGCAGTATTTGGAGCCACC    II-2G14
36  D08 II  F07E5.7 TTTCCTTTAAACTGTTGAGCTGC AAGAATCGAAAGTGATGGTCAAA II-2G16
36  D09 II  F07E5.8 GTTGAAGGCTCATAATCAATTCG CTTCATCACTGAAAAACTGTCCC II-2G18
36  D10 II  F07E5.9 CGGTGGTTGAAGTAGAATCACTC GGTTTCTCAGGTTTTTCAGTCCT II-2G20
36  D11 II  T16A1.1 AGTAGTGCAACGGGGAATTG    CAAGTCCAACCTGCGAATTT    II-2G22
36  D12 II  T16A1.2 ATTGAAGAAATTGGCATCCG    AAACCAATGCTTTCACAGCC    II-2G24
36  E01 II  T16A1.3 ATAAGCCAATTCTTGTCGACGTA CTTCAAAGTCTTGCTTGCTCAAT II-2I02
36  E02 II  T16A1.4 TGGATACCTCTTTTGTCAATGCT GAGGTGATATGATGTCCTGGAAG II-2I04
36  E03 II  T16A1.5 TGGAAAACTAAAACTAATGGCGA GAATTATTGGCTCTGTTCAATCG II-2I06
36  E04 II  T16A1.7 ATCAACTGGTTCAACTGGGG    TCATGTGGGGCATACAAAAA    II-2I08
36  E05 II  T16A1.8 CTTAAAAGCCGGCAAGTCTG    TCCAGCTCTAATCGCCATCT    II-2I10
36  E06 II  T16A1.9 ATTTAAGGTTTACTCCGTGCTCC CACCTCTTTCTCCCCTCATTACT II-2I12
36  E07 II  R52.1   CCAAAATGAAGGACAGCGAT    CCGTGAAGCGCATAATACAA    II-2I14
36  E08 II  R52.2   ACTGGAACAAATTCGGAACG    TGAGGGCAATCGGTATCTTC    II-2I16
36  E10 II  R52.4   TCCAACTTATCAGCTTTTAGCCA AGTCTACGTTCGATTTCGGTACA II-2I20
36  E11 II  R52.5   CAAGCTATGTACGTGCATTTCAA TCACTTACGATTCAAACCTCGAT II-2I22
36  E12 II  R52.6   CCATTCGGATATTTTGACATCAT TTCGAAGAATGCCTATATGGAAA II-2I24
36  F01 II  R52.7   CGCGGGAGTTCAAAAATAAA    TCACTGGAAATTTTGGAGGC    II-2K02
36  F02 II  R52.8   ATATTGTCGAAAACCATTTGTGG AACGATTATTTGAAGATGAGCCA II-2K04
36  F03 II  R52.9   TTGAAAAATACGAGCTTTTGAGG CATTTCACAATTTTGGGTTGTTT II-2K06
36  F04 II  R52.10  TGCGATGAGAAAAGGTAAATTGT TTCTTGAAGATCCTTCAGTCTCG II-2K08
36  F05 II  C40A11.1    AAAAATGGAATGCTTGCTGTTTA GTTACTCGTTCACACCGCTTATC II-2K10
36  F06 II  C40A11.2    AAACATTGTAGGGGTCGAAAAAT TCATAAATTCCCGATTTTCACAG II-2K12
36  F08 II  C40A11.4    AAAAACTTGCCATTAAAAGAGCC GGAAAGAGTTCAGGGGAATTAGA II-2K16
36  F09 II  C40A11.5    TGATGTGAAATGTTGATTTCGAG CACTTCCAAAATCGGTAGATGAC II-2K18
36  F10 II  C40A11.6    TTTTGAGAATACAATTAGGCGGA TTCATTGAATCTCCAGAATGCTT II-2K20
36  F11 II  C40A11.7    TAGTTTTCGCCAAAGAGACACAT TCGATAAAAAGCAACAGAAGGAA II-2K22
36  F12 II  C40A11.8    ATCCATCTTCGAGATTTCCTCTC AACCTTATAATCTGAAGCCGAGG II-2K24
36  G01 II  C40A11.9    CCAAAGTAATAACCATGTCCCAA AATCGGTAATGGAAAACGAAAAT II-2M02
36  G02 II  C33C12.1    GAGAACGACGCAAGAGAAATAGA TTTATATAGTTCAAGGACGGCGA II-2M04
36  G04 II  C33C12.3    TTTTCGGGTCGAGTTTACAGTTA ATAAAACATGGGCTGCTTGTAGA II-2M08
36  G05 II  C33C12.4    GATAAGCGGTGTGAACGAGTAAC TTCTCCGTTCACAAATTGAAGAT II-2M10
36  G06 II  C33C12.5    TTTCCAATTTGACAATGCGA    GCCCACCGTGAGTGAATAGT    II-2M12
36  G08 II  C33C12.7    TGCCTAATAGTTCAAGACTCCCA ATTCGGCAAACTCTTACATTTCA II-2M16
36  G09 II  C33C12.8    GCATAAAACATGGGCTGCTT    TTTAGCCTGCAAAGGGAAGA    II-2M18
36  G10 II  C33C12.9    GCCGCTTTAACATTATTCTCCTT TTTTCTCCAATTTCTTCCAAACA II-2M20
36  G11 II  Y59C2A.1    TCTCACACTTTGGTTCCAATTCT TGTACTCATATCCATCGGGATTC II-2M22
36  H01 II  Y59C2A.3    TGCGAGAGGTAGTTATTTGAAGC AGATGCCAATGTTAGAGTCCAAA II-2O02
36  H04 II  K09F6.3 TATGGACAACCGCATTTTGA    CATCCTTTTTCACCGATGCT    II-2O08
36  H05 II  K09F6.4 TGCAATAAATGGAGTGGCAA    TCGAAGTTCCTCACAGGCTT    II-2O10
36  H06 II  K09F6.5 GAATCATAGGAAGGAGGCCC    CCACGAAGATGAAATTGGCT    II-2O12
36  H07 II  K09F6.6 AGCGAATTTTTAGAATCTCCCAC AAGAGGAAAAGCAGAAGAAGGAA II-2O14
36  H08 II  K09F6.7 ATACATGCTATTGCGTTGTTCCT TGAAACAGGACTGCCTCATAAAT II-2O16
36  H09 II  K09F6.8 TAAACCAACTCCCAACTGCC    GCAATTGATAACGCCCAAGT    II-2O18
36  H10 II  B0281.1 AAAACTCTGAGGACAAGATGACG TCACCTTTTTCAACTTTGCATTT II-2O20
36  H11 II  B0281.2 TGTTTCCGCTTGAAAAATCC    GGAATTCGGGAGAGTTGTGA    II-2O22
36  H12 II  B0281.3 ACTGCCAAAATGCGAAATCT    TGGGTCTGACTCCCCACTAC    II-2O24
37  A01 II  B0281.4 CCATGCACGTAGCATTGTAGATA TACATCTTCCCAGAGGTGTCCTA II-2B01
37  A02 II  B0281.5 GTAGATCAAGCCGTAATGTGGAG ACAGCCTTCAATATGTCTGGAAA II-2B03
37  A03 II  B0281.6 TAACAGTTTTCTGGACGGGTTTA GTTTCTCTATCAGGATGGGCTCT II-2B05
37  A04 II  B0281.8 ATTTTTCGTCCCTGCATACG    AAGTGCCAAAATGCGAAATC    II-2B07
37  A05 II  ZK1240.1    CTACTCGCCTATGCCTACTTCCT TTGCCACATCTACAAAACTTCCT II-2B09
37  A06 II  ZK1240.2    ACAAAAATCGAAAAGTGCCG    CTAGGCAAAAGCTCACCTGG    II-2B11
37  A07 II  ZK1240.3    TGTGGTGGGGTGAGAGTGTA    TTGATACGCGTCTTCATTCG    II-2B13
37  A08 II  ZK1240.4    AAATGCAAAGTTGAAAAAGGTGA TTCGCTTTTTCTTTGAAGACATC II-2B15
37  A10 II  ZK1240.6    TTGTTCTTTTTGTGCCTGTTTTT TTTTACTTGCTCTCCAATTTCCA II-2B19
37  B01 II  F16G10.2    AGGGCGATGTACTTCAAAATGTA TAAATCAAGCTAATCCCCAACAA II-2D01
37  B02 II  F16G10.3    TTCCAACTTGATGGACAGAGATT TTCTAATTGTTTTCGCGGTTAAA II-2D03
37  B03 II  F16G10.4    ACATCCATCAGTCTCCTCAAAAA TTAGACAAAATCCCCAGTTACGA II-2D05
37  B04 II  F16G10.5    TTTAATAATTTTCACATTGCCCG GAAACCAGAAATTAGAGCGGAAT II-2D07
37  B05 II  F16G10.6    GGAAGAATGCGAAGTTACATTTG TAGCAAAAGTGAGGATCATTGGT II-2D09
37  B06 II  F16G10.7    CTTATCAGCTCGTCCCCTAATTT AAATGTACCCATTTACCCATTCC II-2D11
37  B08 II  F16G10.9    CGATCAATGTTTCTCCAATCTTC TCTCACTCCACCTACCTCCATTA II-2D15
37  B09 II  F16G10.10   CTTATTGAGGTGAGAAGCCCTTT ATAAGAAAGACCCGTCAGAGTCC II-2D17
37  B11 II  F16G10.13   CAGCTATTCTATCGTCAGGTGCT AAAGGATCTTTGTCCGATTTCTC II-2D21
37  B12 II  F16G10.14   CAAGATTGATTACAGCACACCAA AAAGGATCTTTGTCCGATTTCTC II-2D23
37  C01 II  F16G10.15   CAAGGGACCTACCCCGTTAT    CGAAGTTCTCAAGCCTGACC    II-2F01
37  C02 II  F42G2.1 ATGAGCGATTTTGATGATGTTCT ATTTGACAGGGGTTTTACTGGTT II-2F03
37  C03 II  F42G2.2 CTCAACTCCGTAGGCACACA    GTAACGTCGGGTTCCAAAGA    II-2F05
37  C05 II  F42G2.4 TAGGTAGCCCTGACGAAGGA    GTCCCACTGAATGGCTTCAT    II-2F09
37  C06 II  F42G2.5 TATATTGGAAAATCCGGGCA    GAGCTCGTCTTCAGTGGTCC    II-2F11
37  C07 II  F42G2.6 TCTGCGGCTCTTCTCTCTTC    GCAACTTCAAAACGAGAGGC    II-2F13
37  C08 II  T22D2.1 CGAAAGCCGTGATAGTTAGAGAA GAGCTAAACTCCAAAATCCCACT II-2F15
37  C09 II  F53G2.1 TCCAAATGACTCTGACTGCG    TCGGCTTCCTGACAACTTTT    II-2F17
37  C10 II  F53G2.2 CCGCCCAGACTGAAAAATAA    GTGGAGTGTGGATGAGGCTT    II-2F19
37  C11 II  F53G2.3 ACCGAATTTGCAGGAAAATAAAT CGAATCTAGTCGATATGGGTGTC II-2F21
37  C12 II  F53G2.4 AAACAGTGCCCGTAAAATCG    CCGAAATTTTCAGACCCAAA    II-2F23
37  D01 II  F53G2.5 TATGCTCAAATTTCGTGGAGAAT AGCAATTCTTAAAATTTCCAGCC II-2H01
37  D02 II  F53G2.6 CTCAGATTTTCTGGAATTTCCCT CCACTAATTTCCATGATTTTCCA II-2H03
37  D04 II  F53G2.8 AAGATCAGACAAGAATCGCATGT CTGATCTCCCTCCTAGCGTATTT II-2H07
37  D06 II  F59H5.3 CGACGTCATTCTCTTTTGACTTT GAGCTGTATCGTAAATCGTCACC II-2H11
37  D07 II  F40B1.1 TCCAAGATAGGCCAAAATCG    TCAATGTTTCGTGGTAGGCA    II-2H13
37  D08 II  F40B1.2 GGCGAGGGAGTTTACACTAGAAT TTATTTTACCAGTTTCGGAACGA II-2H15
37  D09 II  K02F6.1 CTTAGCAAGTCTTTCGGTTCTCA TCTCGATCCCAACTGTACTTCAT II-2H17
37  D10 II  K02F6.2 GGCTGTTCAAGAAGGACTGC    AGCAGCTTGGACGCTACAAT    II-2H19
37  D11 II  K02F6.3 GTCATTCTTTGACGTCGGGT    GCAAAACTCTCCAAACTCGC    II-2H21
37  D12 II  K02F6.4 TTGACAGATGCTATTGGGAAAGT TGAGTGATTATTGGAAGGCTTGT II-2H23
37  E03 II  K02F6.7 ACACTTTGTTCCAGCCCAAG    ATCAACACGACGATGAACCA    II-2J05
37  E04 II  K02F6.8 CAATGGTCTCAAAATGACCAAAT ATAGGTATGCTGACGTGTTGCTT II-2J07
37  E06 II  F09D1.1 GAGCTCATCAGAAAGCTATGGAA TTGGCGTTTTTAGCTCATTTTTA II-2J11
37  E07 II  F33H12.1    AAATCGATTCCGATGAGACG    CGGAGTCCATGATCTCAGGT    II-2J13
37  E09 II  F33H12.3    AGTCTCAGAATGTGCTGGAAAAG AAGCTCATATCAAATGGAGGACA II-2J17
37  E10 II  F33H12.4    AGTCAGCGGAAGCCAAGATA    GTGCAGCCAATCCCACTATT    II-2J19
37  E11 II  F33H12.5    TGACGTGTAAAAGTGAGCAAGAA TCATTTTTACTCAAGCAGCAACA II-2J21
37  E12 II  F33H12.6    GGACAGTGTACATTCGGCCT    CGAGCAATGGTCCAAAACTT    II-2J23
37  F02 II  D2062.2 CTCAACCGTATTTCAAATCGAAG TCACGTGCATTTTTAAGGAGATT II-2L03
37  F03 II  D2062.3 TTTTTCCAGACCAAACTCCG    ACCGAAATCGGTGCAATAAG    II-2L05
37  F04 II  D2062.4 AAATTGATCTCGCGACCATACTA AAACAGTAGGTAGGAAAGCCTGC II-2L07
37  F05 II  D2062.5 TGCTTACCTCATGCCTACAATTT GATCTGACGGAGGAGGAAGTTAT II-2L09
37  F06 II  D2062.6 AGCCTACAATGACCAAACAAAAA CAATTTCAGGTCAACTTCGAATC II-2L11
37  F08 II  D2062.8 CGTCACCTCTCATTTGCTCA    GACGTCCGACTCATCGAAAT    II-2L15
37  F09 II  D2062.9 AGAATGGTGAAGTTGCAGCC    GGTCACTGTTGCATTTGTGG    II-2L17
37  F10 II  D2062.10    ACATTTTGAAGACAAGGCAAAAA GGAAAGCTTAATCATGTGTTTCG II-2L19
37  F11 II  D2062.11    TTTGCCAAAGTTTTGACGTG    ATCTTCCGGAGGGCCTACTA    II-2L21
37  F12 II  F22E5.1 TCAGATGAAGCGAACAATGC    TTTAGAAGAACCCGGGAGGT    II-2L23
37  G01 II  F22E5.2 AGAAGCCTGTATGAGAACTGTCG TGAAATTTTCCAATGGAGTTCAG II-2N01
37  G02 II  F22E5.3 TCATCGATGGATATGGAGCA    TGAACGTCATCTTCCTGCTG    II-2N03
37  G03 II  F22E5.4 TCATTGAAGGCGTGAGACTG    CCGGTAAGGTGGCGTAGTTA    II-2N05
37  G05 II  F22E5.6 AACTCCCCATTTTTGTTTGAAAT ATAATTGAAACCCGATGGCTATT II-2N09
37  G06 II  F22E5.7 ATTAATCGAGGTGGACGGATAAT TCGATAATGATGAACAATTTCCC II-2N11
37  G07 II  F22E5.8 TGTTTTCAAAATGACCCTCAACT AATTTCCAGAACTGAACATCGAA II-2N13
37  G08 II  F22E5.9 TTTTTATTGTATGATGTGCGGTG AAATACACAGAATCCGGTGAAAA II-2N15
37  G09 II  F22E5.10    TCATTTTCACCTGCCCTTTC    TCCTATACGGAGGTGTTGCC    II-2N17
37  G10 II  F22E5.11    CACAAAGGGAGGCAGTAGGA    TTATGTCGACGTGTTCCCAA    II-2N19
37  G11 II  F22E5.12    GCTTCTGTACATAACGGAGCATT TTTCAATTTTTCTCTGCATCCAT II-2N21
37  G12 II  F22E5.13    AATCTACTAGCAGCCGACACATC TTTTGTTTTCGCAGCTATTTCTC II-2N23
37  H01 II  F22E5.14    CCAAAAATAAATCTCCGATAGGG TTGAAATTTGGAGTCACGTTCTT II-2P01
37  H02 II  F22E5.15    GAACACTGAGCCTGGAATAAATG AGGATGGAAAAGTGATGGAAAAT II-2P03
37  H04 II  F34D6.1 CGGGGTTGGAGAGTTGAATA    GGCCCACAAACCTTCACTTA    II-2P07
37  H06 II  F34D6.3 TATTTTGGTCGTGTAGTCATCCC CTACGGTCATAGTACCCCAATGA II-2P11
37  H07 II  F34D6.4 TTTCTCAGGTTCGTTGATCATTT TATGGTAAGTAAGGACTGCCGAA II-2P13
37  H08 II  F34D6.5 GGGACAACAAAGGGCAAGTA    CTCCCGCTCTCACTTCAAAC    II-2P15
37  H09 II  Y47G7B.1    TCACACCGCTGCAGAGATAC    AACATGGCCCAAATTCTCAG    II-2P17
37  H10 II  Y47G7B.2    CGATGCTCATCCAGAACTGA    ATTCTTTCCGTCTTCTGCGA    II-2P19
37  H11 II  Y47G7B.11   TTTTTGAACGAAATTGGAAGAAA TTTGCCGGAAGTCAATAACTAAA II-2P21
37  H12 II  T05A8.1 TGACTTGGGATCACGTCTAGAAT TTAGCAATACTTTCCAACGCTTC II-2P23
38  A01 II  T05A8.2 CTGTGAAATCTGCTCTGTTGTTG TCTCCGATTTGCTAGTCTTCTTG II-2B02
38  A03 II  T05A8.4 TCATTCCAGCATCCGTGATA    ACAGAGGCCAATTGAAATGC    II-2B06
38  A04 II  T05A8.5 CTTGAACTCACCGAAGCACA    CCGTCCTCTTCAATCTTCCA    II-2B08
38  A05 II  T05A8.6 AGCATGGTGTTACAAGCTTCAGT AGGTTATCAGCAACGAGAAAGTG II-2B10
38  A06 II  T05A8.7 AGATCATGAAGGTTCGGTCG    CAGATCCTCCATCCCTTCAA    II-2B12
38  A07 II  F29A7.1 TCGATCGTAATAGCATCCCC    ACAAACGTCCAGACCAGACC    II-2B14
38  A08 II  F29A7.2 AGGAGGTTATTTGGTCCGCT    GCCTTTCAGCACAACATTCA    II-2B16
38  A09 II  F29A7.3 TTTCGAGGGAATCTGACAAGATA GACCATGGTAACTAGGCAATCAG II-2B18
38  A10 II  F29A7.4 TGCGGAAGGAATTGGTAGTATAA ATGACAATTCGTGGAGAAAGAGA II-2B20
38  A11 II  F29A7.5 ACCCTTGAAGTACACCTAGAGCC GCTAACATCATGCTATGGAGACC II-2B22
38  A12 II  F29A7.6 TTCCCCAGAACAAATCGATATAA TCTGCAAAATTTTCCGATTAAAA II-2B24
38  B01 II  F29A7.7 CGCTAAGGTAACACAGACTGCTT TGCCAACAGAAATTTATAACCGT II-2D02
38  B02 II  F29A7.8 CGGATGATAGAGGTCAACTTACG AAAAACCCCCTACTCCAAAAAGT II-2D04
38  B03 II  F08D12.1    TGGAAAATTCACTAAAATTCGGA AAATTTTCAAAAATCGCCAAAAT II-2D06
38  B04 II  F08D12.2    TAGCTACCCGAACAAATTGAAAA GCATTGGTGGTAGAGACTGAAAC II-2D08
38  B05 II  F08D12.3    GGTTTAAAATGCCAGCAGGA    ACAACTACTTGACCCGGTGG    II-2D10
38  B06 II  F08D12.4    ATCCAAATGACTCTGCTCCG    TAGACCGCAGCTGGAAACTT    II-2D12
38  B07 II  F08D12.5    GCTTGGAAGGTATGTCTATGTCG TGAGTGTGGTATCCGTGTACTTG II-2D14
38  B08 II  F08D12.6    AGAGTCGCCATTGGCTCTAA    CGATAGCGTGAATGAGGGAT    II-2D16
38  B09 II  F08D12.7    AGCGGCATTTTCAATTTCAG    CATCCCCCACTGCTTAAAGA    II-2D18
38  B10 II  F08D12.8    TTTTGCAGGGTTGGAGAGTT    TGCTCAATTGTGTCTCCTGC    II-2D20
38  B11 II  F08D12.9    TATCATTTCAACCGCAACGA    AAAACATCCTAAACGCGACG    II-2D22
38  B12 II  F08D12.10   CAAAACGGAGTACCTGCCAT    TTGTGCTCCAAAATCACCAA    II-2D24
38  C01 II  F08D12.11   ATTCGGAGGTGTCGTGTAGG    AGCGACGCGCTATCTGTATT    II-2F02
38  C02 II  F08D12.12   TTTGTTGGACGATCCACTGA    GCCAACTCGATTTCTGAAGC    II-2F04
38  C03 II  F08D12.13   TCAGTTTTTCACCTAGAAATGGC TATGGATACCTCACCATCTCCAC II-2F06
38  C04 II  F08D12.14   GCCAACTGCAAAAATGTAGAAAC TTTCAAAAACCTCATTCCAGATG II-2F08
38  C05 II  Y110A2B.a   GCTTCTTGTAGGAGATCATGCAC TTTCAAAAACCTCATTCCAGATG II-2F10
38  C06 II  K12H6.1 CTCCCAAACTCGCCTCTATACTT CTCCATTTCCAGAAAGTCCTCTT II-2F12
38  C07 II  K12H6.2 AATTATTTCTGAATCGGAGCACA TTGGAATTTGGATTATGATCTGG II-2F14
38  C08 II  K12H6.3 GCCAATTTTCATTTGCATTTTTA GTTCAATCCCCACATAAGTCAAA II-2F16
38  C09 II  K12H6.4 AAAAATGTTTGTTTTTGGCTGAA ATTCAACGATGACATCTCCAACT II-2F18
38  C10 II  K12H6.5 ACGATGTTAAGTTCTGGTGCATT CGCTCGATATCTGTAAGCTGAAT II-2F20
38  C11 II  K12H6.6 ATGGTACAATTGGGAGGGTTACT CGAATTTTGCACATTGTGATCTA II-2F22
38  C12 II  K12H6.7 TTGAAGCAATAAGGCTGAAACTC TCACAATTCCAATTTTATGGGAC II-2F24
38  D01 II  K12H6.8 AAAAGAGGAAGAAATTCAGGTGG TTTCAAATAGTTATTGCGGTGGT II-2H02
38  D02 II  K12H6.9 TGGATGTAATTGGATTTGAGAGG ATCCCACTAGGCTTTAACTGGAG II-2H04
38  D03 II  K12H6.10    GGCTTAGTTTTTGGTGTGTTTTG GAGAAAAATGTTTTACCACAGCG II-2H06
38  D05 II  K12H6.12    GGTCTTGGCATTAAAGATGTCAG ATAACCTAATGCGACGAGTTTCA II-2H10
38  D06 II  ZK355.b CCACTGAGGTTTCTGAAATTTTG TGTGGTAAGTTATTGGGTCTCGT II-2H12
38  D07 II  ZK355.c ATTTTCCTGTGAATATGCCATTG ACTTCCAATTGAGGGAAGATAGC II-2H14
38  D08 II  ZK355.d ACTTTCATGCTCTGAAAAAGTGC TAATGTTATCGCTGGTTTTTGCT II-2H16
38  D09 II  ZK355.e GACAATTTTTCTGTGGAACCAAC AGCCCTAAACAAGATAATGCACA II-2H18
38  D11 II  ZK355.h TGCTCAAAAGTACCCACTGGTAT TGTAGCATACGACCTTGTTGTTG II-2H22
38  D12 II  T11F1.1 TGCTCTTTTGATTTTTGACCACT TCAGGACGGTTCAAAACTTTCTA II-2H24
38  E01 II  T11F1.2 CTGCAATGGATATCAGATCAACA CAAGGCAATAAAACAGAATGGTC II-2J02
38  E02 II  T11F1.3 TGGACATTCGTTTGTTATCACTG GCAAATGAACTTTGTGGTGAGTT II-2J04
38  E03 II  T11F1.5 AAACTTCAATGACGTGCCTCTAA TAGGCACTATGGTCTAGGCTGAG II-2J06
38  E04 II  T11F1.6 ACTGCCAAAATGTTAAGCAAAAA GGCATTCCAAATGTTGTCATATT II-2J08
38  E05 II  T11F1.7 AGTTATTCGAAAATCTCACTGCG AAGAAAAAGTTCGGGCTAATCAC II-2J10
38  E06 II  T11F1.8 CTGCAAACTAACATTTTTCGGTC CCTTCTGCTCTGAAGAAATCAAA II-2J12
38  E07 II  K08A2.a GTCTGTGCACAACGTTTTTGTAA AACGATGACTAGACGAATCGAAA II-2J14
38  E08 II  K08A2.b TAAAACTTTCCCCGGTTACTCTC GAGCTTTGTCAAAAATTCCAAAA II-2J16
38  E09 II  K08A2.c GGAAGGCTTATCAGGAATCAAAT CACCATAAACATTTTTACGCCAT II-2J18
38  E10 II  K08A2.d CGCTGCTTCTAAAAACCTGTAAA CAGCTGAAATTGAATGGGATAAG II-2J20
38  E11 II  K08A2.e TAAAGTTTGCGACTTTTAGTCCG CAAATCAATAATCATTCGGGAAA II-2J22
38  E12 II  K08A2.f CCTACCCTACCTAAATTTGCGAT TCAAGTTACAAAACCCATACGCT II-2J24
38  F02 II  C41H7.1 CACAGTTTGTCTTTTCAGAGCCT AGGTCAAGAGTGGGAAGAAAGAC II-2L04
38  F03 II  C41H7.2 TTATGTTTCCTACAGAAGGGGCT ACATCAAAATCCTCCATGTTGAC II-2L06
38  F04 II  C41H7.3 CTCCAGCGAATCTTCCTCAC    GTCTGAGTCGACGAACGACA    II-2L08
38  F05 II  C41H7.4 CGGAAAACTGGGTTCTTCAA    CTGATAATCGGCAGACGGAT    II-2L10
38  F06 II  C41H7.5 AAGGTTGTGCTCTCGCTGAT    AGGTAGTGAGACCGCGTGAT    II-2L12
38  F07 II  C41H7.6 AACGGCAGATCCATTCTCAC    TGAAGTAGTGAGACCGCGTG    II-2L14
38  F08 II  C41H7.7 CCAATTTTCAGCCCATTTGT    TGGTATTGAAGGTTTTCGGC    II-2L16
38  F09 II  B0454.1 AGAATCTGCCAAAATGTCAAAGA TTCGGAAAGTTGGAGAAATATGA II-2L18
38  F10 II  B0454.2 TCGAGCTGAAAACACGTGAC    CACGTTCAGAAGAAGCACGA    II-2L20
38  F11 II  B0454.3 TTTTTGCTCCCTTTAATCACAGA CGACGGGATCATTGAAGTAATAA II-2L22
38  F12 II  B0454.4 CTCCTCATTTTTCCTGCCAA    ACCAGCATGAAGGGTGGTAG    II-2L24
38  G01 II  B0454.5 TTTTCATTTTCCGACACTGTTCT GGAAAAACGTGGCAATATTGTAG II-2N02
38  G02 II  B0454.6 TGCTCGAGGTTGTACCACTG    GTGGTGAGCTTCTTGGCTTC    II-2N04
38  G03 II  B0454.7 TACTCGGGCTTTTTGGATTG    CGGATGGTGGAAAAATTCTG    II-2N06
38  G04 II  B0454.8 CAACATTACCGCTTCAGGATTAC ACTTATGGAGTTGGAGACGATCA II-2N08
38  G05 II  B0454.9 GCTCACAAATCCATAGGCGT    CGGGACGTCCTACTACGAAA    II-2N10
38  G06 II  Y25C1A.1    GAAGACAGGATCAGTTGATGGTC TCAATGCCGGTATAACCAGATAC II-2N12
38  G07 II  Y25C1A.2    TATGGATTCTCATCGCTTCATTT TGATGAGAAGTTAATGGCTTGGT II-2N14
38  G09 II  Y25C1A.4    AAGCTCTTTCGGTGGAAATAATC TGGAATACAAAACCATCAACTCC II-2N18
38  G10 II  Y25C1A.5    CACAAAAACACATTTTATGGCAA GAAATCGTTGAAAAGATCACACC II-2N20
38  G11 II  Y25C1A.6    GTTGTCTGCTGCTATTACAGCCT TAAAACGGTCAGAATTCCAAAAA II-2N22
38  G12 II  Y25C1A.7a   CCAAAAATACGCGAAAATTGATA GTCATTCCAACCCATCGTAACTA II-2N24
38  H01 II  Y25C1A.8    TCCGACTTCTTTTTCCTCTCTTT CGATTTTCTCCAATTTTTGACAG II-2P02
38  H02 II  Y25C1A.9    ACTTAGGACCTCTTAGGACCCCT CACTCCTCAACTCACAGAAAACC II-2P04
38  H03 II  Y25C1A.10   ATGTGGGGTTACAGTACCCTTCT TTGCATTGTTCACTTTTGACATC II-2P06
38  H05 II  Y25C1A.12   CCTCCATTCTCCCTGTTAGAACT TTTTGATATACCTTGTGCAGGCT II-2P10
38  H06 II  Y25C1A.13   TTGCCTCACTCCAGAATACATTT ATTCTCGGTCATTTTTCGAATTT II-2P12
38  H07 II  T10D4.1 TATGACTTTGGTGCTTTCGTTTT ACTGAAGCCTGTAAGATACGCAG II-2P14
38  H08 II  T10D4.2 AACCCTTCTCATGCAACCAG    TAGGAATCGGTCCCAAACTG    II-2P16
38  H09 II  T10D4.3 TGCACTTAATTCTCTCCGTTTTC TTTTAGGCAGACGTCAATGATTT II-2P18
38  H10 II  T10D4.4 GTTGCTCACCTATATCCTTCACG ATGACAATCAGTAAAAGCCTGGA II-2P20
38  H11 II  T10D4.5 TTCTCCGCCGAATACTTCAC    GGCGCTATGATGAAAATCGT    II-2P22
38  H12 II  T10D4.6 TACCCGAAAGGATGAAGACG    CACTCATGTCCGACAGGCTA    II-2P24
39  A01 II  T10D4.7 CCTATTCTCCTAGCGGTTTTGAT AAACATAACCCCCAAAAGTGTCT II-3A01
39  A02 II  T10D4.8 CCACAAAATCAAACTTCAGATCC TTCGAAATTTGAAGCAAAAATGT II-3A03
39  A03 II  T10D4.9 TTAGTCCGACTTTTCAGCACATT TGACTTCCATCTTAGCCTACTCG II-3A05
39  A04 II  T10D4.10    TCTTGCTCAAGATTCCAAAAAGT TTGTGTACAGCTGCCAACTCTTA II-3A07
39  A05 II  T10D4.11    TCATATGTGGTCTGCGTCTAGTG ACCCAAGATTGGCTTACAAAAGT II-3A09
39  A06 II  Y27F2A.a    AGTCTTCTCTTGGATCTGAGCCT ATCATCCTTAAGAAGCACACCAA II-3A11
39  A07 II  Y27F2A.b    TGAAATTTTCCAATGGAGTTCAG CAGTCCGTTGTGGAACTTAAAAC II-3A13
39  A08 II  Y27F2A.c    CTTTGCACACGTTTTTAGATTGA AACTTGAATTTTCAGATGAAGCG II-3A15
39  A09 II  Y27F2A.d    GGTGTTTTCTTTCTCTTCCACCT TCATTGGGTGGAGTAATTTTGTC II-3A17
39  A10 II  Y27F2A.e    GCTCTTTTTGATCGAATGTGAAT AGGTGGAAGAGAAAGAAAACACC II-3A19
39  A11 II  Y27F2A.f    GCAACCAATAGCAATAATGAAGC TGTCATAGATGATGATGGAGTGC II-3A21
39  A12 II  Y27F2A.g    GTGTCTGGATTCGAAAGTTTGTC ATCAATTTGTGCTCTCCACTCAT II-3A23
39  B01 II  Y27F2A.h    TGGATATCACATTCGAATTACCC CGACAGTTTATTCACAAAAACCC II-3C01
39  B02 II  Y27F2A.i    TCTTGCTTGGTCTTCAAATCTTC ACTGTAATCGTGTAAGCTGCCAT II-3C03
39  B03 II  Y27F2A.j    CAAATGTCTGCCACAACGTATAA ATGAAGACAGGCAAGTACCAGAA II-3C05
39  B04 II  Y27F2A.k    CATACAACACAATCGCCAAACTA ATCATCCTTAAGAAGCACACCAA II-3C07
39  B05 II  ZC239.2 ATAATATCTCCCCAAGTCGGTGT CAAGAAATTTGGAAACAGTTTGG II-3C09
39  B06 II  ZC239.3 GCAACATGGCTAAATCTGAAAAC CACAAATTGGACCTGAAAAAGAG II-3C11
39  B07 II  ZC239.4 GAATGGCAATGTGGTTGTTAAAT CAAAAGTGGGAGCTTTTGTATTG II-3C13
39  B09 II  ZC239.6 CCACCGAAATCCCAGATAAA    AGCAGGGGAAAAGGTTGATT    II-3C17
39  B10 II  ZC239.7 TCCAGTTCCTCATTCCGTTC    ATTTCAGTCCCAAACCCTCC    II-3C19
39  B11 II  ZC239.8 GGAACCGCGATTATGGTAGA    GGCCATAGCGTCATTTCCTA    II-3C21
39  C01 II  ZC239.10    GAACTTTCAGTCTCACGCCTTTA CTCAAAAATTTCGTGATCTACCG II-3E01
39  C02 II  ZC239.11    TCCATCTGTTTGTCCTTATCCAC CAAAAACCAGTGAATTTGCTACC II-3E03
39  C03 II  ZC239.12    CTGCAGATTGTGGAGCAAAA    TGCCGGTTTTAATCTTTTCG    II-3E05
39  C05 II  ZC239.14    GGAATACTTCTCAATGAACGCAC AACAACAATTTGGTAAGGCTGAA II-3E09
39  C06 II  ZC239.15    AAATACTCATCAAACTCCCCGAT TCGAAAATGAGTGAAACTGTGAA II-3E11
39  C07 II  ZC239.16    TTTCGAAGAGTTTTCTAGGGGAG TTATTAAACTAGACGTTGGCGGA II-3E13
39  C08 II  ZC239.17    TTCGGGTCTGTTCACATTTCTAT TTCGACTGAGGTATTGCATTTTT II-3E15
39  C09 II  ZC239.18    TAAAAACGAATGGCATTAGCAGT TTTTCCAGTAGTCCCAATCTCAA II-3E17
39  C10 II  C17F4.1 TGGTGGAGCAAATGTAAGAGTTT AATAGTACGTCCCATAGACGCAA II-3E19
39  C11 II  C17F4.2 ATAATCGATAAGGAAAAGCCGAG TTATTTCTCTGCGGAAACTGAAG II-3E21
39  C12 II  C17F4.3 ACGTGTTCCCCCGTGTATTA    GGAAAGCTTCTGCAAACGTC    II-3E23
39  D01 II  C17F4.4 AATTCCGGAAATTCTCTTTTGAC TCCTGCTGTCATTAAATTTTCGT II-3G01
39  D02 II  C17F4.5 CTCGTCGAGCAATGTTTCAA    CCTCCCAATGGAGACAGGTA    II-3G03
39  D03 II  C17F4.6 CAACAGTCGCGGATTAGGAT    AAAACGTCTGGAACGTGACC    II-3G05
39  D04 II  F02E11.1    ACATCGGTACCCAGATGCTC    TGACACGAATCTTCAAAGCG    II-3G07
39  D05 II  F02E11.2    CTATTCCCGAAAATAAACGGAAC ATCACAATGCACATAACAGCAAA II-3G09
39  D07 II  F02E11.4    AAGTATGGCTCCAAGTCCAAAAT TCGATTAGAAGGAGGTGGTTACA II-3G13
39  D08 II  F02E11.5    TAGGCAAAACGTCGTATTCAGTT GTCAGTGTCTATGGGCAATTCTC II-3G15
39  D10 II  F39E9.2 GAAAGTTCCCCTTCGAGGAC    CGTTTTCGTAAAGACGGGAA    II-3G19
39  D11 II  F39E9.3 CCGTTCCGTTATACCCATTG    AAGCAACCAATGACCAGGAG    II-3G21
39  D12 II  F39E9.4 TATGAGAAATGCTCGTTGCG    CTCCTCCGTATACCCGATCA    II-3G23
39  E01 II  F39E9.5 TACAGATTTAATTGAACACCCCG CGAAGCTGAATATTTCCTGAGAA II-3I01
39  E02 II  F39E9.6 TCTAAAATAAAGATGACCGGCAA GCATGGAAAGAAAAGATGATGTC II-3I03
39  E03 II  F39E9.7 GAAGAGATAGTGGAGAACGCAGA TGAATAGTTTCTGTTGCCCAGTT II-3I05
39  E04 II  F14D2.1 GGCATCAAATGGTTGGAGTT    GGAAGCATGAGACGAAGAGC    II-3I07
39  E05 II  F14D2.2 TTTTACTCACTTCAAATGTGCCA GAAACCATCCACCCTAACTAACC II-3I09
39  E06 II  F14D2.3 CTGAATGCCGAGTATAATTTTGG TGGCACATTTGAAGTGAGTAAAA II-3I11
39  E07 II  F14D2.4 GTCACCGGCAAAGAATTTGT    TGTGATCCCGTTTGAGCATA    II-3I13
39  E08 II  F14D2.5 CAATGTCCTCCTATAACATCCCA AAACTGTTACCTTTTGTGGAGCA II-3I15
39  E09 II  F14D2.6 GGGAATTTGGATGATTGTGG    TCGTAGTGGTTTCAGGCACA    II-3I17
39  E10 II  F14D2.7 CGTAAAGGTGCCCAATTGTT    CAAGGAGTTGAAGACTCGGC    II-3I19
39  E11 II  F14D2.8 CGCCGTGGAACTCCTTAATA    AATTTCAACCAAATCGCTCG    II-3I21
39  E12 II  F14D2.9 ACTCTTCTTGGAACCGCTCA    AAATGCATGGTCTTTCCCAG    II-3I23
39  F01 II  F14D2.11    GTCGAATTGTTGCTGATGTTGTA GTCATTCTTCACTCACGGCTAGT II-3K01
39  F02 II  Y49F6C.1    ATTCCGCTAAAAAGGAATTTGAG AACATAATCCCAGTGTCTGTGCT II-3K03
39  F03 II  Y49F6C.2    CTCAACAAGGAGAAATAGGGGAT TTCAAACGATGTTTCACATCAAG II-3K05
39  F04 II  Y49F6C.3    CCCAGAATGGTAAAGGAAATAGG CAAGCCTTGAAAATGAAACAAAC II-3K07
39  F05 II  Y49F6C.4    CTGGGTTGCAATAGTTTACAAGG ATTGCTGACTTGATGTCTTGGAT II-3K09
39  F06 II  Y49F6C.5    CGAAATGGTTCGTTTTTGATAAG CAGCTTGAACAAGTTCTTATGGG II-3K11
39  F08 II  Y49F6C.7    AGCGGTTTTAGGAAGTTATTTGG CTTTTGCAACTGACCAGATTTTC II-3K15
39  F10 II  T06D4.1 TCAAAATCCCTGCTCTTCGT    CATCTTGTTCCGGTCCTTGT    II-3K19
39  F11 II  T06D4.2 TGAATTGGAGGCAATGACAA    GACAATGTGCGCTTCAGAAA    II-3K21
39  F12 II  T06D4.3 GATAACCATCCCAATGGTCG    AGTCGAGAAATTGGACGTGG    II-3K23
39  G01 II  T06D4.4 GTGACTGCATCAATGAAATGAAA TATGTGAATCTCCACAGTGCATC II-3M01
39  G02 II  T06D4.5 TTGCCATAAGATCACTTTTTCGT CTGCGCATTTTTCATTAGATACC II-3M03
39  G03 II  F18A12.1    GCTTTTTCAAATCCGTCCAA    TCCCGTAAAGGGTGTCTTTG    II-3M05
39  G05 II  F18A12.3    TGTGAATCCCCGGATTGTAT    AAAATATCGCGGGATGACTG    II-3M09
39  G06 II  F18A12.4    CTAGGCCTTGGGTAGCTGTG    CTTGGGTGAATCATCTCCGT    II-3M11
39  G07 II  F18A12.5    ATTGCCTACCTACCACACGC    TTCAGGATTTTTGCAAAGGG    II-3M13
39  G09 II  F18A12.7    CAATGGATAAAATGGGTCCG    AGCGAGTATGAGCCTTTCCA    II-3M17
39  G10 II  F18A12.8    ATTCACTGCCTTGGGAAATG    CCGTAACAACACCCGTCTCT    II-3M19
39  G11 II  C16C8.2 CTGCTACGAAGGAAGGATGC    TAAGAATCTGCGGAATTGGG    II-3M21
39  G12 II  C16C8.3 TCAAATCAAATCGAAAAGGCTAA ACAAGAAGCATCCCTCTCTCTCT II-3M23
39  H01 II  C16C8.4 ACGCAAGTACCGTAATCCAGTAA TATTTTTAGACTTGCCCACGAAA II-3O01
39  H02 II  C16C8.5 ACCCGAAAAATGTTTTCAAAGTT AAACTGATTTTCAATGCCAGAAA II-3O03
39  H03 II  C16C8.6 CATCAGCTTCAAGTGGACGA    CGTCTTGGTCATTCTCAGCA    II-3O05
39  H04 II  C16C8.7 TATCCCATAAAAGTTGGCATTTG ACAGAACTTGAATCCAATCCAGA II-3O07
39  H05 II  C16C8.8 TATGCCTGCCTGTAAGTAGCATT ACCATAGAGTCATTTGCAGCATT II-3O09
39  H06 II  C16C8.9 AAACGTTCTGAACTTGATGGAAA TTTTGATCTCAATCCATACACCC II-3O11
39  H07 II  C16C8.10    AAGGTGTCGTCAGAATGCTCTAC TAATTCGATTTGCTCACACCTTT II-3O13
39  H08 II  C16C8.11    CAAACACGTTGCGTACTTCATAG TTTACAAGGTCGCAATTTCAGAT II-3O15
39  H09 II  C16C8.12    TGAGAATTTCCAATTATTTTGCG TAGAATTTAACGGGAGAAAAGGC II-3O17
39  H10 II  C16C8.13    ATTTCCAATTATTTTTCGGGTGT TTTACATAATGGCAGATGGGAAC II-3O19
39  H11 II  C16C8.14    TTTTCCAATGCTTTTTCAAGTGT AAAGAATACGCAAATTGTTGAGC II-3O21
39  H12 II  C16C8.15    GATTTTTCGAGTTTCTTTTCCGT GAGCTCATTCGGTGTAATTTTTG II-3O23
40  A03 II  C16C8.18    GGAAATGAGTTTGAGTTGGTGAG CAAGCATGTTATCCTACCCTTTG II-3A06
40  A04 II  Y49F6B.a    CGTAAGATTCTGCATTCTGATCC AAAATTTTCGGAGAGTGGAAAAG II-3A08
40  A05 II  Y49F6B.b    CTGTATCTCTGCGGTGGTTAGAG TTTTCTTCTCAGAAAACCAAACG II-3A10
40  A06 II  Y49F6B.c    TGAGCTGAAAATTATGGGGTAGA CTGCTAAACAACAAGAAGCCTGT II-3A12
40  A08 II  Y49F6B.e    GCCATTTCTCGTGTATCATTGTT AAAATATGCGAAAAATCCGAAAT II-3A16
40  A09 II  Y49F6B.f    AGCAAACACACAACTTTTACCGT TGAACCCTTTTCGTCAAAAGTAA II-3A18
40  A10 II  Y49F6B.g    TTATGCCTTGAACGGTTTTTAGA CATCACCAAGGCTATCAACTTTC II-3A20
40  A11 II  Y49F6B.h    AACTCTGCCATTTCGATTTATGA GAACATGACCAGAAGCTTTTCAG II-3A22
40  B01 II  Y49F6B.l    CACTGTTTTGACATTTTCACCAA AGTTCGAATTCTTTCTCTTCCGT II-3C02
40  B02 II  Y49F6B.m    TTTTCCTTTAGTCTGTCAGAGCG TTATTTTCAAACCGAATTTTCCA II-3C04
40  B03 II  Y49F6B.n    ATTCAAGCGAACAATCTCATCAT ATCGTCTTTTCGTCTTTCTCTGA II-3C06
40  B04 II  Y49F6B.o    AAATTTTCCCAAAAATTCCAAAA CGTTGCAAGACATTAATTGTGAA II-3C08
40  B05 II  Y49F6B.p    GGTGCAAATAAGCGACTGATAAC GAAAAATTGTCACATAAGCTCCG II-3C10
40  B06 II  Y49F6B.q    CTCAAAATGTCTGCGCTCTACTT CAAGAAAATTCCAACAAAAACCA II-3C12
40  B07 II  Y49F6B.r    CAATTTTCCCACTCAAATACCAA GTCCTCTTCGATTCCGATAAGTT II-3C14
40  B08 II  W09G10.1    CTTTGTTCTTCAAGACACCGAGT CAAGACCTCTTGCTAGATGCAGT II-3C16
40  B09 II  W09G10.2    GCTCCTAAATTCAGAAATGCTCA TGGATTAGTGTCCTGATCGTCTT II-3C18
40  B10 II  W09G10.3    TCAAAAAGTTGTCAACAGACGAA AACGAGATCAGAGATATCGGGTT II-3C20
40  B11 II  W09G10.4    GTCGAGTCAATTCGTCACTTTTC TTTTCCAGATTATCGCGTTTTTA II-3C22
40  B12 II  W09G10.5    CACTTAAAACGTCGCAATTTTTC AAAAATTCCCACAGAAAATGGTT II-3C24
40  C01 II  W09G10.6    TTAAGCTTTCTTTCCACAAACGA TCCCAGCTAGAGCTAAATCAGAA II-3E02
40  C02 II  W10G11.1    TTTGATCTATCCCTTTCTGACCA CGATGACGTTCACCAATTTATTT II-3E04
40  C03 II  W10G11.3    TTTATGGGAGGATGCTAGTTTGA CAATAGGCAGGAGTGTTTACGTT II-3E06
40  C04 II  W10G11.4    CTCTTCCTCTACGATCTTGGTGA TCAAACTAGCATCCTCCCATAAA II-3E08
40  C06 II  W10G11.6    AGAAGCTGAAAGAGCTTGCG    CTCGTTTTCCACAGGCAAAT    II-3E12
40  C07 II  W10G11.7    CCACGGTTTCTCCTGTCAAT    ACGATCTTCAAGTGATGGGG    II-3E14
40  C09 II  W10G11.9    CAAAGGCCATAGTGCAGACA    TGAAAACCATGAAAGTGCCA    II-3E18
40  C10 II  W10G11.10   GGGATACTTCCACCGGATTT    CAATACTACCTGCCGGGAAA    II-3E20
40  C11 II  W10G11.11   AGGAGGTAATGGGCTGGAGT    AGAGCGGATAGACGCCAGTA    II-3E22
40  C12 II  W10G11.12   CCAAATCTCAGTTCTTCGGTATG ACGACTTTCCCTTAAAAATGCTC II-3E24
40  D01 II  W10G11.13   AATCATTTAGCAGCCTTCTTTCC TCAGAAGAGCTGAACTTTTGGAC II-3G02
40  D02 II  W10G11.14   TTTATCAGCCTTCTTTCCACAAA AACGATAGAAAATTCTCATGGCA II-3G04
40  D03 II  W10G11.15   ATGTGCTGAAATTTAGGGTGAAA TTGGGCAAAACTGCACTACTTAT II-3G06
40  D04 II  W10G11.16   ATGGGTAAAAGACACGGCAG    CTCGACTGGTCAACCCGTAT    II-3G08
40  D05 II  W10G11.17   GCTGTTGCCTCTACCTCCAG    ACGAGCTGAAAGAAACCGAA    II-3G10
40  D06 II  W10G11.19   GTTTTCAGCGGGTTTTGTGT    GATTCCTTCGAACACTGGGA    II-3G12
40  D09 II  Y49F6A.c    CCAATTATCAGGTTGTCCCATAA TCGAGACGTTAGATTGCTTCTTC II-3G18
40  D10 II  Y49F6A.d    AATTCAATAGTGGGACAAGGGAT GTCACATAAATGAGAAGAACGCC II-3G20
40  D11 II  Y49F6A.e    CCTTATCAATTCTACATGCCGAG GGTCTCTTTGTTTTTACGCATTG II-3G22
40  D12 II  Y49F6A.f    GTTGCCAAGATTGGTAGAGATTG TCACAATCAAAGCTGTCTGAGAA II-3G24
40  E01 II  F40E12.1    TAAGTGCCTTATCCGATTCAAAA TTGGTGATCCGTAAAATTATTGG II-3I02
40  E02 II  F40E12.2    CCAGGAAGTCAACCGAATGT    GTGCCGTATCCTTCTCCAAA    II-3I04
40  E03 II  M151.1  CTATGCTCCTCCGGGATGTA    CAAGGTGCTACGCAAATCAA    II-3I06
40  E04 II  M151.2  GTACCCGTGGGAATTTGAGA    GATGCTTGGTGCTTGACAGA    II-3I08
40  E05 II  M151.3  CACGGCATACCTACCGACTT    TACATCCACTCCGTGAGCAG    II-3I10
40  E06 II  M151.4  TCAGACTCCCTCCCTCTCAA    GGTGTTATGCTCGTGGAGGT    II-3I12
40  E07 II  M151.5  GAAAAATGTGTCCCGCAAGT    GCACTTCGAAAGACTCTGGC    II-3I14
40  E08 II  M151.6  AGCTTGTCAGGTTCTGAAGTCAC AGAAGGACATCAATGCACTCAAT II-3I16
40  E09 II  F19B10.1    ACCATGAACCCACTCGAAAG    ATCCGGGAAGTAGTCCGAGT    II-3I18
40  E10 II  F19B10.2    CCCATCTGCCGTTTAGTCAT    CAATCCACGTTGAGCATTTG    II-3I20
40  E11 II  F19B10.3    CGACAGGTTTGTTAAGTGGTTTC AAAAATTGGTTGGAAATCTGGTT II-3I22
40  E12 II  F19B10.4    ATGAAGACGTCCAAAAACGG    CAGCGGGATTACTCAGCTTC    II-3I24
40  F01 II  F19B10.5    CAAAATCCTGAAGCTCAGCC    TTGGCACCATTGTTTTCGTA    II-3K02
40  F02 II  F19B10.6    CGAAGTAAGAATAAGAAAGCGCA TCCATCTTACCAGTTCTCCAAAA II-3K04
40  F03 II  F19B10.7    AAGCCTTGCCTACGCCTTAT    AATTTTAGGCGTCCGCTTTT    II-3K06
40  F04 II  F19B10.8    TGAAAAACAACATTATGCACCTG TATCACTACCTCTTCCAGCTTGC II-3K08
40  F05 II  F19B10.9    TGCTTGCGATCAGTTCTACAATA TCCATCTTCAACCTATTCTTCCA II-3K10
40  F06 II  F19B10.10   GGCTCTGGATCTTTCACTGC    AAAGCCGTTTGTCATGGTTC    II-3K12
40  F07 II  F19B10.11   TGTGCTCGAAAAACTGAACG    GATCTGCCAATTTTGCCACT    II-3K14
40  F09 II  F40H7.2 ATTGGGTCTGGCACGTTAAG    CGGAGACACTGGGGATATTG    II-3K18
40  F11 II  F40H7.4 CTTCTTGATCTTGCTCTCGTGAT TGAAAGGGCAAATTAGTCCAGTA II-3K22
40  F12 II  F40H7.5 CAATATTCACGGAGTAGGATTCG AATCAGAACAATTACAGGCCTCA II-3K24
40  G03 II  F40H7.9 GGGTGACCGTGGACTTTTTA    TATCCCATGAGGTGATGCAA    II-3M06
40  G04 II  F40H7.10    CATATACCTACCCATCCGTCAAA TTCAGGCCTCAATGCTAGTTAAG II-3M08
40  G06 II  C46E10.2    ATTATCATGTTTCTTTGCGTGCT CTCGTAATATGTTTTGCGGGTAG II-3M12
40  G07 II  C46E10.3    TTCTGAAGCTAGCGGAGAGC    AGCGACGAAATTTGAAATGG    II-3M14
40  G08 II  C46E10.4    CTCACCGACAAATGACCCTT    TTGACCCCGGTTTTGAAATA    II-3M16
40  G09 II  C46E10.5    TGGGGACCTGGATAGTCTTG    AGGACGGGTGAGTCCTTCTT    II-3M18
40  G10 II  C46E10.6    GCTTCCATGGGTGTCTTGAT    AACCCCATACTGACGAGCAC    II-3M20
40  G11 II  C46E10.7    CTTCCCGGGTAAGTGTCGTA    CTTCTTGGAAAGGAGTTGCG    II-3M22
40  G12 II  C46E10.8    AAACTTCTGGACACGAATGAAAA CTTTCTCTGCGTCTCTCTTTCTG II-3M24
40  H01 II  C46E10.9    TTTCACATTTGAATTGGCGA    AAATGTGGACTTGGGCTGTC    II-3O02
40  H02 II  C46E10.10   AACTCGTGTGCTAGATTGTGGAT CTGTCGGAGTTTTTAGTTGGTTG II-3O04
40  H04 II  F12E12.b    AACCTTCCAGATTTTTATCGAGC TGGAGACTGTGATCCGTTATTTT II-3O08
40  H05 II  F12E12.c    TAATCATGGCTGCTTCAAAATCT AATACGCTTGGTGCAGTCACTAT II-3O10
40  H09 II  F12E12.g    TGAAAGTGTGGAAGACTTTGTGA CATAGGTTGAATTGATCATCCGT II-3O18
40  H10 II  F12E12.h    CTGACTACCTCCTCCTTCCAAAT ACAGGGGTAAGTAGAATGGGAAA II-3O20
40  H11 II  F12E12.i    TCCTTACACCCTTACACCCTTTT TTCCATCGCAAGTTAGTCAAGAT II-3O22
40  H12 II  T24E12.1    CCGGAGCAACAATTACCACT    GGGCCACTCTGGATTCATAA    II-3O24
41  A01 II  T24E12.2    CACCTGTTGCAGGAGGGTAT    CTTTTCCTTCTTCACTGCCG    II-3B01
41  A02 II  T24E12.3    TTGTTTGTTTTAGCAGCCCC    AGAGTTGGGTGGGAGGAAGT    II-3B03
41  A03 II  T24E12.4    AACGCCTACTCACCTGCCTA    GCCGATCATTTTGTAGGGAA    II-3B05
41  A05 II  T24E12.6    GACGTCTGAAAGGAGCAAGC    TCCCAAACTTAGATCCGACG    II-3B09
41  A06 II  T24E12.8    TTATTTGCAGCGTCAACTGC    TTTTTACAGCTCATGCGACG    II-3B11
41  A07 II  T24E12.9    GGTTGCTGGTGCTTCTCTTC    ATGCCAAATTGCTGGAAATC    II-3B13
41  A08 II  T24E12.10   ATTTCACAGTTGGGAGCTGG    TAGACTGGATCACGCTGTCG    II-3B15
41  A09 II  Y8A9A.1 AGCAGCTGAAAATTCATTTCTTG CAAACGCCCTTTCTAAATCTTTT II-3B17
41  A10 II  Y8A9A.2 ACATGCTGTCCTCTTGATGGTAT GCGTATGGAGTAGTGTAGTTGGG II-3B19
41  A11 II  Y8A9A.3 ATGCCATTGAAGAAGAAGATCAA TTTCAATTGCTGAACCTTCATTT II-3B21
41  A12 II  Y8A9A.4 CTCTACGCTACCCCAGATCTTTT AGATCACCTCAATCTCATCTGGA II-3B23
41  B01 II  Y8A9A.5 GTTTTCTGGGTTGCAGATAGTGT GGATTATCGATTTTCTACGGGTC II-3D01
41  B02 II  Y8A9A.6 TTCAAAATGCCAAGTTTTTGACT TACGAATCTCAGTGGCAATTTTT II-3D03
41  B03 II  F54D10.1    GTAGGAACTGTTCTCCTCCGTTT TTAGGCGTTTCAGGACAATTTTA II-3D05
41  B04 II  F54D10.2    CTACAATCGGAAGAACTGGATTG ATAACTTTTGCACGAGAAACCAA II-3D07
41  B05 II  F54D10.3    GGTGTCCCATGATCTACATGAAT GATATTGCTCGAAAATTCGTTTG II-3D09
41  B06 II  F54D10.4    GCAGCTCAAAATAGGCTCAAATA AAGAAGAGAAAGAAGACGGGTGT II-3D11
41  B07 II  F54D10.5    TACACAATTGGTTCGCCAGA    TTAGTCAAAGTGGCAGCGTG    II-3D13
41  B08 II  F54D10.6    GCATTTTTCCAATGCTCCAT    TCCAAATAATGCCCGAAAAA    II-3D15
41  B09 II  F54D10.7    CCATGCGAAGTTTTTGGAAT    TTTGCGATCTGAAACTGCTG    II-3D17
41  B10 II  F54D10.8    TCAAAAGGTGCCATGCATAA    TTTCATTTTGCTGCTGCTTG    II-3D19
41  B11 II  F54D10.9    TCCCAGCGAATCTCCTCTTA    CCCAGCTGGATCTGTTTCAT    II-3D21
41  B12 II  C17A2.1 CTGAAACAACGAGTCCCCAT    GCAGATGAAACTGCCACGTA    II-3D23
41  C01 II  C17A2.2 TTGAATTGTCCATGTGCGTT    AAATTCGATCGTTTTGTGCC    II-3F01
41  C02 II  C17A2.3 TTCTAAAATTCGGCACCTGG    ATCGGTTCAACTCCTGATCG    II-3F03
41  C03 II  C17A2.4 TGAGTCGGTTTTTGGAGCTT    AACTTCAACGGAACCCAGTG    II-3F05
41  C04 II  C17A2.5 TGCAAACGATAGACTTGAACTGA TGTCATTGCTATCAACAAGGATG II-3F07
41  C05 II  C17A2.6 AGTAGCTTCCGTGCAATCGT    TTGGTCCGCCTATTTTTCTG    II-3F09
41  C06 II  C17A2.7 AAAGACGCATGTGCTTTCCT    AAATTTCACAAAAATGCGGC    II-3F11
41  C07 II  C17A2.8 CCCGAGTCGAATTGCTATGT    CAAATGCAGGTCCATGTCTG    II-3F13
41  C08 II  C49D10.1    AAAAATGGACTCGCGAAATG    TGAGAACCCGATTTTTGGAG    II-3F15
41  C09 II  C49D10.2    GAAGTTGGGATGAACCCTGA    TTGTAGCTTGCGTGGAACTG    II-3F17
41  C10 II  C49D10.3    GAATGTGCACTTTTGGAGCA    CTGCCTGCCTATCCCAATTA    II-3F19
41  C11 II  C49D10.4    TGAGCATGGACTATGTGAATTTG TTATTTGAAGACGGAAAACTCCA II-3F21
41  D01 II  C49D10.6    GTCTGGAAGCAGGAATGAGC    AGGGTACTCAATGCCACGAG    II-3H01
41  D03 II  C49D10.8    CGCATTTCCTCCACATTCTT    TCTTCACTCACACCTGGTCG    II-3H05
41  D04 II  C49D10.9    TCCATGTCGCTCAGTTTCAG    CAATTGTTTGCACTGCCTGT    II-3H07
41  D05 II  C49D10.10   TGCTGCTTCTGTGCAGTTCT    CTCCACGATTGCTCTCTTCC    II-3H09
41  D06 II  F53C3.1 TTTCAGGGATCCGAAATCAG    GCATCTCCCAGTCGTATGGT    II-3H11
41  D07 II  F53C3.2 AGACGCGCGGTTTTTAGTTA    CGGAAGCTTGGAGATTTCAG    II-3H13
41  D08 II  F53C3.3 TTAAATGAGTCGCCTTATCTGGA ACCAGTACAACATTCCATTCCAC II-3H15
41  D09 II  F53C3.4 AGTAAATGTCTGGATGCAAGAGC CGATTAAACGATCAAGTGAGAGG II-3H17
41  D10 II  F53C3.5 CGAATTCTTTCACATTTAGTGGC CGTTTGAAAGTTCAAGTGAGAGG II-3H19
41  D11 II  F53C3.6 CCCTCTTTCCCATCTCTAACTGT GAATTACCATTTTGCCGTTACAA II-3H21
41  E01 II  F53C3.8 TTTGCAATTGGAGAACACTTTTT ATCCCCTAAGCAAGACTTACCTG II-3J01
41  E02 II  F53C3.9 ATCTGGCCCCCTTCTCTTTA    AGTCAAAGAGAACCAGCGGA    II-3J03
41  E03 II  F53C3.10    CTCTCTCTCTCTCCTTTCCCATC GAAACGCAGGTGAATGAGTAGAC II-3J05
41  E04 II  F53C3.11    TATTCATCAGCTGCACTGGC    AACAGATCAAACAGGCGGTC    II-3J07
41  E05 II  F53C3.12    ACGTAGTTGTACGGCTTCATGTT CCTTGTTCCTATACGCCTACCTT II-3J09
41  E06 II  F53C3.13    GGTTTTTCTTCAAATTTCGCTTT TCGTGGTTTCTACTGTGATGATG II-3J11
41  E07 II  Y14H12B.1   TTTTTGAGTTTTCCCGAATTTTT AGGGGCAATTTGAAAATATGAAT II-3J13
41  E08 II  Y14H12B.2   ATTGTTCGGAGTATTCGCATAAA GAAGAAAAGTGATGAAAAAGCGA II-3J15
41  E09 II  T20H12.1    GGAGTACCGGAATCTGAGACTTT AAACTAACCTCTCATCGAGGTCC II-3J17
41  E10 II  T20H12.2    CTCCTGTAAGACGGCAAGAGATA CACCATAAACATTTTTACGCCAT II-3J19
41  E11 II  K10G6.1 TAGATATTTAGGTGGTGGAGCGA AGGATGACAGAAAATGAACAGGA II-3J21
41  E12 II  K10G6.2 ACTGTACTCGGAGGGGACCT    GATCCGGGTTTTGTCTGAAA    II-3J23
41  F01 II  K10G6.3 TGCAAAAAGACGTATGCGAG    TTTTGCATCCAGAGCAAGTG    II-3L01
41  F02 II  K10G6.4 TCTCGACTTTCTGCCGATCT    ATTGTTGGAGGAAATCGCTG    II-3L03
41  F03 II  K07D4.2 GAAGTTGGGTAATGTGAATGAGG CAACAAGAAATAAGAAGCCATCG II-3L05
41  F04 II  K07D4.3 GTTCTTCTCGTCCTCCAACG    TCAGAGAGGAATGGAGCGAT    II-3L07
41  F05 II  K07D4.4 GTTTTAATTTTCACCAGCTCACG CGTATCTCTGTTCTCAATGGTCC II-3L09
41  F06 II  K07D4.5 GGCTAGTTTTTGAATTGTCGATG GGGTTTTCGGTAAATTAGTTTGG II-3L11
41  F07 II  K07D4.6 ACACGCTAGTTGAATCTCCTCAG ACCCTACAACATGAGCTTCACAT II-3L13
41  F08 II  K07D4.7 GCTTAGAATTCAGCGTTGGC    AGTAGCCATGAAAGCGCCTA    II-3L15
41  F09 II  K07D4.8 TGAGAGAAATTGAGAGTAAGGCG TTTACCGATTTGCCGTAAAAGTA II-3L17
41  F10 II  Y54C5B.1    TTGACAAGTTCACGCTACGC    TCCAACCCAGTGGTTAAAGC    II-3L19
41  F11 II  W06A11.1    GTAGGGGAGAGAAGTTTTTGGAA GATTGTGTCTGGAATTTTTGGAA II-3L21
41  F12 II  W06A11.2    ATTTTTCATTGCGTCCCAAG    TGCAGAAGCTTCCCAAATCT    II-3L23
41  G03 II  R11F4.1 CAAGCTCAAATGGCTCTTCC    TCGTCCAAACTGATCTGCTG    II-3N05
41  G04 II  R11F4.2 TGAACGATGAGGTAGGGGAG    GGAATCCAAGAAATCAGGCA    II-3N07
41  G05 II  R11F4.3 AGTTCCGATCATGAACCTGC    CTGCATCAATCTCCGACAAA    II-3N09
41  G06 II  R11F4.4 GATTTGCATAACCTGTGGAGAAG ACGAATCATCTTCATCCAGAAAA II-3N11
41  G07 II  T08H4.1 GCAACCTGGACAGCTAGGTC    GCCCTGAGAGTCAATGGAAG    II-3N13
41  G08 II  T08H4.2 GCCGGTGATAACTACTTTGACAC AAAAGCACAGTTTTAAGGGTTCC II-3N15
41  G10 II  Y54C5A.1    TGTGACGTTTTGCATTCTCATAC TGATTTATGATTTGAGGATTGGG II-3N19
41  G11 II  F56D3.1 AGACGGTGGACAAATCGAAG    TGTCCGTTCAGTGGGTTGTA    II-3N21
41  G12 II  F56D3.2 TTCCTTACGAAGAACATCCAAAA GAAGTAGGCATGTAGGCTAGCAA II-3N23
41  H01 II  R03H10.1    GCGTCTCTGGAAACATAAACATC GATTGACATGAAAAGTAGGCAGG II-3P01
41  H03 II  R03H10.3    ACCCCCATCTCTTATGTGATTTT GACACAACTATTGCTCCATCACA II-3P05
41  H04 II  R03H10.4    CAGGAGAAATTGTAGACGAATGG TTGGCTCAATTTATTGTGAAGGT II-3P07
41  H05 II  R03H10.5    ACAATTTTGCTTCTTTTCCCTTC GTTTTAGCAATTTCCTCACATGC II-3P09
41  H06 II  R03H10.6    GCCTCGAGCATTGTATCCAT    AGCGACGACTATCCCAGCTA    II-3P11
41  H07 II  R03H10.7    TGACTCCCTTGAAAGCAACC    AACCCTGCTGGTTGTAATCG    II-3P13
41  H08 II  R03H10.8    AGGAAGTCAGAAAAGTTGGGTTC CCACATCAATCAAGACATTCTCA II-3P15
41  H09 II  R03H10.9    TTGGAAGATTTTGATAGCTCCTG TGCCAGATTCGTCTACAATTTCT II-3P17
41  H11 II  F31D5.2 GACTTGATAACTGCGAAATGGTC TTTTCCGAGTATTCTGACACGTT II-3P21
41  H12 II  F31D5.3 ATGCATGAAAATGGCACGTA    GCTGCTCCACTATGGCTCTC    II-3P23
42  A01 II  F31D5.4 CTCTTCGACCAGCTTCGTTC    GACGCTGCTCTAAACGATCC    II-3B02
42  A02 II  F31D5.5 ACTCACTTTAAATTCCCCACCAT ACGTGTAATCAAATTTCGATGCT II-3B04
42  A03 II  F31D5.6 CAGCTCTCAAAAATATGTCCACC GAGTAGCTTCAATGCCTCTTCAA II-3B06
42  A04 II  C16A11.1    TAACGATTTTGCAAACAACACTG AACTCAATTTCCGTAATACCCGT II-3B08
42  A05 II  C16A11.2    GTCGTGGAGTTTTAGAGGGATTT CTGAGCTGCTTGTGAGTATCCTT II-3B10
42  A06 II  C16A11.3    CGTGATTTTCCATTTTATTTCCA ACCTTATCCATAGCTTCCAGTCC II-3B12
42  A07 II  C16A11.4    TTTCTGCCTTGACAAACGTG    TTGGTAAGGCGGATAACTCG    II-3B14
42  A08 II  C16A11.5    TTCATTCAACATCCGATCCA    CCTCCACGTGTTTCTCCAAT    II-3B16
42  A09 II  C16A11.6    AAGGTTCGTGAATCCTGTGC    CACAATGCCCATCTCTTGTG    II-3B18
42  A10 II  C16A11.7    GTTCTTCATTGTCGACTGGTGAT ACGCCGATCAATCAATACTTCTA II-3B20
42  A11 II  C16A11.8    CCGACCACAAACATATCCATAAT GAAGCAGATAAAAAGCTGCAGAA II-3B22
42  A12 II  C01F1.1 CGGAATTTGGCTTTTCTGAG    CTCCGTCCGATGACTCGTAT    II-3B24
42  B01 II  C01F1.2 TGAATTTCCGAAAACAAGCC    GGAGCAAAAATGGTGAGGAA    II-3D02
42  B02 II  C01F1.3 TACAGACGAGGTTTACGGGG    CTCCAATCGGGTGTTCCTTA    II-3D04
42  B03 II  C01F1.4 CCGTGAAGAAACTTGATAGGTTG AAGTGTGCTCCCAAAAATAACAA II-3D06
42  B04 II  C01F1.5 GCAGCTAGAGAGAACTCAAGCAC TGTAGGCACAGGAAGGATATGTT II-3D08
42  B05 II  C01F1.6 TCACCAACACAAACAGGGAA    TGCACACATGTCAACGAAAA    II-3D10
42  B06 II  H20J04.a    TCAAATCATCTCGGCTACAAAAT CAATCTTTTCAACGGTTTTCTTG II-3D12
42  B07 II  H20J04.b    CCAATTCACCAGTGTCTATCTCC CATGTTTTTCAGCATTATTCACG II-3D14
42  B08 II  H20J04.c    TACATTGAAAACCCCCTAATTCC CAAGATTTTTCAAGACTCCATCG II-3D16
42  B09 II  H20J04.d    AAAGCCGGAAAATACAAAAATGT TGAAAAAGCAGTAGGAAATCGAG II-3D18
42  B11 II  H20J04.f    AAAACCTGATGATTTCGACTTGA TCTCGAAATTCTGTACCTTGAGC II-3D22
42  C01 II  B0286.2 ATTCCAGGCATGGACAGAAC    CTCGATTTCGTTGTTGCTCA    II-3F02
42  C02 II  B0286.3 ATGACCAAATGTCAAGACTCGTT GTGCTCATTCGTTCCAAAGATAG II-3F04
42  C03 II  B0286.4 AAAATTTGCACACGAGAGATCAT TTATTGCAGATGTTAGCAGACGA II-3F06
42  C04 II  B0286.5 TTGTTGGTTGACAGGACCAA    AAACAGGGATGGCAGAACAG    II-3F08
42  C05 II  ZK430.1 CCATTCCACGAGACCAAAGT    CCATCTCATTCAGAGCCCAT    II-3F10
42  C06 II  ZK430.2 GTTCAGTCTCTGCAGAAGCATTT TTCTTGATTTCTTGTGGAATCGT II-3F12
42  C07 II  ZK430.3 TTCCCATATGTTGTTTTGTCCTC ACGTTTATTTACAAGCAGCGAAA II-3F14
42  C08 II  ZK430.5 AGCCAATTATTCGGAAGCCT    ACTGGCTAAAAGCCGAGTGA    II-3F16
42  C09 II  ZK430.6 CAAAATGAATCATGGAGGAAGAG TTTCGATCTTCTCGTTTTCTCTG II-3F18
42  C10 II  ZK430.7 ATGCCGCTATCCCTGTTCTA    GAAACCACGGACAAAAGGAA    II-3F20
42  C11 II  ZK430.8 TGATTCGCTTCATCGAACTG    GTTGGGCAAAAGCCATAAAA    II-3F22
42  D01 II  T12C9.2 CACTCCAACATTGATTGTCAGAA ATTAAGGAACGGAAGAAGAATCG II-3H02
42  D03 II  T12C9.4 AGGGGTAAAATATGAGAAACCGA GATTTCGAGAAACAAATGCTGTC II-3H06
42  D05 II  W06B4.1 GCAAAATAAAATGCGGGAAA    TTTTGTCCGTCACACTGCTC    II-3H10
42  D06 II  W06B4.2 TTCGAGAAGGAGAAGCTGGA    TAATTCTGACAAAACCCGCC    II-3H12
42  D07 II  W06B4.3 CGAATCGAGATGCGGTCTAT    GGCGTTAAATTTGGCTGAAA    II-3H14
42  D11 II  T05C1.4 TCGTATGTGAATGGTGGTGG    CAGTTCGGTCCTCGATTGAT    II-3H22
42  D12 II  T05C1.5 TTAGCCAGAGGAGAGAAGATGTG TTTGCACTTGAAAGTTGGAAAAC II-3H24
42  E01 II  T05C1.6 TGTCCGGGATCTTCTTCATC    AACCACAATCAGCCCATCTC    II-3J02
42  E02 II  B0304.1 TGTGAAGCCATCGAAACAAG    GGAGTTGTTCGTCGGTCATT    II-3J04
42  E03 II  B0304.2 TAATTCAAGGCGCATCACTTTAT GAATGTGAGATGTGGGAAATTGT II-3J06
42  E04 II  B0304.3 AGATGAAATGATTGAGCAAGAGC ATTCAACGGGAGACACTGTTAGA II-3J08
42  E05 II  B0304.4 AATTTTGGGTTAGGTTTTTGTGC ATAAAGTGATGCGCCTTGAATTA II-3J10
42  E06 II  B0304.5 GAATTGCTACTTGGAGAAAAGCA AACGAAAACAATCCGGTAAAAAT II-3J12
42  E07 II  B0304.6 AAAATTTGCTGTTGTTTGCTGAT CAAGTCTTCAATCCTTCAACCAC II-3J14
42  E08 II  B0304.7 GAAGTGCAAGGCCAGCTATC    ATTTATCCGACGTTTTGCCA    II-3J16
42  E09 II  K07E1.1 CCTGTTCAGTTTAGGAGAAAGCA GTACTAGACAGAAAGCGCAGCTC II-3J18
42  E10 II  M03A1.1 ATCTCCCAACCACCACCATA    GGGTTGGAACTACTCCGACA    II-3J20
42  F03 II  F35D11.1    CTACGATTTCAACATTTCCGTTC TTTTCACATTCTTTGCGATTTTT II-3L06
42  F04 II  F35D11.2    CGAAAAGTTTGGCTTCTTGC    CATCTGGGGAGATGACGTTT    II-3L08
42  F06 II  F35D11.4    TTCGAAGCCTTTTCCTTTTAAGT TTTTCTCATTGTCTGAGCCTCTC II-3L12
42  F08 II  F35D11.6    ACCAAATAGTGTGAAAAGGCAGA AACTAGAACAGCAACCAATCAGC II-3L16
42  F09 II  F35D11.7    TCGTTTCCATATGGTTTTTCATC CTGTGTCAAGAAAAATCGGAGAG II-3L18
42  F10 II  F35D11.8    TACTTAGAACGGCAATCGGC    ATATAATGCGTCGTTTCCGC    II-3L20
42  F11 II  F35D11.9    CAAGTGATGAATTCGAACAACAA GATGTATTCGGGGAATAATGGTT II-3L22
42  F12 II  F35D11.10   TATACTGGAGCACATCCACACAG GATTCTTATTGTTGCCTTATGCG II-3L24
42  G01 II  F35D11.11   CTTCTTCCGTGTGCAGATGA    CGTTCCAAAGATACCGAGGA    II-3N02
42  G02 II  Y74E4A.a    ATTCGTTAATGCTAAAATGCCAA AAGTTCCCCAGATTAATTTCCAA II-3N04
42  G03 II  T05A7.1 AATCCTTTAACCATGATCCGTTT TGAATATGCATTTTTGACAGGAA II-3N06
42  G05 II  T05A7.3 TTGCTCACATAAACCCTCGTACT AAAATACCCACAAGTGCTCAAAA II-3N10
42  G06 II  T05A7.4 CTTTACTCCTCTTCGCTCTTTCC TGGCTCAGGAAATTAAAAGTGAA II-3N12
42  G07 II  T05A7.5 CCTTCAATGTGTTCCGGAGT    ATGGACTGTTTATGCCCGAG    II-3N14
42  G08 II  T05A7.6 CTTCAGTTTGCCCATCCAAT    GAACTCGCTGGTGATACGGT    II-3N16
42  G09 II  T05A7.7 ATGTTTGGTGGCATTCCATT    TTTCGAACCTCTCGTGGTCT    II-3N18
42  G10 II  T05A7.8 ATCGAGAGTCATCCGACAGG    ACAGGCATTTTGTGCCTACC    II-3N20
42  G11 II  T05A7.9 TGTCCGGAGTTTGTAGTCTTTGT TCCGACTGGCTTACTCAAAATTA II-3N22
42  G12 II  F10G7.1 CGTTTCTCTCGGAGTTGGAG    GCGGTATTTTTGGAAAGCAA    II-3N24
42  H01 II  F10G7.2 GAACAAGCTAAGTCGGCAGG    TTGCTTGGCCTTAGCAAGAT    II-3P02
42  H02 II  F10G7.3 AAATTCTCGACAATCCTGCG    AGTCACTGAAAATCGGGTGG    II-3P04
42  H03 II  F10G7.4 GCTGTCGCAGATGTTCAAAA    TTTGAAATTGGCTCCTGGAC    II-3P06
42  H04 II  F10G7.5 CATTTTGCCAACTGCTCAGA    TGCACACTGCAAAAATCCAT    II-3P08
42  H05 II  F10G7.6 GTTCTGACAGCTTGCTTCCC    TCGTTGTCTGCTCTCAATGC    II-3P10
42  H06 II  F10G7.7 GCGGTGACGTTTTTGTTTTT    TGCCCGTTCACAAGTCAATA    II-3P12
42  H07 II  F10G7.8 GTCAGTTTGTGCACGTTGCT    AATGGCTATCGCAAAGATGG    II-3P14
42  H08 II  F10G7.9 TCCACGACTACCTCCGATTC    CAGCCGTGTCACTTCTTCAA    II-3P16
42  H09 II  F10G7.10    CTACCAACCAGAGAGGCTCG    GGTTCCATTCCGTTTGATTG    II-3P18
42  H10 II  F41C3.1 GGCAAAACTTTATTCACAAGTGC ACTTGTCCGAGAGGACTACACAG II-3P20
42  H11 II  F41C3.2 CGTGGAAGACCTTCACCAAT    CAATTGGCTGACAATGGTTG    II-3P22
42  H12 II  F41C3.3 AAATGCAACATTTTCCAGGC    ATCAGTCACCTTCTCCGACG    II-3P24
43  A01 II  F41C3.4 GCCGTTTAAAAGAGAAACCACTT AACCCATTTTTGGTGAGATTTTT II-4A01
43  A03 II  F41C3.6 CTTCCTTATTCCGTGGATTCTCT GCTGTTTTCTGAGTGACTCTCGT II-4A05
43  A04 II  F41C3.7 GCTGGAAGAAAAGAACTGTGAAA TTAGGTTCAAAATGGACGAAAGA II-4A07
43  A05 II  F41C3.8 AATGTCACAACATCCACCGA    ATGCTTTCGAGCCATACACC    II-4A09
43  A06 II  F41C3.11    CCCAACTTCCTCCGTCATAA    TTTGATTTTCAGGCGCTTTT    II-4A11
43  A07 II  C27D9.1 TCAGCAACCAGCACATTCTC    AAAATACGCTTGACGTTGGC    II-4A13
43  A08 II  C27D9.2 GTGCTGTTTTGACATAGAAACCC CATTTTGCTTTCGTTAGTTTTGC II-4A15
43  A09 II  F26G1.1 ATTTCAGGCGCTACATTTGG    TCCGCGAGTGAAGTTTTCTT    II-4A17
43  A10 II  F26G1.2 TCACACATTTACAAAAATGCTCG TGTTGTCTTCCACTATTGCACAC II-4A19
43  A11 II  F26G1.3 ATTTTAAAACCCAAAAGGACGAA AAATCACATTAGCATGTCATCCC II-4A21
43  A12 II  F26G1.4 TCTGCTCAATGTTGCCTACG    TTCCACCATCAAAAACACGA    II-4A23
43  B01 II  F26G1.5 GATCTTCGGTAGCTCCAATTTTT TCCACGTGCCTACCTAGTTTTTA II-4C01
43  B02 II  F26G1.6 TAATTCGACACAAGGCACCA    ATCTCGCATTCGTCATTTCC    II-4C03
43  B03 II  F26G1.7 ATAAAACCAAGAACACAAAGCCA TTCCAGAAATCGCCTATTGATTA II-4C05
43  B05 II  C33F10.2    CGTTGCATACACAGACCCAG    CACTTGATACTGCACGCGAT    II-4C09
43  B06 II  C33F10.3    AAAACTACTGGTTCATTGCCAGA AATAAGTCCGGTAGTAAGCAGCC II-4C11
43  B08 II  C33F10.5    CTTCTTCCCATCCTCATCCA    ATCGTCTTGTTCCAACCGAG    II-4C15
43  B09 II  C33F10.6    TAATGCTGTCGCTTGTCGTC    TTTGGAATTTCAGGGCAGTC    II-4C17
43  B10 II  C33F10.7    GCGACTGACAACTTTCGTGA    GAAGACGAATGGGCAGGTAA    II-4C19
43  B11 II  C33F10.8    TGAAGAAGTTGCGTCATTGC    AAGGAGTTGTGCAAACTGGG    II-4C21
43  B12 II  C33F10.9    AGCGAAGTGTGGATTTTTAATCA GAGCTCTCTCGCATTCAAAATTA II-4C23
43  C01 II  C33F10.10   GCCAATTATCCTTTTGTGTTGAG GCACATTTTTCATTCACAACTGA II-4E01
43  C03 II  C33F10.12   TTCTCAGATTTCGCACTCTTTTC AATAGTAATTCCATCGGCTCCAT II-4E05
43  C04 II  T23B7.1 TTCATCATCTCCTTCAAATTCGT CTGGCTCTTCTAGTGTCGATCAT II-4E07
43  C05 II  F11G11.1    CAACCAGTTCATTGAAACAGACA TTCTGCCGCAATTTTACATTACT II-4E09
43  C06 II  F11G11.2    TCTTCAATAATAATGGCAAGCGT AAAGAGACCATGTGAATTTGGAA II-4E11
43  C07 II  F11G11.3    ATTTCAATTTTAATCGGCGAAAT TGGACGGTTTGCAATATACTTCT II-4E13
43  C08 II  F11G11.4    GGTGCCACTCTTTTTATGACTTG AGAGATAGCCGAGGAAATATTGG II-4E15
43  C10 II  F11G11.6    GATTTTTGAGTAGCGACAATGCT AAGCCAAGCAGTTTTTAGCTTTT II-4E19
43  C12 II  F11G11.8    ATAAAATCCTGCAACAACGAGAA AGCAAGTTTCTCTGAATAACCCC II-4E23
43  D01 II  F11G11.9    GTAACAAAGTGACTCGCATGTTG AGCGATTATCAACCAATCAAGAA II-4G01
43  D02 II  F11G11.10   GTCGGGTCGCTAACAACATT    GAAGAAATTCGCGTTCTTCG    II-4G03
43  D03 II  F11G11.11   CTTCTTGGAAACCGCTTCAG    CCACCTTGACGGCTATCATT    II-4G05
43  D05 II  F11G11.13   TTCATCGTTTTGTATTGTACCCC TTTCAGTTGTTGTAACGCAAAGA II-4G09
43  D06 II  R05F9.1 GCTCATGTCACAATTGGGTG    ACAATAGGGCACGCAAAATC    II-4G11
43  D07 II  R05F9.2 TTCTTTTACCCAAATTTTCCGTT CCGAAAATGTTACTTTCATCTCG II-4G13
43  D08 II  R05F9.3 TTTTGCTTCTTCTCCAATGTAGC AGGAGATTTCGATTTATTGCACA II-4G15
43  D09 II  R05F9.4 TATGAATGCTTTCTAGGCCACAT AATGATGGCTACATTGGAGAAGA II-4G17
43  D11 II  R05F9.6 CAGCAGCAGAATTACACGGA    GCAATTCTTCCAGCATCCAT    II-4G21
43  D12 II  R05F9.7 ATCTAAAAGCGTTTTCTGAACCC TTTTTGTTTTGTGCTGGAAGAAT II-4G23
43  E01 II  R05F9.8 TATTTCTAAAGAGCAGTGGGCAG TCTCACTCTACAAAGAAGTCGCC II-4I01
43  E02 II  R05F9.9 AATTGTAAAGGAGCAGCTGTGAG TTCTTTCCATCACAGACACACTG II-4I03
43  E03 II  R05F9.10    AGGAGATTGGCGGAAGAGAT    TATCCGCCAGAAGGTTTCAC    II-4I05
43  E04 II  R05F9.11    AAATTTCATCGTCGGAATCG    CTGGGCTTGCATAACCAAAT    II-4I07
43  E05 II  R05F9.12    TGCTGGAAGGAATGGTTTTC    GGTGTCGGCTATAACCTGGA    II-4I09
43  E06 II  R05F9.13    TCAAAGCTTGGTTAAAAATTGGA CTTGATCACCCTTGAAAATTCTG II-4I11
43  E07 II  ZK546.1 GCTGATATGGCAGTTTGGGT    GCAACTGAGCAATCCCATTT    II-4I13
43  E08 II  ZK546.2 ACATCAACGGTCAATAAGCATCT TAAGCAGAGCAAGACATGAACAG II-4I15
43  E09 II  ZK546.3 AGGCACATCATGTATTTTCGAGT TTGGTTTTGGAAAAAGTTCAAGA II-4I17
43  E10 II  ZK546.5 GATCAGCCGACTGTAGGAGG    TTTCCAATGCCATCATCTCA    II-4I19
43  E11 II  ZK546.6 TCCTGGAGAAAAATTGATTTGAA TGCAGAAATGTTAAAGTTCGGTT II-4I21
43  E12 II  ZK546.7 CAGAGTTGACGACCAAGCAA    TCGAGTTGGTATCCTGGGAG    II-4I23
43  F01 II  ZK546.8 TTGGTCATTCAGCAATGGAA    TTACACCCCCTACAACTGGC    II-4K01
43  F02 II  ZK546.11    TTAGATTGTTGCCGTTTTAAGGA GCATTCTCAAATCACGTAAGACC II-4K03
43  F03 II  ZK546.13    GATCGATACCTCCTGGACGA    GTCTACGGGATTTGCTCCTG    II-4K05
43  F04 II  ZK546.14    GACAGGCTCATTGCCATTTT    CACTCCGCTACCAGAGAAGC    II-4K07
43  F05 II  ZK546.15    ACCTGTCAGCTCCCAATGAC    GAATTAGGGCGCCAATTTTT    II-4K09
43  F06 II  ZK546.16    CGTACCTTCGTTAAAAATCATCG TTGCTATTCAAAAAGTGGGAAAA II-4K11
43  F07 II  Y38A8.1 GCTCAGAGGAGTCTGATCAATGT GGCAACAATTCTACGAACAAAAA II-4K13
43  F08 II  Y38A8.2 TGAGACAGGGAAAAGAGAAACAA CTATTTGTAAGCAAAATGTCCGC II-4K15
43  F09 II  Y38A8.3 TACCGGCAATTTTTGAGAGG    GCTTTCGTCCGAGCTGTAAG    II-4K17
43  F10 II  T27F7.1 TGCAGTTCACTCTTTTCTCAACA AACAGCAATTCGACAGAATAAGC II-4K19
43  F12 II  T27F7.3 AGAGTAGCATGGCATTAGAGCAG ATTTTTCTCGTGCAATCCTGATA II-4K23
43  G01 II  F59A6.1 TGAAGCAGCTTTGATGATGG    TTCGGTTACTGGATTCAGCC    II-4M01
43  G02 II  F59A6.2 ACCTTGAATCTACAGTGTGCCAT TTAGAACAAATTCGCCATCAACT II-4M03
43  G03 II  F59A6.3 TCAGACAGATCCACAGACTCTCA TGTTAACTGCTTGAGTTGTTCCA II-4M05
43  G04 II  F59A6.4 CGCAAGAAACCTTCACCAAT    GTCTCCCGTCATTCTGCAAT    II-4M07
43  G05 II  F59A6.5 CCTGCAGAACAAATGCTCAA    CCACTTTGCGTTGACTCTCA    II-4M09
43  G06 II  F59A6.6 CAACCTTTCCTGAATCAACTCAC TCTACTGGTGAGAGTTGGAAAGC II-4M11
43  G07 II  F59A6.7 TATTTGCCCTTGAGTTTGTTGTT GTTAGAAAATGACGGCAGAAATG II-4M13
43  G08 II  F33G12.2    GAATCACTTTTGAAGGATGTTCG ATTGATTGTAAGCAAGGTGCAGT II-4M15
43  G09 II  F33G12.3    GGTAAGAGGACGTGGTGGAA    TAAAACTTGTGAATCGCCCC    II-4M17
43  G10 II  F33G12.4    TCAGATGGAAGATTGGAGGG    TCCCCAGTGCTCTTTTATCG    II-4M19
43  G11 II  F33G12.5    ATCTTCCAATTGTTGACGGC    TGAAAACTTGCAACGTGAGC    II-4M21
43  G12 II  F33G12.6    GAGAACCAATTGCCGATGTT    GAAGAGATGCAGCACATGGA    II-4M23
43  H02 II  C27A2.2 TTTATTCCTGAAGATGCCGATAA GAAGCCTGATTTGAAACAACAAT II-4O03
43  H03 II  C27A2.3 GGGAAAAGCTCCTGGAAAAC    GAGGAAGCACCCAGATACCA    II-4O05
43  H04 II  C27A2.4 CGAGTACCAGTAGGGAATGAGTG GATATGGACAGTTGACTCCGGTA II-4O07
43  H05 II  C27A2.5 GCTCAGTTGATCACGTCTTTCTT AATCGCAATTTCTCAGGTATCAA II-4O09
43  H06 II  C27A2.6 TTGCTTCAAATGAACTTGCG    GACAGATTCCCCTTCACCAA    II-4O11
43  H08 II  F09C12.2    AATGGCCGGCATAACTACTG    AACTCGTAGGTCACCGATGG    II-4O15
43  H10 II  F09C12.6    AAGCGTTGAAACTAGTGATCTGC TGGGCAACAAGGTATAACTCACT II-4O19
43  H11 II  F09C12.7    ACGAAAAATCACGAGTTCTTTGA TGTGAAATGGAGAGCTAGAGAGG II-4O21
43  H12 II  F58A6.1 TGTCTCCAACTCGAATGCTG    TGGAAAATGGTGGAGTTGGT    II-4O23
44  A01 II  F58A6.2 CAGAAATGATTTTGGTTTTCTGC GGAACACAATAACAATGGTAGGC II-4A02
44  A03 II  F58A6.5 CGCCCGCTAGTTGTAGAAAA    CGTCAGACCCAAAACCACTT    II-4A06
44  A04 II  F58A6.6 TTGTCTGTCTGCCTTCATGC    TCCACACCGTTCAGACAAAA    II-4A08
44  A05 II  F58A6.8 GGCATTCAAAATCAGAAAAGTTG GCAGCATATTAGTTTTCACCCAG II-4A10
44  A07 II  F58A6.10    TCAGCTCCTTCCTGACCAGT    GCAGGGCTATCACTTCTTCG    II-4A14
44  A09 II  C27D6.1 GAAATCTGCTGAAACCGAGC    AATTCGAGCGTCTTGTTCGT    II-4A18
44  A10 II  C27D6.3 GGTTGTCTCAACTCTCAATTTGG TATTTCAATTATGGCGTCTTTGG II-4A20
44  A11 II  C27D6.4 ATGAGTGATGAAAAGCGGTTAAA CGTTGTGGGAATCATACATTTTT II-4A22
44  A12 II  C27D6.5 TCGAACCTATGTGAAAGCAATTT GTCATCTCGTTCATCAATGTCAA II-4A24
44  B01 II  C27D6.6 ATACTCAAGACTGCAGAAAAGCG TTCAAATCATCCCTTCTCGAATA II-4C02
44  B02 II  C27D6.7 ACCTCAAGTTTAATCGTCGTTGA TGTTTTCTAAAGATCCGGACTGA II-4C04
44  B03 II  C27D6.8 TGAAGGAACACAACATTCCTTTT TCAACCAAGCTCTGAATTGATTT II-4C06
44  B04 II  C27D6.9 AACGCCTCTTGCCACTGTAT    ACAGATTGGGCATTACCAGC    II-4C08
44  B05 II  C27D6.10    TTGGCCTCAACTCTCTGGAT    ATGACATGAACGTGAGCTGC    II-4C10
44  B06 II  C34F11.1    ATCAATATAATTTCCACGGGCTT TCTTATGGCAACTGGACAAAGAT II-4C12
44  B07 II  C34F11.2    ACAACATTTAAAACTGACGAGCC ACATTTATTGAAGATCAAGGGCA II-4C14
44  B08 II  C34F11.3    AACGATCCATCGTCTCATCC    TGGTAGGGAAATGGTGGAAA    II-4C16
44  B09 II  C34F11.4    CAGGTTTTGCCATAAACTTCACT GATGGAAGAGAAACAGAGAAGCA II-4C18
44  B10 II  C34F11.5    GCTTCGTCTTCGGAGACATC    GCCAGCGACAAGACCTATTC    II-4C20
44  B11 II  C34F11.6    TAGTCAGGAAAACCGAAATTTGA GTATACTCTCGCTTGTCTTCCGA II-4C22
44  B12 II  C34F11.7    AGTGCAAAGATTAATGCGTGTTT CCATGACCTATTTGTTTAGCTGC II-4C24
44  C01 II  C34F11.8    GGGAATTGGGGATATTCTTGATA TGTACATCACAAAAGACGCATTC II-4E02
44  C02 II  C34F11.9a   AACATCCAAAATTACAATCACCG CCTCTAGAGCATCTTCGTTTTCA II-4E04
44  C03 II  EGAP2.1 ATCTCTATGCAGGAATTGAGCAG ATCATTGAACCAACTTTGGAATG II-4E06
44  C04 II  EGAP2.2 CTCAATCTTCTGCTCCTGTTGTT GATGCAGTGGAATAAAATAAGCG II-4E08
44  C05 II  EGAP2.3 ACTTCCGTCTTGCTCGTGAT    GTCCAACTTGCTCGGACAAT    II-4E10
44  C06 II  T16D1.1 TGCACCTACCTAAGTTAAGCTCG CACGTGTGTACAACAAAAGCAAT II-4E12
44  C07 II  T16D1.2 CTTTCCAATGTCGATTCCGT    GGTTCAGGCGGTAATTTCAA    II-4E14
44  C08 II  C54A12.1    AACCAAATCTGTAGGCGTCG    GTCCAGGGTTTCTGTGCAAT    II-4E16
44  C09 II  C54A12.2    GAAAAATGTTGAGGCGGTGT    TCGCCAAAATCCTAAAATCG    II-4E18
44  C10 II  C54A12.3    GTTTAAGAACCAAGCAATCATCG TTTTCTTCCGACTTTTTGGTACA II-4E20
44  C11 II  C54A12.4    AGGCTACATAATATGGCATCCCT TGTGCAAAATATCAGCTCTCAAA II-4E22
44  C12 II  ZK622.1 GAGCGAAAATGCAGAAAAGG    CAGCAACTTTGCCATCAAGA    II-4E24
44  D01 II  ZK622.2 CGCCTGCAGAAAATCCTAAG    GGAAATTCCCAATCCATCCT    II-4G02
44  D02 II  ZK622.3 TTTTTCAAGCCCAGACTGCT    GTGAACGTTCGTCGTGCTAA    II-4G04
44  D03 II  F08B1.1 CTTCGATCTCGCCAAACTTC    TTCGTTAAACCCCGATTCTG    II-4G06
44  D04 II  F08B1.2 AATCCACCAACTGCCTCATC    TGAGTTGAGGACGAGCAATG    II-4G08
44  D05 II  F09E5.1 CATTTCCAACCACAATTCCC    TGTTCCAAAGCTTCCCAATC    II-4G10
44  D06 II  F09E5.2 AAAATTTCGCGTCTCCGTAA    TCAACCAAAAATCCCGTCTC    II-4G12
44  D07 II  F09E5.3 GTGCGCCACGATTTTTATTT    GATGCGGAACAAGTGAGGAT    II-4G14
44  D08 II  F09E5.4 ACATGTTGTGCAGCATTGGT    AATAAAGTCCATGCTTGCGG    II-4G16
44  D10 II  F09E5.6 GCTCATCTTCAAACCGCTTC    AAATGTTCCGATGCCACTTC    II-4G20
44  D11 II  F09E5.7 CGATCGGAAATTCTCAAGGA    TGGTCTTCCGTGACTTCCTC    II-4G22
44  D12 II  F09E5.8 AAAGGTTGGTAAACCGGAAATTA TATTTTTGTATTCTCTGGCTCCG II-4G24
44  E03 II  F09E5.11    GTCGGTATACACTTCGAGCATTC CTTTCATGTAGATTTACGGCGAC II-4I06
44  E05 II  F09E5.13    AAATTCCTCTTTGTGGTTTTCGT CTTTATTGTTCGATGTCGAGGAC II-4I10
44  E06 II  EEED8.1 AAGTCAGTTATTGCCGTGTTGTT TTGAGCAGTCTGAAAATAAAGCC II-4I12
44  E07 II  EEED8.2 AGGCGCTTAATTGACCCTTT    ATCAGTTGTCACCCCCTCTG    II-4I14
44  E08 II  EEED8.3 CTCGAAGCTCGAAATTAGAAACA ACGGCGTTAAATGGAATAAAAAT II-4I16
44  E09 II  EEED8.4 GAATCGATTGAGACAAAACGAAC CCGATTTGGACCATTTACATAGA II-4I18
44  E10 II  EEED8.5 GAGCTTGTCGAAGACGAACC    TTCACTTGGAAGAGCTCCGT    II-4I20
44  E11 II  EEED8.6 CAATCTGAAGGGGTTCTCCA    TGGCTCAAGTGTCAAAGCAG    II-4I22
44  E12 II  EEED8.7 TAAAAACGAAAACGAAAACGAAA CGGATATCAATGGTCTAACTTCG II-4I24
44  F01 II  EEED8.8 GCGAAAATAAGAGGAGAACATGA TATCGATTTTTGGGCAATTTATG II-4K02
44  F02 II  EEED8.9 TCTGAACAATGACAAATTCAACG ATTGTTTGAGTTTTCAGGGGAAT II-4K04
44  F03 II  EEED8.10    GGGTGATTGGTGGAAGCTAA    CAAGCAACGACCAATGAGAA    II-4K06
44  F04 II  EEED8.11    GGATTATCCCCTGGTCCTGT    TCTCATTGCTTTTGGCCTCT    II-4K08
44  F05 II  EEED8.12    GCAACAGTGCTCAAAACAACTTA TATGGTTTCCCTTCTGTTTCTCA II-4K10
44  F06 II  EEED8.13    TTTGGAAGGTGTCTATGCAATCT TTAACAAAAACACGGCTGCTATT II-4K12
44  F07 II  EEED8.14    AGATTCGAGTGCATGTGACG    AGAGCCATCGAATGCAGAAT    II-4K14
44  F08 II  F07F6.1 TGCTGAGTTCCGAATCACTG    TTTGTGGTCCAAAGTGTCCA    II-4K16
44  F09 II  F07F6.2 AAACGTGAAACGACCAGACC    CAACATTGGCAACTCATTCG    II-4K18
44  F10 II  F07F6.4 TACTGCACAGGTTGCGTCTC    AACCTCGGTGTTCACCTCAC    II-4K20
44  F11 II  F07F6.5 TCTGGCATTTTTGATCTTTGTTT GTTTAGTTTTCCCACAAAAACCC II-4K22
44  F12 II  F07F6.6 CCGAGCAACTTCTTGGAGTC    AGATTCGATTGAATGGGCTG    II-4K24
44  G01 II  F56D1.1 AGAAACCAGCATTCATTCGC    CGTGCCGTAAGATCCTTGAT    II-4M02
44  G02 II  F56D1.2 ACGGCATACGTTCCTATTCG    GGGGGCACCAGGTTATACTT    II-4M04
44  G03 II  F56D1.3 ACAACATTGCGTACTTGACACTG CGCCTGAAAATTGATGTAAAAAG II-4M06
44  G04 II  F56D1.4 CGCCTGTTGTGATACATTGC    GCTCTCTGACGATCCGTTTC    II-4M08
44  G05 II  F56D1.5 CGTATTTTCGTTGGTGGCTT    CAGTTGTTGTAGGCGGGATT    II-4M10
44  G06 II  F56D1.6 AAATTCAAGTTTTGGGCATTTTT AACAATCCAACCAACAAACAATC II-4M12
44  G08 II  F12A10.2    AGGAGGTTGTTATGAAGGTGACA GTGAAGAATCAATGCCAATTCTC II-4M16
44  G09 II  F12A10.3    AGTTGGATTCTCGTGGATGG    TAATCTGTCGCAGATGCCTG    II-4M18
44  G10 II  F12A10.4    TGTGCAATGGGAAAAACTGA    CTCCGGTGTTATCTTCCCAA    II-4M20
44  G11 II  F12A10.5    GATTCTTTTGATTATTGGCCCTT AATGGACTCACTGAAAGAAGCTG II-4M22
44  G12 II  F12A10.6    CTTCCTCTTATCTCACGCACACT GTAAAATTTAATCTTCGTGGGGC II-4M24
44  H01 II  F12A10.7    TCCAACTTATTGGGGATACAATG AGGAATTGGTGACAGAATCAGAA II-4O02
44  H02 II  F12A10.8    AGTCTTCCTGGCTGTCCAGA    TGCAGAGACATCGGAGACAC    II-4O04
44  H03 II  ZK177.1 CCAACTGAGCCTTTCACCAT    GCACTTCCTGGATGTTGGTT    II-4O06
44  H04 II  ZK177.2 ATACGTGAACTTTGCCCCAC    ACCATTTTAACAGCTTGCCG    II-4O08
44  H05 II  ZK177.3 TCCTTACAGTTCGGATCAATGTT ATGGTTAGTGGCAAAAGCACTTA II-4O10
44  H06 II  ZK177.4 CCTTCGATTTGATTCCTCCA    CAAGCTGCAAGTGGTTTCAA    II-4O12
44  H07 II  ZK177.5 CCCGGTCTTGGAAATCTGTA    CGAATCCGAACGGAAGATAA    II-4O14
44  H08 II  ZK177.6 TGTCACAATTGGGTTGCAGT    TCGACGTTGAACAATTGGAA    II-4O16
44  H09 II  ZK177.7 GTTTTCAGCTCAATTTTCGTTTG TGCTGGATTGATCACACTATTTG II-4O18
44  H10 II  ZK177.8 TTCTCGCAATACCTCCTGCT    GTCAAAGTGCCGAGACCAAT    II-4O20
44  H11 II  ZK177.9 ACATGGCGACATCAATCTAAAAC CGAAATCTTTATGAGCAGCAGTT II-4O22
44  H12 II  ZK177.10    GATCTTTGAAAATTCAATGCGAG TGAGCATGAGTATACTTGGAGCA II-4O24
45  A1  II  C17C3.1 CGTTTTTCTTCCTGCGTCTC    GAAAAAGAATTCGGCCATGA    II-4B02
45  A3  II  C17C3.3 GGAACAAGGTCGCAAAATGT    ACGGTTGCTCTGAAAATTGG    II-4B06
45  A4  II  C17C3.4 GTTGCGTTGTTTCAATTTTTAGG GTATGAAACTGCCTTGAGGTCAC II-4B08
45  A5  II  C17C3.5 AAATTTGCACAACGCGTATACTT AATACGATGTTCACTTTGCACCT II-4B10
45  A6  II  C17C3.6 CTACTGAACGGTGAAGAGTCGTT CTTTGGAGCTCTGAACAAAGAAA II-4B12
45  A7  II  C17C3.7 TGGTCCCATTTATCTGTTTTGTC TAATTTGAGATTACGGGGATGTG II-4B14
45  A8  II  C17C3.8 TTAATTTTCAATGAATCGGGATG TTGGTTCTTTTCAACGTTTTCAT II-4B16
45  A9  II  C17C3.9 ATTTGTTCAAATATGGCATCCAG TTAAATTTTTGAGCGTTTTGGAA II-4B18
45  A10 II  C17C3.10    CGGGAATATTGGCCATAGAA    GGTCCCAAGACAAAACTGGA    II-4B20
45  A11 II  C17C3.11    AGTTCGTCAACGACAAGATCAAT TCGGTAAAATTTGTTAGCCAGAA II-4B22
45  B1  II  C17C3.13    CCTGCCTTTTAGTGCGTATTTTA TGTCATTTCCAGAGAGCTTCTTC II-4D02
45  B2  II  C17C3.14    ATGATATCCTTAACCCAGTCCGT CTGGAAAAATCAGCACCATTTAG II-4D04
45  B3  II  T25E4.1 CTTTTTCCAACCCATCGAAA    TTTTGGCTCTTCTCCACCAC    II-4D06
45  B4  II  T25E4.2 CGGCCAATTAAACGCATATT    TTCTAGACGATGAAACCGGG    II-4D08
45  B5  II  C17G10.1    AACGGATGGTTCCACTCAAC    CCCCATTCAATGCAGTTCTT    II-4D10
45  B6  II  C17G10.2    CAAAAACATCTCGGTAATCTTCG AAATAACACAACAAAACAACGGG II-4D12
45  B7  II  C17G10.3    TCCTCTTTTACGTTTATCCACGA ACCATAACAGCGAAGAAAATTGA II-4D14
45  B8  II  C17G10.4    ACATACACGTAGCCAACCCATAC AAAAATGAGAGAAGACCACTCCC II-4D16
45  B9  II  C17G10.5    AAATTCAGATGGACAAGCGG    CATCCTCTTCAACAGCGTCA    II-4D18
45  B10 II  C17G10.6    TTTTGGAGCAGTTTTACGGG    ATTCCACTTCCGTTTAGGGG    II-4D20
45  B11 II  C17G10.7    AAGGCATTGATCGTTCTGAAATA CTAAACCTTTTCCTCCGTTGTCT II-4D22
45  B12 II  C17G10.8    TCCGAAAGCTGAGAAGCAAT    AATGTGCCGGAAATTTTGAC    II-4D24
45  C1  II  F59E12.1    GCAAACAAAGAAGCTCCCAG    CTTCGACGTCTTTCACCCAT    II-4F02
45  C2  II  F59E12.2    CGTTGAGTTTGAACACATTACGA CATTTCATCAACTTCGACAATCA II-4F04
45  C3  II  F59E12.3    TACGACTCCGTTTTTAGCCG    TGAAGTCGCGCACAAATAAG    II-4F06
45  C4  II  F59E12.4    CCCGAAAGGAATTTGCACTA    CTTCACATTCCTGAGCCCAT    II-4F08
45  C5  II  F59E12.5    CCCGAAAGGAATTTGCACTA    CTTCACATTCCTGAGCCCAT    II-4F10
45  C6  II  F59E12.6    TTAACAGCTTGCCGGACTTT    GGGTATCCAATGTTCGATGG    II-4F12
45  C7  II  F59E12.7    TTCCATACCGTGGAAAAATTATG CACTTACATCAACAGGCAAACAA II-4F14
45  C8  II  F59E12.8    GATGAAACATTGATTGGGAAAAA CGTTCTCTACAACTGTCTGGCTT II-4F16
45  C10 II  F59E12.10   AGAGAAGGATGCCGTAGATTCTC CTCTTCTTGAATCTGTTGCCCTA II-4F20
45  C11 II  F59E12.11   AAAACGGCAATGGAATTTTG    GATATCGAAACCGACGCAAT    II-4F22
45  C12 II  F59E12.12   TTAAAAACGTTCATTCCGCC    AAGGGGTTCCGTCAGAAAGT    II-4F24
45  D1  II  F59E12.13   TCGATCGCAATGTAGAATGG    CCAATTCACAGACCACAACG    II-4H02
45  D2  II  C25H3.1 CCCTTTTTGGATAGAATTATGGC ACACAATATCACAAGTGAACCCC II-4H04
45  D3  II  C25H3.3 TTTTAACACTCTTCACGGTGGAT AACAAATGATCTCTCACTTCCGA II-4H06
45  D4  II  C25H3.4 TAGGCTGCTCAATGATGTCG    CTATTTCTCTGCCGTCAGGC    II-4H08
45  D5  II  C25H3.5 TTTGAAATTCAGAATATGGGTGG TGTCAAAGATGCATGACAATAGG II-4H10
45  D6  II  C25H3.6 AAAGTGGCCAGCTCTTTTGA    CCTTCTGAATTTTTCGCTCG    II-4H12
45  D7  II  C25H3.7 CTCCACTCGGGATAATAGTGTTG ACAGTAACCACCTGCACATTTCT II-4H14
45  D8  II  C25H3.8 TGTTGCAAAATGACTGGGAA    AGAAGGAGCACGTGCAAAAT    II-4H16
45  D9  II  C25H3.9 GGTCCATCCTCTACCACGAA    CAGATCGAACGAGATGCTCA    II-4H18
45  D10 II  C25H3.10    TACCAAAAGTGACGAAGAAGCTC TTCACATTAGCAAACTCGAATGA II-4H20
45  D11 II  C18A3.1 CAGATTCTGGGTCTTTGGGA    TTCTCCGGCAACTCAAACTT    II-4H22
45  E1  II  C18A3.3 CGCAGCATTATGAACGAGAA    CCGAGAAGTCTCTTGCGAAC    II-4J02
45  E2  II  C18A3.4 ACATATATTGCCTCGCTGGC    CTCAAGTGGTCGACTCGTCA    II-4J04
45  E3  II  C18A3.5 CTGTTGTCCAGGTCCTCCAT    TCCCAAGCTCTTCAGACGAT    II-4J06
45  E4  II  C18A3.6 AGCTCTGGGAATTGTTTGGA    CCAATCTTCGAAGGGTTCAA    II-4J08
45  E5  II  C18A3.7 GAATTGCGACTTCATATTTCGAC GGGTTCAGATTTTTAGCCAGAGT II-4J10
45  E6  II  C18A3.8 ATGGAGACCCGTAAATGCAC    GTGGCAACTTGGCGTTTTAT    II-4J12
45  E7  II  F10C1.2 GGCTGAGTACAGATCCAGGTTTA TCAAAACCAAAAAGCTTCAACAT II-4J14
45  E9  II  F10C1.5 TCATAATACACTGCTTTTCCCGT TTCTGCATTGAAAGGTTCGTATT II-4J18
45  F1  II  K05F1.3 AGCTGCTCCGATCTGTTTGT    ATTTTTCCGCTTTCCTGTGA    II-4L02
45  F2  II  K05F1.4 ACCCAATCCAGACAAGATGC    TTCGTTTTCTTCCAAATCCG    II-4L04
45  F3  II  K05F1.5 AATAGCTCATCTACACTGCGGAC ATCTCAGCTTGTAAGGAGTCGTG II-4L06
45  F4  II  K05F1.6 ATCAATGCTCGGAGTGTTCC    AAATCGAGCCACCATTGAAG    II-4L08
45  F5  II  K05F1.7 TGAAGAAAGTCGAGGATTCAAAG GAAGGCCAAGTTACCTTTTAGGA II-4L10
45  F6  II  K05F1.8 GGAAACAGTTTAGAATGTGCGAC CTACCAAAGTTTTGCTCTGCTGT II-4L12
45  F7  II  K05F1.9 CTAAAAAGTGCGCGAAGAAATAA TTCAAAGCTTCAAAGACAGGAAC II-4L14
45  F8  II  K05F1.10    CTGGGAAAAGTGCAAAAGATATG CATTCTTGTTTCCCTCCTTTTCT II-4L16
45  F9  II  ZK1248.1    CGTTGCATTCTCTCAACCAA    TTTCTAGTCATCGGCGATCC    II-4L18
45  G1  II  ZK1248.5    TCATTCCCGACTTTTGGTTC    TTCCTTTTTCCTTGTGGTCG    II-4N02
45  G2  II  ZK1248.6    ATGATACTTGGCAGCAGATGTTT GCCCCCTATATAAGTTCGAAGAA II-4N04
45  G3  II  ZK1248.7    GGTCCATGAGCCCTGTAAAA    TTTCCCTACTGGAAAATGCG    II-4N06
45  G4  II  ZK1248.9    TTGGCTTTCGGGTATTGAAG    CACAGATTCGTGGTTCATGC    II-4N08
45  G5  II  ZK1248.10   TTTTCCTGGTTTTGTCGGAG    TGCAACGGAATGGTATTTGA    II-4N10
45  G6  II  ZK1248.11   GTGAAATGCAGGAAGAGGTATTG CACTTCTTATTCACTGCCTGGTT II-4N12
45  G7  II  ZK1248.12   ACCAGGCAGTGAATAAGAAGTGA CGTTACTTTGGGATGAAGAACTG II-4N14
45  G8  II  ZK1248.13   CAAAGCGCGAATCCATTTAT    TGAAGACGACGATGTTGGAA    II-4N16
45  G9  II  ZK1248.14   CAGGGACATCGACACAAATG    GGAAAAATTGGACACGCACT    II-4N18
45  G10 II  ZK1248.15   TTAAATGATTCCGAGTTTGAGGA ATGGAGAAGTTGGATGATGAAGA II-4N20
45  G11 II  ZK1248.16   TTCTTTTCCCCAAACATTGC    TGCTTATCTTTGGCAGCCTT    II-4N22
45  G12 II  ZK1248.17   AGGAGTTTCGATTTTCTTTCTCG ATGTTTTAATATAGCGGGGCACT II-4N24
45  H1  II  H41C03.1    TCGGAAATGCATGACTTTTATCT TGCTCATTTTGAAATCGAACTCT II-4P02
45  H2  II  H41C03.2    ACTTGAACAATTTTAGATCGGCA AGTGAATACTCACCTGTTGGAGC II-4P04
45  H3  II  H41C03.3    AAGGCAATTTATCCACGACG    TGTTCGAACCATCCAATCAA    II-4P06
45  H4  II  F55C12.1    TAGTCTTGGTGGAAGCTCTTCAG GTATCACTGGGGTAAAAAGGTCC II-4P08
45  H5  II  F55C12.2    AAAATCCCCGTAGTCATTTTGTT AGTGGAACATCTTTCAGGATTGA II-4P10
45  H6  II  F55C12.3    TGTTTTGCCACTAACTTTGGTTT GAGATGAAGTTCTTGCCAATCAG II-4P12
45  H7  II  F55C12.4    TCAAATTCGTTGAAAGATTCGAT GGGTTTTTCTTCTTCGTTGACTT II-4P14
45  H8  II  F55C12.5    TGCAGTAAACTTCGGTGCAG    CGACTCGAAGGATCCATGTT    II-4P16
45  H9  II  F55C12.6    TCGGATGAGCATTCACAAAA    CCCATCTTTATCGGAAAGCA    II-4P18
45  H10 II  F59G1.1 CGTCACTTGCTCCGACTACA    CCATGATTAAACCAGACGGG    II-4P20
45  H11 II  F59G1.2 TTGATGTGGCGACTTCTCAG    TTTCCAATGTTGCTGGTTGA    II-4P22
45  H12 II  F59G1.3 AACTGAAGCCGAGAGATGGA    TTCACCCAGAGTTTTACGGG    II-4P24
46  A1  II  F59G1.4 AGAAACCATCGTATTTTCAGCAA ATTGGCTCTCTGTAATCCAACAA II-4B01
46  A2  II  F59G1.5 CAGTATCTGTCGAAACGCGA    GGATGACGCAGAGGAAGAAG    II-4B03
46  A3  II  F59G1.7 GCTCAAATACCACATAATTTCGC AATCCGTCAGCACTTTTTGATAA II-4B05
46  A4  II  F28B12.1    TTTCCATAGAATGTCTGCTCCAT TTTTCTTAGAGTGCTGGATTTGC II-4B07
46  A5  II  F28B12.2    TCAAATTGCGATGTGGAAAA    TCCAGCACGTTGTTCATTGT    II-4B09
46  A6  II  F28B12.3    GCTCATCGCACTACGAACAA    CGAACTCGAAGGAGTTGAGG    II-4B11
46  A7  II  B0034.1 AAATCTCGGATCATTCTTTCTCC TTCATAAAGCTGTGATTCTGCAA II-4B13
46  A8  II  B0034.2 CTGAATGGTTTCATAGAGATGCC CAAGTTGAATGACCCTTGGATAA II-4B15
46  A9  II  B0034.3 CTGAGTACTCGGCCCTTGAG    AGACTTCCGTGCTGCTGAAT    II-4B17
46  A11 II  B0034.5 CACATCTTATGTGACGTCATGCT ACAATCAAATGTGCGAAGAAGAT II-4B21
46  A12 II  ZK84.1  CAGCTGACTCTGGTAGTGGAGAT ATATTGAACGGCTAACTTGCTCA II-4B23
46  B1  II  ZK84.2  TCAAGAATGCAATTTCAGGATTT AACTGATCATTTCACGCAGATTT II-4D01
46  B2  II  ZK84.3  TCCAGACTCAATCGAAACTCTTC ACCGCAGTATTTTTGAATTAGCA II-4D03
46  B3  II  ZK84.4  TTCTGCAGGGTTCAAGTCATAAT TAAAAACGATTTCCTCGAAATGA II-4D05
46  B4  II  ZK84.5  TGAAGCATCTCCCAAACATAGAT TTCAAGCAACATCTCTTCTCTCC II-4D07
46  B5  II  ZK84.6  TTGAAGTCACATTGTTTCCTCCT GATAACGCACTTTTGATTTCTGG II-4D09
46  B6  II  R12C12.1    ACTGCTCAAGCTCTTCTTGCTAA CGAATCGATGACTCAAATACTCC II-4D11
46  B7  II  R12C12.2    TGAATTTGCAGGCAAAACAG    GAAGGAGTTGAGCTGGATGC    II-4D13
46  B9  II  R12C12.4    CTCAATGTGACGGAGTATTGTGA GATTTTTGAACCTTTCCTTTGCT II-4D17
46  B10 II  R12C12.5    CATAGAGGATTAGTTTGATGCGG TTCACCACTCCCAGTGTTCTATT II-4D19
46  B11 II  R12C12.6    TGCCGAGAATCTCCTCATCT    ACTGGCGCACTTCTTGTTTT    II-4D21
46  B12 II  R12C12.7    GTGTCAGAGCGAAATTGGATAAC GCACTATCTCAGGCAACTCAAAT II-4D23
46  C1  II  R12C12.8    ATTAAACATCTTCGACGGCTGTA TTGTTACATGCAAAAAGATGTGC II-4F01
46  C2  II  R12C12.9    ACAAGAAGTTGAAGCCAAAAACA TCCTTCCTGAGAAATCAAATCAA II-4F03
46  C3  II  H12I13.a    TTGTTTGTTGTTTTTGCGTAATG CTCTCAACCCGTATTTCTCAATG II-4F05
46  C4  II  H12I13.b    GGATTTCTTTTTCTCTGCACCTT CATTTCATATCAGCAAATGCGTA II-4F07
46  C5  II  H12I13.c    TCGAGTCATCATAAAGCCAAAAT GTTAAAAACGGTTTGTCAAGTGC II-4F09
46  C6  II  H12I13.d    TTCATGTCCTCATTCGTTTTCTT CACATACCAAAATCAGACGAACA II-4F11
46  C8  II  F21H12.1    ATGGCAGGGTGCTGATTTAC    CCTCATCCGAACTAGCAAGG    II-4F15
46  C9  II  F21H12.2    AACCGTAGTGAAAGATCCACGTA TTTCTCATCAACGTTTGCCTTAT II-4F17
46  C10 II  F21H12.3    CGATAATCGATTGAAAATTGCAT CGGACTAATTCTTCTCCCAGTTT II-4F19
46  C11 II  F21H12.4    ATCGAATCCGCGTTGAATAC    CATCCACTTGCATCGACATC    II-4F21
46  C12 II  F21H12.5    ACCTTAATCATCGCCGTGAC    TGCGTGTCGTGTTATCCAAT    II-4F23
46  D1  II  F21H12.6    GTAGAAAGCGCAGGTCCTTG    GATGCGTTGCTTCTCAACAA    II-4H01
46  D2  II  C29H12.1    CAAGTCAAGTCCGAAAAGCC    TTCCAGGTCGTACCATCACA    II-4H03
46  D3  II  C29H12.2    CCAGTTTTCAAATGCTCCGT    ACATGCCGTTGTTTTGTTCA    II-4H05
46  D4  II  C29H12.3    TCCGTGTGTTCTTGTTCCAA    CTGATCTTCAAGCGGGAAAG    II-4H07
46  D5  II  C29H12.5    ATCCGAAATTTTGTCGTTCG    GAACGAAAACCGAAACCTCA    II-4H09
46  D6  II  C29H12.6    ATGATGAATTCTTTGCGTTGAGT ACTTTCTTTTGTTGTCCTCCTCC II-4H11
46  D7  II  F57F10.1    CACCAATGTGAAGGTGTTCG    TGGGAGGGTCCAGTAGTTTG    II-4H13
46  D8  II  H35N03.1    CCATTTTATCTTCACCATTTGGA AAACCGGGAAGTTACTTTACAGC II-4H15
46  D9  II  F40H3.1 TTCCTGAAATGATGGTGCAA    AAATTAGAGGACGCTCGCAA    II-4H17
46  D10 II  F40H3.2 TTTCCCGAAACATCTGAAAGTAA ATGATACAAGGAGAAGACGTGGA II-4H19
46  D11 II  F40H3.3 CGCATTTTCCTGAATTAGTCATC TACATTACTTGTGAAGCCGACCT II-4H21
46  D12 II  F40H3.4 ATCTGAGGATGAATGACGGC    GGCTGAGGTCAACATCTGGT    II-4H23
46  E1  II  F40H3.5 TACGGGGTTCCGTTTTATTAGAT TCGAATCGTTCAATTTCTTGTTT II-4J01
46  E2  II  C30B5.1 TTGAAACACAGCATGGAAGC    CGAACTCGCCAGTGTTGTAA    II-4J03
46  E3  II  C30B5.2 CGGTCATATAACTTGTTTCAGGG TAGGAGATGATGACCAGACGATT II-4J05
46  E4  II  C30B5.3 TGGCCATCAAAACATTACGA    AGATTTCGGTCGCTTCAAGA    II-4J07
46  E5  II  C30B5.4 CTTGCTGCTTTCTCTGCCTT    AGACTTTCGACCGTACCCCT    II-4J09
46  E7  II  C30B5.6 TACGTTTGAACTCCTTGGGG    AGTTGGAAGGAATTCAGCGA    II-4J13
46  E8  II  C30B5.7 GAACCGGTGCAGTTTGAAAT    GATTTCTTGGCGTTTTTCCA    II-4J15
46  E9  II  T24H7.1 TTTCAATGCCGCATAATTCA    ACATCAATCCTCCTGTTGGG    II-4J17
46  E10 II  T24H7.2 TTGACCTCGGGACTCAATTC    AGATACAACGGTGGCTTTGC    II-4J19
46  E11 II  T24H7.3 CAATTCACTGTGCCATGATTTTA ACGCAAATTTGAGCAATGTAACT II-4J21
46  E12 II  T24H7.4 TTGAAACAATACATCTTTGCGTG CCGTAATAAAATCATGGCACAGT II-4J23
46  F1  II  T24H7.5 GCTTCTTCAGCATCGGTTTC    GCCGAGCTGAAAATTGAAAA    II-4L01
46  F2  II  F13H8.1 TTCCACCGTCACTACAAGTTTTT AATTGCTCATAGAAATTGCTCCA II-4L03
46  F3  II  F13H8.2 CGCATTGGAGAGATGGTTTT    TTTCATCGGTTTTCTCCCAG    II-4L05
46  F4  II  F13H8.3 ACCGATGGGGTTTATGATGA    ATGCAAACCCATGTCCAGTT    II-4L07
46  F6  II  F13H8.5 CAAAAGCTGAAGGAACTCGG    TCAATTGTCCCCAACCTCAT    II-4L11
46  F7  II  F13H8.6 GCCAAAATCAAGTCAACAATTTC GAACAAATTCAACAGGCTCAAAC II-4L13
46  F8  II  F13H8.7 TCGATACCCCAGAGTGGTTC    TCGCAATTTGTCCATTTTCA    II-4L15
46  F9  II  F13H8.8 TCTCCAGTATTTGGCCGTTC    CCAGCTGCAAACGTTGATAA    II-4L17
46  F10 II  F13H8.9 TCGTTTTTGTGACAAGCTGC    AAGGCTGCTGATGCAATTCT    II-4L19
46  F11 II  C29F5.1 AAACGTGAGAGCGAATCATCTAC TTGGACAAGACATTGACAAGATG II-4L21
46  F12 II  C29F5.2 TCCTATTCCTGACAGCTTGTTTC ATGCTTTCTTGAGAAGTTGCTTG II-4L23
46  G1  II  C29F5.3 ACCCGTCAGGTCATTCAAAG    GTATTGTGACATTCACGCCG    II-4N01
46  G2  II  C29F5.4 TCGATTTGACGATCACAGGA    CCAAGAAGGCATTCGAGAAG    II-4N03
46  G3  II  C29F5.5 GGAGAGTACCCAAAGTTCCAGTT CTCAATAGTTTTGACATTTCGGG II-4N05
46  G4  II  C29F5.6 TGCTTAAGGTTTGGAGGTCG    GCATTGGGCTACGTTTTTGT    II-4N07
46  G5  II  C29F5.7 TTGCAAATGTTGATTCAAGTGAC CTTATTGTAGTTTCGATGGTCGC II-4N09
46  G6  II  C32D5.1 TCGACCATCAAAGATCCCTC    TGCGATCAAAAATTCAGTGG    II-4N11
46  G7  II  C32D5.2 CAGCTGTACACGGAACTGGA    TCAACTTTACGCTGCGATTG    II-4N13
46  G8  II  C32D5.3 GAACCAAGGCAAGAAGCAAG    GGTTCAGCGGTTATTGGAAA    II-4N15
46  G9  II  C32D5.4 GTGAGACAGCGTGAGGATGA    TTTTGGAAAGTTCAGTCCCG    II-4N17
46  G10 II  C32D5.5 TTTCTTTGGGATCGCTATGG    TTAAAATTTCAGGCGACGCT    II-4N19
46  G11 II  C32D5.6 AAACCATTTTTGCCAATGGA    CACCCCAAGCTTCATCTCAT    II-4N21
46  G12 II  C32D5.7 TGTCCAACATCAGGCAGTGT    AAATCACCAGTTGTCTCGGC    II-4N23
46  H1  II  C32D5.8 CTGACCAATTAAACGTTCACACA GGACTAAACTCTCCTTGTCCCAT II-4P01
46  H2  II  C32D5.9 TGACATTTTCAGACGATGACAAC TGTTATCGAATCGGTCAATCTCT II-4P03
46  H3  II  C32D5.10    CCATTCAATGCTGCATCAAC    ATGGATTCTCCGAGCACAAG    II-4P05
46  H4  II  C32D5.11    CAAAATGCTTCTGGTTCGGT    TTATGCTGAGTCGTCCATCG    II-4P07
46  H5  II  C32D5.12    TTATCGTATCCCCATAGGCG    GCTTATTGCCCAATTCCAAA    II-4P09
46  H6  II  K10B2.1 AGTCGAGACATGTCAGTGCG    GCAGAGGCATATTTCCGAAG    II-4P11
46  H7  II  K10B2.2 AGCTGCTCCAGCTACGGATA    TGGTAATCCGACGGCTATTC    II-4P13
46  H8  II  K10B2.3 GTTACGGTAATCGTGGTGGG    AATGGTCGAGTTCCGTTCAC    II-4P15
46  H9  II  K10B2.4 TTTGTAGCCTTCGTTGAACATTT GTGTCCACTTCTCTTTTTGTTCG II-4P17
46  H10 II  K10B2.5 CCACAGAATCTGAAGTCGCA    TCGACGAACACATACCAGGA    II-4P19
46  H11 II  F58F12.1    TTGTTTGTTCCCCAAATACAATC CCTATAAGCAGCATCGAGAGAAA II-4P21
46  H12 II  F58F12.2    ATTTGGTTTCAGAACGAAAGACA TCATTTCACCATTGTAGCTGATG II-4P23
47  A01 II  F58F12.3    GATCATTGAGGCGGTGAGTT    ATTCAACGTTGGCAAAAAGC    II-5A01
47  A02 II  T25D10.1    TCGAAACGAAACTACTTCGAAAA CTGATAAATTCCAGAACACTGCC II-5A03
47  A03 II  T25D10.2    AATGTCCTAATGGAAAACACCCT TAAGGCATCCAAGAAGGAACATA II-5A05
47  A04 II  T25D10.3    GTCCATCGAATCCCTTGAAA    TCCTCCATCGGTAGGTCAAC    II-5A07
47  A05 II  T25D10.4    TGTGGGAGAAGGTGTAAGTTGTT TTTTAAGAACGAGATGGTTTGGA II-5A09
47  A06 II  K03H9.1 GTTGCCAGGAAATTTTTCTACCT TGCCAGATATCTCAGCTTTCTTC II-5A11
47  A07 II  K03H9.2 TTCTAATCCGTGGAACCGTC    ATGAAACAAAACGCAGGAGG    II-5A13
47  A08 II  K03H9.3 GCAATACGTCATGGTGTTCG    CTCCATCCGTTTCACGTTCT    II-5A15
47  A09 II  K06A1.1 TAGGCTCCGCCCTTTTTATT    CCGGATCGATTGCTAGAGAG    II-5A17
47  A10 II  K06A1.2 TTCCAACATTGAACGAAACTTCT ACACTTGACACATGACTAGGGCT II-5A19
47  A11 II  K06A1.3 TGCGACAACATCGTTTCAAT    TGTGGTTGTTGGATCAAGGA    II-5A21
47  A12 II  K06A1.4 GAAGAAGCTGACCAACTCGAATA TGGAATCAGGGATTAATGAAATG II-5A23
47  B01 II  K06A1.5 TACGTTGCATCTGAAGAGCG    TTGGCTGACAGTGAATCTCG    II-5C01
47  B02 II  K06A1.6 TCCAACCACAATTACTGGCA    TGTTGGATGGGTGCTATCAA    II-5C03
47  B03 II  T28D9.1 TGTTTTTGAAACGACAACACATC CTAATTAGATTCCTGCCCTTCGT II-5C05
47  B04 II  T28D9.2 AAAACATCTGCATCAAGGAAAAA AGTAATCGTGGTGAGACCTGTGT II-5C07
47  B05 II  T28D9.3 GTTCCCACTCTGCTTGGTGT    ATTATGCACTTTGCGGAACC    II-5C09
47  B06 II  T28D9.4 CAGTAGCTCCGTTGGCTTTC    TTGCTTTCGCATTAGCCTTT    II-5C11
47  B07 II  T28D9.5 ACAAGTCAGTGATGCACTTCTCA GTGCTCAAGAAGCTGTTTCTCTC II-5C13
47  B08 II  T28D9.7 TTCATCTGAGCCCATATGTTTTT GCACGTATTTATGCCAGATTCAT II-5C15
47  B09 II  T28D9.9 AGATGCTGTTCAAAATCCAGGTA TTTTAAAATGCTCAACTTCCCAA II-5C17
47  B10 II  T28D9.10    ACTTTAACGGGAACAAAATGTGA TTTTTCCTTGATGCAGATGTTTT II-5C19
47  B11 II  T28D9.11    ACACAGGTCTCACCACGATTACT CTATCGCGGAAAGAGACATCTTA II-5C21
47  C01 II  R05G9.b TCTTTTCGACTAACAAGATTCGC CTTGCAATTACCAAGAAATCGTC II-5E01
47  C02 II  R05G9.c ATCCAACCTCTCACTGCAATAAA TTTGAGGAAACCATCAAGTCCTA II-5E03
47  C03 II  R05G9.e TTTATGGGGTTATTCTTGTGGTG CCCTTCAAAAAGAAGAGGATGAT II-5E05
47  C04 II  R05G9R.a    GAGATGATCGGTCCAGAATACAG CTTACATTTTCGCCAATTCGTAG II-5E07
47  C05 II  C56E6.1 GCTCTTGGAAAAATTGCTGC    TTTGATCAATGCCAACCAAA    II-5E09
47  C07 II  C56E6.3 TTTTGTCGCAGTTCAACGAG    ACTCCGATCGCTTCAAGAAA    II-5E13
47  C08 II  C56E6.4 GATGATGTAATGGAGAGATGGGA TTCTTTCTTTTTGTTCGAAATGG II-5E15
47  C09 II  C56E6.5 TGCAGCAGTTACTGGGAATG    ACAAGTGGAGCAGGAGGAGA    II-5E17
47  C10 II  C56E6.6 TTCGATTTCCTGCCAAATTC    TGTGAATGCATTTCGTGGAT    II-5E19
47  C11 II  F18C5.1 ATTCCGGAAGGCTTCAGTTT    TTTGTCGTCAGCACGTTTTC    II-5E21
47  C12 II  F18C5.2 GAAACAGAACCTGAAAGCGG    TGTCCCCATTGAGAAACACA    II-5E23
47  D01 II  F18C5.3 ATGTTGTGAATGAGCACCCA    TTAACGCCAATCCAATGTGA    II-5G01
47  D02 II  F18C5.4 TTTTGATGATGCATGGAGGA    ACAGATGGCAACCAACAACA    II-5G03
47  D04 II  F18C5.6 CAGAGGAGTGTGCCATTTTTATC CACGCTATTGTATATGCCAGTGA II-5G07
47  D05 II  F18C5.7 TAATACTTTGTCGCGTATCCGTT TCCGTCGACTATTTGGAAAGTAA II-5G09
47  D06 II  F18C5.8 CACTGCAGTTTGGCATCAGT    CTCAAATGCTCCATGCTCAA    II-5G11
47  D07 II  C56C10.1    GCTCGACCAGATCAACCAAT    TAGGTAATTCCGCCGTTGAC    II-5G13
47  D08 II  C56C10.2    ATATTACCACGCAGGAAGACTCA CAAAAGCGAGATCGATTCTTCTA II-5G15
47  D09 II  C56C10.3    CCTACCACTTCCTTTTAAGCGTT ATTGTAGGATTGATGAAGGGGAT II-5G17
47  D10 II  C56C10.4    CGGCTCTCAGTTTAGAAAAACAA ACACAAAGACAATGGCTGAAAAT II-5G19
47  D11 II  C56C10.5    CCAAATTTTCCCAAGGGTTT    TCATTGGTCAATTGCTGGAA    II-5G21
47  D12 II  C56C10.6    CGACATATTAATTTTCTCAGCCG CAATTTCTTTTTGCTGCAAGACT II-5G23
47  E01 II  C56C10.7    AGTCTGCAAGACACTTCAAAAGG CTCTGCGGGGTAATTTTAGTTCT II-5I01
47  E02 II  C56C10.8    CGTACCGTTCATCTCACAAAACT TCGATCTCGTAGGTGTATTCGTT II-5I03
47  E03 II  C56C10.9    TTCGAAGCAAGTCGGAAGTT    TCATGTTGAACTGATGCCGT    II-5I05
47  E04 II  C56C10.10   CCTGGAATCGATTATGGGTG    CAGAATGTCGGTCAGAGCAA    II-5I07
47  E05 II  C56C10.11   CAACTGCCCATTTCGATTTT    TGTCGCATTTGCTCAAAAAG    II-5I09
47  E06 II  C56C10.12   TCTCGTCACCTCATGCTTTG    GCTTCAAAAGTTGGAGACGC    II-5I11
47  E07 II  F54H5.2 TCCATCGTGATCTGAAACCA    CTGATTTTCTCCTTGCTCGC    II-5I13
47  E08 II  F54H5.3 ATCAAGGGACCTGGAGGAAC    GACGACCCAGCTCAACTCTC    II-5I15
47  E10 II  F54H5.5 CATCCGAAACTTCGTTTGGT    CGCTTCCAAATTTCAGCCTA    II-5I19
47  E11 II  T19D12.1    CTGCTGCAAGTGTTTTCCAA    ACTCACTCGGAAATTGTGGC    II-5I21
47  E12 II  T19D12.2    CAACGCATTTGTGGAGAATG    GAAGGGGAGAAATTGCATCA    II-5I23
47  F01 II  T19D12.3    AGAAGCACTCAACCAATCCATTA TGCAAGAACTTCCAGATAAGCAT II-5K01
47  F02 II  T19D12.4    TGAATCAAATGCAAATCGGA    GCAAACATCGAGAAGTGGGT    II-5K03
47  F03 II  T19D12.5    AGCTCGTAATCTTCCAGGCA    CGCGTTTTCTACTTTTTCCG    II-5K05
47  F04 II  T19D12.6    GACCATCTGGTGATCCGTCT    CGGCTCCTGATAGCATTCTC    II-5K07
47  F05 II  T19D12.7    AGAAGATGAAAGCGGTGCAT    CGAGGTGAGCCCACTCTTAG    II-5K09
47  F06 II  T19D12.8    GATTGTGACAACAAACGTCAGAA GAACAATTGGATAGCGAATCTTG II-5K11
47  F07 II  T19D12.9    AAAAACTGCCCATTCTGACG    CAGGTACGTGCCCCTTTCTA    II-5K13
47  F08 II  T19D12.10   CCGAAATGAAAGGACATCGT    TTCTGCAGCTCAGCAACATT    II-5K15
47  F09 II  H43E16.1    CATCTACACAAACCACACAAGGA ATCCAACAGTCGATCCTGAACTA II-5K17
47  F10 II  C18H9.1 ATTGGCAGAATATCAAGCAAAAA CATATGTGTTTGCGAGGTACAAA II-5K19
47  F11 II  C18H9.2 CGTCAGCCAATTATAGTTTTTCG ACTCTCCCCATAAAACACCATTT II-5K21
47  F12 II  C18H9.3 TTGGGCTGGAAAGAAAATTG    GGGTGATGCTGGAAGACATT    II-5K23
47  G01 II  C18H9.4 CTACCCAAGGATCGTCCTCA    GAATGTAGTCATTGCGGGGT    II-5M01
47  G02 II  C18H9.5 TAGACTCCGCCCATTTCTTG    CCAATGCCAACATGATTCTG    II-5M03
47  G03 II  C18H9.6 CATTTTCCGTTAGAATCAGTTGC TACATATTCCAAAACCACCCAAG II-5M05
47  G04 II  C18H9.7 TGGCTTCACTCTCTCCCAAT    AAGCAAAGCAACACATGCAG    II-5M07
47  G05 II  C18H9.8 TAAAATTTGTAGCTCCTCCACCA AGTGCACTTTGCATATCTTCCAT II-5M09
47  G06 II  T14B4.1 ATGGATCAAAGTTCAAGCCG    TTGTTCGTTTAACCCCTTCG    II-5M11
47  G07 II  T14B4.2 TTGCATTTTTGACTAATCGCTTT GGCAGGAGTATCCACTAACTTGA II-5M13
47  G08 II  T14B4.3 CATATTGGATTGACCCACCC    CCGGAAAGCGATTAGTCAAA    II-5M15
47  G09 II  T14B4.4 CTTGCAGCTTCTTGTCTTTTCAT TGAAGAAAATTCAGTTCCAGCAT II-5M17
47  G10 II  T14B4.5 ATCGACCGTCTTTTCTATGTCAA CGAGGAATCGATACTTTTGAATG II-5M19
47  G11 II  T14B4.6 TCCGGAGTTCTTTCGATCAC    TTCACCATTTCCGTATCCGT    II-5M21
47  G12 II  T14B4.7 CCACGACTTCCACCATATCC    CGGAAGCAGACAATCAGACA    II-5M23
47  H01 II  T14B4.8 GGCGATCTCAGAATCAAAGG    TGCTGCCAGTTGAAAAAGTG    II-5O01
47  H02 II  T14B4.9 TCCATGATTCGACGTTTCAA    CAATTTTCATTTGAGGCCGT    II-5O03
47  H03 II  F41G3.1 ATTGCCATTTCCTTTCTTTCTTC AAGCCCAATTTTATTGTGGAAAT II-5O05
47  H04 II  F41G3.2 CAGCATTGATTGCGAAGAAA    AATTTCGATTTCCCCCAAAG    II-5O07
47  H05 II  F41G3.3 CACATCGATGAGCGTCAGTT    GAAACGCTTCGATTGTGTGA    II-5O09
47  H06 II  F41G3.4 CGAATAATTGGATATTGAACCGA CAACAACACGGAACAATAAGACA II-5O11
47  H07 II  F41G3.5 TCCATTTCAGGTCGATCACA    TTTCTAGATCCGGCGTCATC    II-5O13
47  H09 II  F41G3.10    ACGTGTTTTAGCTTTTGAGCTTG AACTGAAGCTCTTTGCGAAGTTA II-5O17
47  H10 II  F41G3.11    CCTTCAATTGCCTTCACTATTTG TAGCTTCTGGTTTCATGTTTGGT II-5O19
47  H11 II  F41G3.12    TATTGGAGCACCTTTCTGGC    AGCTGGAAGTCCCTGTGAGA    II-5O21
47  H12 II  T13C2.1 TTGACAAGTTCACGCTACGC    TCCAACCCAGTGGTTAAAGC    II-5O23
48  A01 II  T13C2.2 AATTTGCTGAATCTGCCACC    TTGTATGATCAACGGCTCCA    II-5A02
48  A02 II  T13C2.3 CTGTTGGTTGCCTTCTCCAT    ATAGATTTGTGGAGGCAGCG    II-5A04
48  A03 II  T13C2.4 AATTTGATTGTGGGGATGGA    CTCTCGGTTCTTCCAAGTCG    II-5A06
48  A04 II  F31E8.1 TCATTGAAGATGAGGTGGTTTCT AAAGATGAAGAAGTCGGGGTTAG II-5A08
48  A05 II  F31E8.2 ATAACGATTGTCTCGGTTTTTGA GAAAAAGGACAAGCAGGAAAAAT II-5A10
48  A06 II  F31E8.3 CTTCTTCTCCTTGTCGTCTTTCA ATTCGCTCTCATTATCATTTCCA II-5A12
48  A08 II  F31E8.5 ACATTTTCCGATTTCCCACA    CACGGATCTGCTGATTCTCA    II-5A16
48  A09 II  F31E8.6 GGTGGGATTGAAATTCCCTT    CCAACTTCGCTTTTCAGAGG    II-5A18
48  A10 II  C04A2.1 CATCTTCTTCTCTGTTCGCTCAT ACACAGACACAAAATGCCTACCT II-5A20
48  A11 II  C04A2.2 AGATCTTGTGGTCCTCGGTG    CTGCAACATTTGAAGGGGAT    II-5A22
48  A12 II  C04A2.3 GCTTGAAGGTTTTTGAAGGATTT TTGTAACACTGTGGAACGATTTG II-5A24
48  B01 II  C04A2.7 CGAAGAAGCAAAGATAGACGAAA GATAGCGCTGAGAAGAAACAAAA II-5C02
48  B02 II  C44B7.1 ATTCATTGTAAAATGGGCATACG ACATTAGACATTAGCACCGGAAA II-5C04
48  B04 II  C44B7.3 TTCGCGAAGTTGTTGTTGAG    CCGTTGCCATATGTCTTGTG    II-5C08
48  B05 II  C44B7.4 CGTGCGAACAAGGGATTATT    GGCTGTGGAAATGGTTATGG    II-5C10
48  B06 II  C44B7.5 TTGGTTTCGAGTTTTCAGTCAAT CACAATTTGATTTTGGATGGAAT II-5C12
48  B08 II  C44B7.7 TGGCTATGTCTTGTGATTTGATG TAAATTCACGCTGTAAAAATCGG II-5C16
48  B10 II  C44B7.9 CTCCTCCTGACAGTACATCCATC TCTTGGAACATCACTTGGATTCT II-5C20
48  B11 II  C44B7.10    AATCCATGAAAACGACGAGC    GGGTTTAACTTTTCGGCACA    II-5C22
48  B12 II  C44B7.11    GGATAGACGCCAGATTGGAA    TTAGGCCAGCTCACTGGAAT    II-5C24
48  C01 II  B0252.1 AAATTGCATCAATGCGTCAA    ATCATTGTTCCCGCAACTTC    II-5E02
48  C03 II  B0252.3 TCGACCAAACTCATGAGCAC    TGGCTTTGACTCTGTGCAAC    II-5E06
48  C05 II  B0252.5 ATATGCCACGTGGGTACAGATAC TCTCATAGTGTAGGCGAAAGCTC II-5E10
48  C06 II  B0252.6 TAGTTTTCATAGTCGCCGTGAAT GGAATGGATGATTGGAAGTGTTA II-5E12
48  C08 II  F22D3.2 TCAGACAGTTTGGATTTCAGGTT CCAACTGAAGAATCGAACAAATC II-5E16
48  C09 II  F22D3.3 GAATGTCTCTGGAGACGAAGAGA TCGACGGTACTCCACCTTTAATA II-5E18
48  C10 II  F22D3.4 ACTGAGTCAGAGCAGTTATTCGC TTTTCTTTGTTTAGCAGCTGAGG II-5E20
48  C11 II  F22D3.5 GATGAAGTTTCCTTTTCCTTGCT TTGAGTAACTACCGACCGTGAAT II-5E22
48  C12 II  F22D3.6 GTTGATGAGCATCTGCTGGA    CCTGATCCGGAACAACAAGT    II-5E24
48  D01 II  C15F1.a AAAGTTGATTGCAAAACGTCTGT CTTGAACCATGAACTGCAACATA II-5G02
48  D02 II  C15F1.b CTTGTTGATAGTTTAACGGCTGG TGTTCCCTAGAAAATTCGTTGAA II-5G04
48  D03 II  C15F1.c ATACAATAAATATTCGGCGCAAA ATAGCGACCCGTAAAAGAAAATC II-5G06
48  D04 II  C15F1.d TGAAGAATGAAGTCAAGGGTGTT CATGTGAAGAAGCAACTCAAGTG II-5G08
48  D05 II  C15F1.e AAGAGAAAACACAAAAAGGCTCC CTGGCTAACGACACTCCGTAATA II-5G10
48  D06 II  C15F1.f ACAATGGTTTACCATGAAATTCG TTCAGAGGCTTCTTCTTGAAATG II-5G12
48  D07 II  C15F1.g GAAAATTGTCTACGACCTTCACG CAGTGAAACAATGATTTGGAACA II-5G14
48  D08 II  C15F1.h GTCCCACACTCTCAGCAAATAAC CCTTATACAAAAGGCTCTCAGCA II-5G16
48  D10 II  C52E12.2    TCCTGAACACATGCAAGAGG    CAACAGCTGGTTGAGCACAT    II-5G20
48  D11 II  C52E12.3    GCACATCAATTGGCATTGTC    GGTCAGTTACGCCCGTTTTA    II-5G22
48  D12 II  C52E12.4    TTTGTTTTTGAGACCATGCG    TGCGAAGACCCTCTCGTACT    II-5G24
48  E01 II  C52E12.5    TATAGTCCTGGAGGTCAAGTTGG ATGTGACGCTTGTCGATTATTTT II-5I02
48  E02 II  ZK1127.1    GGGAAATTCAAGCCATTTGA    TTTCTCGATATTGCGGCTCT    II-5I04
48  E03 II  ZK1127.2    AGCCTCTCAAGCATTTCCAA    TGACCAACCGTGTTGATTGT    II-5I06
48  E04 II  ZK1127.3    CTGTTGCTGTTGTTGTTGTGTTT AGCCGGTACTAGTTTTAATTGCC II-5I08
48  E05 II  ZK1127.4    AGCATATCCACCATCGGAAG    CCATCGGATCCTTTCTTCAA    II-5I10
48  E06 II  ZK1127.5    GCGGAAGACCCATCAGAATA    TACACCAACAGCGGTAACCA    II-5I12
48  E07 II  ZK1127.6    ATTTGTGGCGAATCTTGGAG    GATGGAGAACGGGAAAGTGA    II-5I14
48  E08 II  ZK1127.7    GGACGCGACAAATATGGAGT    TGTTCGTGGACCATCCAGTA    II-5I16
48  E09 II  ZK1127.8    CAATGTCCTTCGTTTCCTTTATG CTCTGACATATCATCGCATACCA II-5I18
48  E10 II  ZK1127.9    ACCGATGCTGTTTCATCTCC    TGTACAGTCGGCTGCTATCG    II-5I20
48  E11 II  ZK1127.10   AGCAATCAAATGGAGATGGG    CTTCGGAACTGCTGCTATCC    II-5I22
48  E12 II  ZK1127.11   CAGTTGGGCAGTTTGTTTCA    GAATCGGAAGCCAAAATCAA    II-5I24
48  F02 II  T02G5.1 GAATACGGTAGGACAGTTTGCAG CAACTCCTCATTTTTACCCCTTT II-5K04
48  F03 II  T02G5.2 AAGTGGAAGAGGACGAGATGTTT ATCCAAAGTTCGATGCTAATTGA II-5K06
48  F04 II  T02G5.3 TCTCATCTCTAACTATGCTCGGC ATCTAAGAAGTTTCGGTCGTTCC II-5K08
48  F05 II  T02G5.4 AAGCCGAGTTCAATTCAGGA    TTTTTGATGAAAGCAAGGGG    II-5K10
48  F06 II  T02G5.5 CTCCTGTAAGACGGCAAGAGATA CACCATAAACATTTTTACGCCAT II-5K12
48  F07 II  T02G5.6 ATCGTATCTTCTCCAGAATGGGT ATATCGGGTCCAACTCGTTTATT II-5K14
48  F08 II  T02G5.7 CAGTCTATCGCAATGTCGGA    TCGCTACTGCACCTCCTTTT    II-5K16
48  F09 II  T02G5.8 CTTCTGGGCTGAAAGCAATC    AACCATTCCACTTGAGCCAC    II-5K18
48  F10 II  T02G5.9 GAAGGACTTCCTTGATGTTGTTG GATTTTACAACTCACACCTTGCC II-5K20
48  F11 II  T02G5.10    TATTCTCAAATGGTGCATACGTG AAGCATAGTTTGCTGGAATGAAG II-5K22
48  F12 II  T02G5.11    AACATCAAAGATCGGAAGAATCA TCTCTACACACGCGTAGCAAATA II-5K24
48  G01 II  T02G5.12    CAGCTTCTGATCAGCCACAA    GAGCTGGAGTCGCTTTTGTC    II-5M02
48  G02 II  T02G5.13    TTGATCCTGTCGCCTTCTTT    TTCAGACACGCATCGTTAGC    II-5M04
48  G03 II  F10E7.1 ATTCTTGAACCAGCTCGTGG    CTTCGGAAATCCCATTCTCA    II-5M06
48  G05 II  F10E7.3 TAAGAGGGGTAACGAGGAATCTT TAGTCATCTCCCAAATGACCAGT II-5M10
48  G06 II  F10E7.4 CAATGTGGTCACGGAATGAG    CACATGAAACAGAGCAGGGA    II-5M12
48  G07 II  F10E7.5 AGTTTTGTTTCGTGTTGTTTCGT TGTTCCTGAACAATCAGCTTTCT II-5M14
48  G08 II  F10E7.6 TCCGAAAATTGTCGTTTATCATC GGACCTAGTCGAACAGAGGAAAT II-5M16
48  G09 II  F10E7.7 TTGTTATTTCGTCGCTATTTCGT TCCTTAAAACCTTAAATCGCTCC II-5M18
48  G10 II  F10E7.8 CGGTTTTCGTTTCTGGGATA    TGCCAGTTTAGCCGATCTCT    II-5M20
48  G11 II  F10E7.9 GGAGCGATTTAAGGTTTTAAGGA TTGGAGAATTATCTGCTGTTGGT II-5M22
48  G12 II  F10E7.10    CTCCATTAGGGCCAGTCAAA    CGTAGATGGACGGGAAAATG    II-5M24
48  H01 II  F10E7.11    AGGAGGCTTCAACAAATCCA    CGTGAGTATCGTCCAGCAGA    II-5O02
48  H02 II  T07F8.1 AGGCGAAATAGAATTCGAAAAAC TCAAATTCGAAGGATTGAACTGT II-5O04
48  H03 II  T07F8.2 TATTCCCCTCTCCGCCTAAT    CAGCTGTGAGTTCCGATTGA    II-5O06
48  H05 II  T07F8.4 GTAAGAGTTGATGGCTCCTCTGA GAGGAGGAGCTTCTAGATGAAGG II-5O10
48  H06 II  C27H5.1 GTCTGTCGTCATTTCCTCAAAAC GGGAAGGATTAGAAGGGAAAAAT II-5O12
48  H07 II  C27H5.2 AGCGCCAACACACTTCTTCT    TTGCCCAATTCTCATTCACA    II-5O14
48  H08 II  C27H5.3 AGGTGTATTATTGCGCGGTC    CTATTTCCGCACTGCTCACA    II-5O16
48  H09 II  C27H5.4 GCACAGATTGCAGGGAAAAT    GCCTTGTTGGAGCTCAATTC    II-5O18
48  H10 II  C27H5.5 TTTCGAGCGAGCGTTTATTT    ACGATCAGCAGCAACAGATG    II-5O20
48  H11 II  C27H5.6 GATCAGCAACCAGCACAAAA    TTTCAGAGGATGTTCCCAGG    II-5O22
48  H12 II  C27H5.7 AAACGCTTTCGATGCGTAAT    TTCCAAACAGTCCTTTTGCC    II-5O24
49  A01 II  C27H5.8 AAGATGCATTGAACATGCCA    TTGATTGGAAAGGAACGGAC    II-5B01
49  A02 II  E04F6.1 CACCTGCAATGACAATACGG    TGGAAGCATTGATTGAACGA    II-5B03
49  A03 II  E04F6.2 TTAAAATTCCATCACGCTGTCTT GGCCTTTATCATAATGAACACGA II-5B05
49  A04 II  E04F6.3 GTGCTCGAGCGAAAGAAGAT    GGAACTGTTGGAAGTTCGGA    II-5B07
49  A05 II  E04F6.4 ATGGTTTGCAGACCGAGTTC    TCGGATGGCATTATCGATTT    II-5B09
49  A06 II  E04F6.5 CTTGAAACAGCCAACCCAAT    GACCAATTCGCTGAGCTAGG    II-5B11
49  A07 II  E04F6.6 GAACCGCCAAATTTGAAAAA    GAAGAAGGCATAGGTGAGCG    II-5B13
49  A08 II  E04F6.7 CAAGCCATGAATCTCGGAAT    ATTTGCCACCTTTTTGTTCG    II-5B15
49  A09 II  E04F6.8 AGCAACCATTCTGAAAATGAAAA TGAGAAAACTTTGTTTCAGGAGC II-5B17
49  A10 II  E04F6.9 GTCACGCCTATTTCTGTTCTGAC ACTTCCTGATTGTTCCATTTTCA II-5B19
49  A11 II  E04F6.10    CAATAACATCTACACACTCGCCA GCGTTTATGGAAGAATATGCAAG II-5B21
49  A12 II  E04F6.11    ATCATTTGGTGGAGCAGTCC    GGTCAAGAAACGGAAAACCA    II-5B23
49  B01 II  E04F6.12    ACGAACAGAAGGAACAAAACTGA TTTAGCTCATCCCGTATTTTCAA II-5D01
49  B02 II  E04F6.13    TACCCATTCAATAATTGCCTGTC GCTTCTGAACCATTCTCTTGAAA II-5D03
49  B03 II  E04F6.14    GGATCTAAGAGTCCCGGTAGAGA TCTTACACCCTGAAAAATGTGCT II-5D05
49  B04 II  F32A5.1 ATCGCCGAGGTCACAATTAC    AATTGCGCCGAGAGTTTCTA    II-5D07
49  B05 II  F32A5.2 TTGCCATTTGACCAGAACAA    GTCTCGCCACTGATTGAGGT    II-5D09
49  B06 II  F32A5.3 ATGCCCTTACCCTTTGGAGT    TCCTGCACGATCATATGGAA    II-5D11
49  B07 II  F32A5.4 AGCTCTGTGTGCAGTTGGTG    CTTTCGGAAAATGGCAAAAA    II-5D13
49  B08 II  F32A5.5 GCATTCCAAGGGAGAAATGA    ACGAGCAGTCTGCACCCTAT    II-5D15
49  B09 II  F32A5.6 GGTATGGGCAGAAAAGCTCA    TTTGCTCGACTTGCAGAAGA    II-5D17
49  B10 II  F32A5.7 TAAAAGAGTGGGAGGACAGATGA TAGTGAAAAACAATCACAACCCC II-5D19
49  B11 II  C30G12.1    GTCCGTGGCAGAATTTGTTT    GGGACCCGATAGGAAAAGTC    II-5D21
49  B12 II  C30G12.2    AGCGGATCCAGAAGTTGAGA    CACAACAAAAGGCGGGTATT    II-5D23
49  C01 II  C30G12.3    GGTAGATCAATTGTTTGGCTGAG AATGTGATGGTTTTCTGACGAGT II-5F01
49  C02 II  C30G12.4    TCTCTGTCACTATTCACCCGATT CTGAATGAACATACCATTCCCAT II-5F03
49  C03 II  C30G12.5    AGGTTGTCATGTGGGATTATTTG CTTGCACCAGAGGAAATTAAATG II-5F05
49  C04 II  C30G12.6    CCATCCATCGGTTTTTCACT    AAACCGTTTTCGCACAAATC    II-5F07
49  C05 II  C30G12.7    TCTGAACAACGTAGTTGGCG    TGCCACAGGCATATTTTCAA    II-5F09
49  C06 II  F45E12.1    CCTTTGCTTCTCTTCAACTTTCA TGTAGAACCCGTTGCAGTACTTT II-5F11
49  C07 II  F45E12.2    CTCACGTTGAAGCTGCACTC    GCTTCAGAAACGATTGGCTC    II-5F13
49  C08 II  F45E12.3    ATTTTGATTTCCAGCGAACG    TCAATTTCTCTCCGCGTTTT    II-5F15
49  C09 II  F45E12.4    AACTATCTTGCAACAATCCTCCA TGATAACTCTGCTCTCGGAAAAG II-5F17
49  C10 II  F45E12.5    TAAAATGCTCCATTCCACACTTT GGAACGTACATACTTGTGCATGA II-5F19
49  C11 II  F45E12.6    TTTTTGTTCCTCTCCACATCAGT TATCATTGTTCCCTCATTGCTCT II-5F21
49  C12 II  F21D12.1    AAAGAAATGCATGTCGATCTTGT TGGAGTCCAAAACCTTAACTCAA II-5F23
49  D01 II  F21D12.2    TGAAATTTAGGGAATAATTGGCA TGTAGTTTTTGAACGCGGATAAT II-5H01
49  D02 II  F21D12.3    GGAACAGTCAGTGCGACAAA    CAACCTGGGAAGCACAAAAT    II-5H03
49  D03 II  F21D12.5    GAAGAATTGTTCACTGGGAGATG CCCGGAAATTAATGAAGGTATTC II-5H05
49  D04 II  F43E2.1 GGGCAGAACATTTTTGGAGA    TGCATCATTTGTCCTTGCAT    II-5H07
49  D05 II  F43E2.2 TTCAAGACGTAGCCAAAAAGAAG AATTTCAACATGTGTCCCGTAAT II-5H09
49  D06 II  F43E2.3 GGTTTTGCGACGGAATTCTA    TACCGTGAGCAAAGCAAGTG    II-5H11
49  D07 II  F43E2.4 CCTTCGTCCGGTTCATAAAA    CCCAACTACACAGCCCAAGT    II-5H13
49  D08 II  F43E2.5 TCTCCTCCTGACAGAGCATAGTC AGATTATCTTCGTCAACGTTCCA II-5H15
49  D09 II  F43E2.6 GAAAAACCAGCTGAAACTGCTAA TATATGCCTGCTCACATTGATTG II-5H17
49  D10 II  F43E2.7 GATGAAGTTGGGGACGAAAA    CAGGAGAAATTCGCCAAGAG    II-5H19
49  D11 II  F43E2.8 CGTAAAAATGAATGGTGGGG    TGACTCGTGCCAAGTTTGAG    II-5H21
49  D12 II  F43E2.9 TACTTGGAGCGTCCTAGTGAAAG GGAAAGAGACATGCTCAACAACT II-5H23
49  E01 II  F43E2.10    ACAATGGCAGGTTTAACTTCAGA TGAATTTTCCTCCAGTTTGTGAT II-5J01
49  E02 II  K02A2.1 ACAAATTACAAGCGTCGAAAGAG CTTTTGACATTTCCCTGAATGAG II-5J03
49  E03 II  K02A2.2 AATTCGGACCAGATGTTTGC    CCCAATAGAGCTTGCCGATA    II-5J05
49  E04 II  K02A2.3 CATTGAAGAGCAGCACCAAA    AACGGAGTCGTTGAATCTGG    II-5J07
49  E05 II  K02A2.4 GCACTTTAACCATCATCCTTGAG TCATCAGTTGACCAGTACGATTG II-5J09
49  E06 II  K02A2.5 AAAAAGACACGTGGATCGAGATA TGCAAAGGATAGGCATAGAACAT II-5J11
49  E07 II  K02A2.6 GCCAGTTTCTGTGCTTCCTC    GAAGCTGAAACTTTCGGACG    II-5J13
49  E09 II  Y9D1A.2 CGGAGTAAAAATCGAAACAACTG CAGAACAGAAGAAGAAGGAACGA II-5J17
49  E10 II  D1022.1 ACTAAAAATGCCGGTGAGTCTTT GAATACCAGAGGTTGTGGATCTG II-5J19
49  E11 II  D1022.2 CTCTAGGCTCTCCAAATCTCTCC ACGGGTTAACATTGTTTGTCGTA II-5J21
49  E12 II  D1022.3 ATTTCGAGAAAAGTACGAGGAGG TTGAAAGCTATGTCGATTCATCA II-5J23
49  F01 II  D1022.4 CATGCGATACAAAGACAAAATCA TTGCTACGCACTAATGAAACGTA II-5L01
49  F02 II  D1022.5 ACATAGTTTCGGGAAAGTTCACA GGAGAGATTTGGAGAGCCTAGAG II-5L03
49  F03 II  D1022.6 AAGACATTCCAGGGACATCG    AATCACACCAAAATGGGGAA    II-5L05
49  F04 II  D1022.7 CGGTGATGTTTTTCCGAGTT    GCAAGAGACACGGAGCCTAC    II-5L07
49  F05 II  D1022.8 GCAAGAACGCGAAGTTTTTC    CCCGACTTCTGGGGATTATT    II-5L09
49  F06 II  R10H1.1 TGAATCATCCGGTCTTCACA    ACCTCCCTCCTGGTTGTTCT    II-5L11
49  F07 II  R10H1.2 AAACCAGTGTGGCAACTTCC    TTGCCATCTCAAGTTCAACG    II-5L13
49  F08 II  R10H1.3 CACCATAAACATTTTTACGCCAT CTCCTGTAAGACGGCAAGAGATA II-5L15
49  F09 II  C28F5.1 GTAAGGCTTCCCTTCAATTCAGT GGGTCGATTTACAGAGTTTTCCT II-5L17
49  F11 II  C28F5.3 AAGGTCCAATCTTTGTCCTTTTC AGTCAAATACGTCATGTGAGGCT II-5L21
49  F12 II  C28F5.4 GCCTCTAACGAGATCACCCA    TCAATCGTGAAGGGATCACA    II-5L23
49  G01 II  C28F5.5 TAATACTTTGTCGCGTATCCGTT ACTCTGTTTGTTGCACTGGATTT II-5N01
49  G02 II  ZK1290.1    ACTGGGAATATTGGAATGGTTCT GTTCTCCATTCTGTTCCTCCTTT II-5N03
49  G03 II  ZK1290.2    GACAATCGCATGGAGGATTT    GCGAACGTATTGAGTGCAGA    II-5N05
49  G04 II  ZK1290.3    GAGAACGAGCAGAAGATCCG    TGATTAGTAGCCTGGTGGGG    II-5N07
49  G05 II  ZK1290.4    CACCTCAAGACTCACAGGCA    ATTGTTTCCGCATTTCGTTC    II-5N09
49  G07 II  ZK1290.6    TTTTTAGCCACAAAAACCGC    ATCTCAAACGATTGCGCTCT    II-5N13
49  G08 II  ZK1290.7    TGTCCTCAAGAAAGACCAAGAAG AAAAATGACAGCATACGCAAAAT II-5N15
49  G09 II  ZK1290.8    TGAGGGAAGAAAAGATCATCAAA CCCTCCAAAATCTCACTCACTTA II-5N17
49  G10 II  ZK1290.9    CGCAAGACTATTAGGGAGTGCTA GATCCGAGCATGTATTCTTTACG II-5N19
49  G11 II  ZK1290.10   CACATAAAGGATGTGACACGAAA TCTATTTGTTGACAAGTTCCGGT II-5N21
49  G12 II  ZK1290.11   TTCGATTTGCATAACTGGATTTT CGTTTATCGCCTGTAATCAGACT II-5N23
49  H02 II  F35D2.1 TTTATTTTTAGGAGCACATCCGA TCATTTTCCTCGTTTTGCACTAT II-5P03
49  H03 II  F35D2.2 CAATCCGGCTTTTTGTCACT    CCACCTTCTAGGGATACGCA    II-5P05
49  H04 II  F35D2.3 GCGGCTTCTTACAGAAATGC    CGGAGAATTGTGGGCTAAAA    II-5P07
49  H05 II  F35D2.4 GCACAGAGCTGACCAGAACA    CGGATATTGCACGAAATGTG    II-5P09
49  H06 II  F35D2.5 AGCATTCCGTGAATTTGAGG    ATGGAAGTCCGGGAAGAACT    II-5P11
49  H07 II  R07G3.1 TTCTTCGATAATTATTGCTCCCA AACGACGACGAAAATGTTAAAGA II-5P13
49  H08 II  R07G3.2 CAACAAAACCACTCGAAGTTACC ATCAATACATCGTCATGGTTTCC II-5P15
49  H09 II  R07G3.3 CAAAGTTTCCTCGCTTCGTC    CATTTCTTCACTTTGGGCGT    II-5P17
49  H10 II  R07G3.4 TAAAACCAAAGGCATTCGAGATA AGTGACTCAACAGCGGCTACTAC II-5P19
49  H11 II  R07G3.5 CATTTTACCATTTGGTGGGC    TCTTCCGTCACTGTGTTTGC    II-5P21
49  H12 II  R07G3.6 TCCAAGAAGTCGTCCAGCTT    GCCAAAATGTTGAAATGGCT    II-5P23
50  A01 II  R07G3.7 TGTTGCATTTCCCATCGTTA    AAAAATGCATCGACCCCATA    II-5B02
50  A02 II  R07G3.8 AATTGCGGATGGAGTTTACG    GTTTTCCATTTTCCCCCATT    II-5B04
50  A03 II  R153.1  CGTATTGGGTTCATTGGTCC    CAGTCAATGCACGTTCTGCT    II-5B06
50  A04 II  R153.2  AGATGAAGCGGAAGAGGTCA    GACATACGGTGTGGTTCGTG    II-5B08
50  A05 II  F18A1.1 CGACGATTGTGAAGTTGTGG    CGTGATAATTTCGTTCGGCT    II-5B10
50  A06 II  F18A1.2 AGGTAACGCATGGATTCGAC    CAGCTACAAACTGCACGCAT    II-5B12
50  A07 II  F18A1.3 ACTCCGCTCCACCCCTATAC    GCTCACCCTCTCAACTCGTC    II-5B14
50  A08 II  F18A1.4 GCCGGTTGACAACTGAAAAT    GTGAGCGTGAATTGAAGGGT    II-5B16
50  A09 II  F18A1.5 CGATGACCAAATCAAACGTG    GCTTTTGTTGCTTCGTCTCC    II-5B18
50  A10 II  F18A1.6 CTCGGTGGTGGAGTTTTTGT    CTGCCACTCAAAACGAGTGA    II-5B20
50  A11 II  F18A1.7 GGTTAATTGCAAAACGGCAT    CCGCCATCTTTCTGTTCTTC    II-5B22
50  A12 II  B0495.1 ATTTACAATACTCGCCGGTTTTT TCGTCCCATTGTGAAGATAAGTT II-5B24
50  B01 II  B0495.2 TAAAAGCTGGAAATCACCCG    GTCGCACCTCGAATTGTTTT    II-5D02
50  B02 II  B0495.4 ATTGTCGTTGATTTCGCTCC    ATCCTCAAACCATCACTGGG    II-5D04
50  B03 II  B0495.5 GATGTGGGCTTGGTCTTTGT    TCCTGAACGACAACTTCGTG    II-5D06
50  B04 II  B0495.6 CAAACACATTGAATGGAGATCAA CATTTTCGAATAGGAGTACGGTG II-5D08
50  B05 II  B0495.7 TCCTCGTCGAATTCTGTGTG    ATGACCTTGGCACAGTTTCC    II-5D10
50  B06 II  B0495.8 GCGGTCTCCTCTGTCATCTC    TTCTTTTTAATGCGGTTGCC    II-5D12
50  B07 II  B0495.9 TGCAAGAATCACCACTCCAA    CGACAATGCGCTCTCAATTA    II-5D14
50  B08 II  B0495.10    GAATTCAGCCCATTGTGGAT    CTCACTCCTAGTGGCAAGGC    II-5D16
50  B10 II  B0228.2 GTGCGGGAGGATCTTATGAA    AAATTTGCCACCATCTCTCG    II-5D20
50  B11 II  B0228.3 TCAACAAATGCAGAATGGGA    CTCGGTCAACACTTTGCTCA    II-5D22
50  B12 II  B0228.4 ATGTTCTAGCCGAGGAGCAA    CAGTTTCAAACGTGGCTTCA    II-5D24
50  C01 II  B0228.5 GTTTAAAAGCAGATGGTCGAAGA CACCTTTTTCTGTTTATCGATGC II-5F02
50  C02 II  B0228.6 CGTCAATGGGAGTTTGGTCT    TTGCAAAAGAAATTTTCGCC    II-5F04
50  C03 II  B0228.7 TCCGGTGAAATCATGACAGA    TTGGCTCAGTCTTTTCGGAT    II-5F06
50  C05 II  B0228.9 TTTTTCCAACACAAGAGCCC    TCGGACAGATGGACAGATCA    II-5F10
50  C06 II  C06A8.1 TTCAATGCAACGCTCTGTTC    TTCAGTGGTGTTGAGACCGA    II-5F12
50  C07 II  C06A8.2 TGGCCGATTTTCTGTTCTTC    ATTCAGATTCCGGTCACTGC    II-5F14
50  C08 II  C06A8.3 CTTTCATTTTTCACGAAATCCAG CGAATGAGAACGAGAGAATGAGT II-5F16
50  C09 II  C06A8.4 GTAAACCGTTCGAATTTGTTCTG CGCCTAGGAAAACCTCTATTGAT II-5F18
50  C10 II  C06A8.5 TTCATGTTGAGATGGACGGA    GCGTAACGGCAATACTGGAT    II-5F20
50  C11 II  C06A8.6 TGCCAAAAACGTTGACTTGA    GACGGACTCAGTGGGATGAT    II-5F22
50  C12 II  C06A8.7 CCCTAACGAAGGATTCAGAAGTT CTTTCATCTTGGACATTTTCACC II-5F24
50  D01 II  C06A8.8 AAACCACGAATTGTTGGTAAATG ATGTGACGTAATGGTATCCTTGG II-5H02
50  D02 II  C06A8.9 ACATCCACCAAACAACAGCA    CTGCAGAGCACAACGAATGT    II-5H04
50  D03 II  C06A8.10    GCTTCTGATGTGAGTGCCAA    GAGGGTCATTTGCCTACGAA    II-5H06
50  D04 II  T05A6.1 CATTGAATATTTGTTTGGTCCGT CCTAAAATTCACGCAATCTTCAC II-5H08
50  D05 II  T05A6.2 GGCAACAACAAAGAGTTTGAATC AATTGAACCCATATGTTTGAACG II-5H10
50  D06 II  T05A6.4 GGTTTTCCAAAAACGGACCT    TGGTGACGAGAAAACGTCTG    II-5H12
50  D07 II  T05A6.5 TCTGTTTTGAGTTTGTCAGAGCA ACTTTCAGCATTTTCCAAGCATA II-5H14
50  D08 II  T09A5.1 ATCCACATATCAAAGAGCGATGT ACCTAGCGAATTTCGAAACCTAC II-5H16
50  D09 II  T09A5.2 AGTGCTGGAGCTGACAAGGT    GCTGGGATTTCTCTTCGTTG    II-5H18
50  D10 II  T09A5.3 TGCTTTTTAACTCGGCGTTT    TGAGCAGGAAAGCTTTGACA    II-5H20
50  D11 II  T09A5.4 CGAGTACGGTTGGCTCTCTC    TCATTTGCCCACACTGAAAA    II-5H22
50  D12 II  T09A5.5 AGCCACCACCGATTATAAGAAAT TTGTTTTTGTTTTCTTGTCCGAT II-5H24
50  E01 II  T09A5.6 ATCGGACAAGAAAACAAAAACAA CGAAAGAAACGATAGAGAGGTGA II-5J02
50  E02 II  T09A5.7 TCGGATCCATCTGATAAAAATTG ATCTCCGAGTCGTTTGATATCTG II-5J04
50  E03 II  T09A5.8 AACCATCAAGTTCGAATGCC    GGTTCGTTGGTTGGGTTATG    II-5J06
50  E04 II  T09A5.9 TTAGCCCCACAATTTCTTCG    TATTGGAAGCGTCCGAGAGT    II-5J08
50  E05 II  T09A5.10    CCTTGACGAAGAGAGGAACG    ACGAGCATTTTAGGTGTGGC    II-5J10
50  E06 II  T09A5.11    AAGTTTGTGGATGCTGGAGG    CAGTAGGCGAAGAGGCAAAC    II-5J12
50  E07 II  T09A5.12    AGCAAGTTATAGCTGGGCGA    CAGGTAATTCACATGCTGCG    II-5J14
50  E08 II  T01H3.1 CACAGTGTGTAAGAGAAAAGGGG AAATTCACCACGTTCTTTGTGTT II-5J16
50  E09 II  T01H3.2 TCACCTGTAAACGCCAATCA    CTTGCTCCGAAATGGGATAA    II-5J18
50  E10 II  T01H3.3 TCAAAGGTCCCCATTGAATC    TCGTTATCATGCCCTTGTGA    II-5J20
50  E11 II  T01H3.4 AATGTTTATGAACCCGAGCG    TTCACGCAGTTGTTGACACA    II-5J22
50  E12 II  T01H3.5 ATGGGGAGAACTCTTGAAATTGT TATCGTTGTCTCACGTCTCTCAA II-5J24
50  F01 II  ZK675.1 TCTTTCTTCCCAACACCACC    TGACAACGAAACATTGGGAA    II-5L02
50  F02 II  ZK675.2 GAGAAGACTCAATGCCCAGC    TCGAGGTTGTTGTCAGATCG    II-5L04
50  F03 II  ZK675.3 AGTTTTGAAGTTGTTGAAACGGA TAATAGGTGGTGGGATTGTTGTC II-5L06
50  F04 II  ZK675.4 CCTGGATTGTACGGTTACAACAT TGTTCTTTTGTTTCCTTGGACAT II-5L08
50  F05 II  ZK669.1 TAGGAAGAGATGTTGTCTGCTCC AATGTTCTGCTTGTGACACATTG II-5L10
50  F07 II  ZK669.3 CTCAAAAACCTCAAAACCAGTTG TGAAAAGATTCCCGTGATAATTG II-5L14
50  F09 II  ZK669.5 CCTCAAGAAACTGTGATTTTTCG AAAAATGACCTCCACACACAATC II-5L18
50  F10 II  DH11.1  AAAGCAAAACCAATATGGCG    AGCCAAAAAGCGGACAGTTA    II-5L20
50  F11 II  DH11.2  GGGCCTATTTGGGAAAATGT    ATGACCAGCATGTACGGTGA    II-5L22
50  F12 II  DH11.3  CAGTGCAAGACCGTCAAAGA    GGCGTTCGGAGATGAAAGTA    II-5L24
50  G01 II  DH11.4  AGCACTTGGAATTGCTTGCT    CAGCTTTGTTGGGGGTACAT    II-5N02
50  G02 II  DH11.5  GTTTTAAGAGAGCAGCACACGAT ATGGGGAAAAGTGTTCGTATTTT II-5N04
50  G03 II  C08B11.1    CAACTCCACTCGACTCGTCA    CTCCAAGAGCTTTTCGCAAG    II-5N06
50  G04 II  C08B11.2    AAATACTTTCCGGGACCGAC    CTGCACCAAACAAGTGGCTA    II-5N08
50  G05 II  C08B11.3    CCTCATCGATGTATTCGGCT    TAACATATCGACGTTGGGCA    II-5N10
50  G06 II  C08B11.4    TGCAAACATTGCAAGTCCAT    TGTCAGATTCCGATGCTCAG    II-5N12
50  G07 II  C08B11.5    CCTGGTCCAGCAGAAGGATA    GGATTTGTGGAGTTCATGGG    II-5N14
50  G08 II  C08B11.6    GCCGTAATGCTTCTGGACAT    TTTTGACAATGGTGGCCATA    II-5N16
50  G09 II  C08B11.7    TTTAGCGGCTTGATAAGCGT    TCCACTGCAACAAAGCTGAC    II-5N18
50  G10 II  C08B11.8    ACCTGAACGGAACGCATAAC    CCTTGACGCACAAACTGAAA    II-5N20
50  G11 II  C08B11.9    TGAAAGTATCAGGCACACAAGAA AATGAAGTAGAAATGGCGAGTGA II-5N22
50  G12 II  T05H10.1    AGACTGTTTCTGGGGCCTTT    TCTACGATTTGCGTTTGCAG    II-5N24
50  H01 II  T05H10.2    AAATCTCGTGAAACGGTTGG    ATTCCATCGAGACGGTTGTC    II-5P02
50  H02 II  T05H10.3    AATGTCACAATATTCACGCTCCT TTTTCTCCACTTTTTGACGGTAA II-5P04
50  H03 II  T05H10.4    CAATGCAAAATCAGCAAGGA    TTCAGGCAGTCCGAGTCTTT    II-5P06
50  H04 II  T05H10.5    GCACAGAGGCTCGTTATTCC    GCAACGATACAAACTCCCGT    II-5P08
50  H05 II  T05H10.6    TGGACCAAACACCTCTGTCA    GTTTTGAATGGCTGGACGAT    II-5P10
50  H06 II  T05H10.7    TAGCAAGCTCCGATTCGTTT    CATGTTGGTTCTTTGCCCTT    II-5P12
50  H07 II  T05H10.8    TGGACCAGTCAAAAGTGCAG    ACACGGTTTCTTTTTGTCCG    II-5P14
50  H09 II  K02C4.3 CTCCTCTGCCAAGCAATCTC    ATTTTCGAATGTTTCCGACG    II-5P18
50  H10 II  K02C4.4 CTGTGTTTCTGATGGCGAAA    TCGCCATGTTTATGACCGTA    II-5P20
50  H11 II  C41C4.1 TTCCGATCTTTTGGGTCAAC    GAATGGAAACGTGGGTGTCT    II-5P22
50  H12 II  C41C4.2 TTAACCGATTTTCAGGCACC    GGTCCGAACGAATTCTCAAA    II-5P24
51  A01 II  C41C4.3 AGCAATCCGATTTCCAGCTA    ATGGTTGAGGGTTAGGGGAC    II-6A01
51  A02 II  C41C4.4 TTCTATTCGCCCATCCAAAG    GAAGACGCAACAGTTGGACA    II-6A03
51  A03 II  C41C4.5 ATTGCTACTGCCATCAGCCT    TACGGGGCAGAATAGAATGG    II-6A05
51  A04 II  C41C4.6 GACGAGGAAGATAATGACGAATG ACAAAGTATGCATTCCAGAAGGA II-6A07
51  A05 II  C41C4.7 CGACAAACTGGTCACAAACG    CCGTTCTCTCGGTCAATCAT    II-6A09
51  A06 II  C41C4.8 CGTTTAACCATGGCCTCAGT    GACGAAGGGCTCCATCAATA    II-6A11
51  A07 II  F10B5.1 AATAATGATGACAATTCTTGGCG TTGCTTTCAACAAATACAGTGGA II-6A13
51  A09 II  F10B5.3 TCTGTGCTCTTTTCAATGCG    ATTTTCAAGTTGGACAGGCG    II-6A17
51  A10 II  F10B5.4 TCAATCTCACCATCGTTCCA    CTCATCGGTTTCTGTGAGCA    II-6A19
51  A11 II  F10B5.5 AACTGGACCACCAGGAACAG    AGAGATTCATGCAATTCGGC    II-6A21
51  A12 II  F10B5.6 TTGCTTCATTCAGCCTTCCT    GCTCAGAATGGTTCCAGCTC    II-6A23
51  B02 II  T05C12.1    AAAATGATTGCTGGTGGAGG    CGACGAAGGTTTCTTCCAAA    II-6C03
51  B03 II  T05C12.2    ATCAAAAGCTCAGCGCAAAT    AAGCGATACCCTCTGAGCAA    II-6C05
51  B04 II  T05C12.3    GATCGTCCTTCTGGGTTCAA    CACGGGACTATACTCGGGAA    II-6C07
51  B06 II  T05C12.5    CTATTCCTTCGAACCGTATTTCC TTAAAACTCATTGCCTTTACCGA II-6C11
51  B07 II  T05C12.6    ACGTCCATCTTTTTCAACGG    CCCAACACCAGCTGTCACTA    II-6C13
51  B08 II  T05C12.7    ACAAAAAGTTCATCCGACGACTA ATCAATTGAGCTTTGGAGTGGTA II-6C15
51  B09 II  T05C12.8    GCGATTTTTCGGATCACTGT    GCATCGAGTGGGTTGTTTTT    II-6C17
51  B10 II  T05C12.9    GGAAAAATGAAGGGATTTATTCG TAGAGACAACGGGGATTCACTAA II-6C19
51  B11 II  T05C12.10   TGAGACAGCTGACGGAAATG    TGAGCTTGTGAGCAGAATGG    II-6C21
51  C02 II  M110.3  TACAACGAAGCTGAAATCACAGA ACACAACTCTCCTCTCTTTGCAC II-6E03
51  C03 II  M110.4  GATATCAAAACGATGCGAGTTTC ATTCAACTTCTCCAATTTCGTCA II-6E05
51  C04 II  M110.5  TGAGCAAGTTAAGCAACAACAGA AATGGATCAGCATGAGATGAAGT II-6E07
51  C06 II  M110.7  GCTCTTCGTGCATTGATTGA    TTCTTGCACATCCAAGCAAC    II-6E11
51  C07 II  F35C11.1    CTAAAAACCAGCTTCTCCCAAAT CAAAAACACTCGTTTGTGTGGTA II-6E13
51  C08 II  F35C11.2    CATTTCACAAGCAGTCGAGTATG ACAAATTCCTCAACAACATGGAC II-6E15
51  C09 II  F35C11.3    GGTGCTTGTGGTCAGGTTTT    CCTCACGATCCGACTTGTTT    II-6E17
51  C10 II  F35C11.4    CTTGACAACCGCCTCTTCTC    TCGGCTGGGAACTGAAATAC    II-6E19
51  C12 II  F35C11.6    CATCGATACTTCCTTTTCCACTG TATCTGTCTAGTTCCCCCTCTCC II-6E23
51  D01 II  K01C8.1 GAACGAGGAGCAAGATACGC    TCTCCTCCACGTGCTCTTTT    II-6G01
51  D02 II  K01C8.2 CCAGTCGGACATGAAAGGTT    GCTGCAAATGGTCAAGGAGT    II-6G03
51  D03 II  K01C8.3 TGATCCCATTCTTCGTTTCC    CATCTTCCTCAGCGATCACA    II-6G05
51  D04 II  K01C8.5 TCCTATTCGGACTCGCATTC    CAGAGGTCGTCCCATTCCTA    II-6G07
51  D05 II  K01C8.6 TATGAGAATCCAAAAGTGATGGG TTTCAGGATGTTAAACCAGTCGT II-6G09
51  D06 II  K01C8.7 TGACGCGCAAAGTTTATCAG    TTGCCGAACATTTGCAATAA    II-6G11
51  D07 II  K01C8.8 CGTGTGGAGCACTCGAATAA    ATTATGGCACTGAAGGCAGC    II-6G13
51  D08 II  K01C8.9 GGCCCTTTCACTTTTCTTCC    CAATTCCCGACAATTGCTTT    II-6G15
51  D09 II  K01C8.10    AGACACGGTTGAAGAATCCG    TTCGGCAAGTGTGTATGGAA    II-6G17
51  D10 II  F14F11.1    AGTAACCACCGTCTGCCAAC    AGTGCTCCACTAAATGGCGT    II-6G19
51  D11 II  F14F11.2    CAAAAGTTGGCTGGATAATTCTG CATTCGCTCTTTTCCCTATTTTT II-6G21
51  D12 II  C26D10.1    CTGCGTCCTAACTGTCCCAT    TTCAGAAATGTCAACTGCGG    II-6G23
51  E01 II  C26D10.2    AACGACCAACCAAGTTCTGG    CGCTCTGCATTTTCCTGTTT    II-6I01
51  E02 II  C26D10.3    TCCTGCGAATAAATTGAGGG    CACCTCCTGCCCAAATAAAA    II-6I03
51  E03 II  C26D10.4    GAAAAACTGGGTGAGCGAAC    ATCGACTGCTTCTGCCATCT    II-6I05
51  E04 II  C26D10.5    TGTAACACATGCCGAAGGAA    GTCTTGGGAGAGGCAGTTTG    II-6I07
51  E05 II  C26D10.6    CCCACTTTGCATCCTTTTGT    CCATGGACTGGAGTATGGCT    II-6I09
51  E06 II  M195.1  GAAGCATTTGCAAGACACCA    TACTTTGACTGCCATCGTCG    II-6I11
51  E07 II  M195.2  ATCGATCGTGCTCTCGAGTT    GAAAGACAACGGGAACAAGC    II-6I13
51  E09 II  M195.4  TTGTGTCGTTTCATCTTTTTCCT CCAATGTCAATTTCTTTTTCTGC II-6I17
51  E10 II  F49E12.1    CGACACTTCCTCCAAAGAGC    TGCTTCACGTCGTAATCGTC    II-6I19
51  E11 II  F49E12.2    ATATTTTTCAAGCACAGGAACCA TGATTGACATCCACACATCTCTC II-6I21
51  E12 II  F49E12.4    CGAGTTTTGGATTCAGAAAAATG CAACTTTTTGTTTTTGCCAGTTC II-6I23
51  F01 II  F49E12.5    TCCAGTCAGCCTTTCCTCAT    TCGGAAGTTTATTTCCACGC    II-6K01
51  F02 II  F49E12.6    AATGTCCTGGTTGCTCTTGG    GAATCCGCGAATCTGATGTT    II-6K03
51  F03 II  F49E12.7    TTATGTCTAAGCCTGCCGTATGT TTTCTTGGCCATACCTATTCTGA II-6K05
51  F04 II  F49E12.8    TCTCCAGATTTCGTTGATGATCT ATGGAAACACAACCATAAATTGC II-6K07
51  F05 II  F49E12.9    TGTATTGCTCCGCCTATTCC    TGTTCCGTGAATCCAATCAA    II-6K09
51  F06 II  F49E12.10   AAGGCGGTTGTGATTTCAAG    TTTATCTGTTCCGTGGAGCC    II-6K11
51  F07 II  F14E5.1 TTTCGCACTTATTGCGTTTG    GAAGAGCCCATAATCCGACA    II-6K13
51  F08 II  F14E5.2 AATGGAAATCATCAGCCTGC    CGTTGTTTAGTGCGCATTGT    II-6K15
51  F09 II  F14E5.3 ATCGGGTTAGTTTGCGTGAC    GAAATGCCTGGAAACACCAT    II-6K17
51  F10 II  F14E5.4 CACTGCCAACTTCTCCCTTC    TTTGATTGTTCAATTCGCCA    II-6K19
51  F12 II  F22B5.1 GTTGGGTTTCTGTCCAATGTAAA CAGTGTGAAATGAGATCAAAGCA II-6K23
51  G01 II  F22B5.2 CCGCTCCAGAAGTTGTAAGC    CGGGAAAACATCCAAGTACG    II-6M01
51  G02 II  F22B5.3 GGCACCATCATACGGGATAC    GTCGTCGTCTCTTTCCATCC    II-6M03
51  G03 II  F22B5.4 CGGTGATCCTATTCTTGAAGTTG TGGGGTGCTTTATTATGTCATTC II-6M05
51  G04 II  F22B5.5 ATGGGTTCGAGCTCACAAAG    CGACCAGTGAGCAGATCAAA    II-6M07
51  G05 II  F22B5.6 GCCTGTACAATCCAGAGAATGTC GAAGAAGCATGAAAAACCCCTAT II-6M09
51  G06 II  F22B5.7 GTACTTTCCAAAATGCCCGA    GGCATTTCGTCCTTTGAAGA    II-6M11
51  G07 II  F22B5.8 TTGATGGGAGGAGTCGAAAC    ATGTGGTTCTCTTTGGACGG    II-6M13
51  G08 II  F22B5.9 AGAAAGCCGCTGTTGAAAAA    TTTCGATCCGGAGATTATCG    II-6M15
51  G09 II  F22B5.10    TGGTTATTTCATTGTCTCTCGGT TGATTGAAAATTTTGGGAAGAGA II-6M17
51  G10 II  M05D6.1 CCTCACGATCCGACTTGTTT    GGTGCTTGTGGTCAGGTTTT    II-6M19
51  G11 II  M05D6.2 GGAACGATGGATCTTCTGGA    GATGTGCTAGGACCAGGCAT    II-6M21
51  G12 II  M05D6.3 CCGCAATGACCTATCCAAAT    CATCTTGATTGCCGACATTG    II-6M23
51  H01 II  M05D6.4 CTCGCAGTATCTCCGAATCC    AAAACCACACTTTCGGTTGC    II-6O01
51  H02 II  M05D6.5 CGGTGATGATAAGAGATGAAAGC TCGGTCCGAACATTCATATAGTC II-6O03
51  H03 II  M05D6.6 TTAGAAACCGTAACAAACGAGGA CCGCGTTTCAAGTTTATCAATAG II-6O05
51  H04 II  M05D6.7 TAACACTTTCGAAAACCGCC    TCAGACATGAGAATGGAGCG    II-6O07
51  H06 II  T13H5.2 TCTCCTATGGCGATGCTTCT    TTCGTTTATTGAGGGAAGCG    II-6O11
51  H07 II  T13H5.3 ACGTACATGCCACGATGAAA    ATCCGGATCACATTTTGGAA    II-6O13
51  H08 II  T13H5.4 AATGTTGGCGAAATGAGAGG    AACCACTCACCGTGGAGTTC    II-6O15
51  H09 II  T13H5.5 CGGTGAACACACATTCCTTG    CAGTGATCCATCGGTTGTTG    II-6O17
51  H10 II  W01C9.1 ATTTTCTGTTTTATGCGCGG    TACGGATCGGGTTTTAGGTG    II-6O19
51  H11 II  W01C9.2 TCGCTGATTTAAGAATGGGG    CTGTATCCCATGCTCCACCT    II-6O21
51  H12 II  W01C9.3 CACCAAATGCAACAATCTCG    TAAAGATACGTCCTTGGCGG    II-6O23
52  A01 II  W01C9.4 CGTCATTGCTGCTCGTAGAA    ATTCTTGAAAATTGGCCGTG    II-6A02
52  A02 II  W01C9.5 CTGGTTTGGAAATGATTCAAGAG ATACGTGACCCATATCTCCATTG II-6A04
52  A03 II  F54C9.1 GAGGATAGCCTCTTCTCCGATAG TGTCAGTGTCTCCACCATTACAC II-6A06
52  A04 II  F54C9.2 GAACCGCCAACGAGTACAAT    TCAGTACCGAGTGTCGTTGC    II-6A08
52  A05 II  F54C9.3 ACCAAGCTAGTCGTAACACCAAG ACACTCCAACTTCATTGGAAAAA II-6A10
52  A06 II  F54C9.4 ATTCGCGGATCAACTCATTC    CCATGCATTCCATTGTTGTC    II-6A12
52  A07 II  F54C9.5 ACATGGGTCTCGTCAAGGTC    TGTGTCTCTTGGATGGCTTG    II-6A14
52  A08 II  F54C9.6 CTGGCCATGGAACTCATTTT    GAATCGGAAGGTTGTCGGTA    II-6A16
52  A09 II  F54C9.7 AATCATCGTTCTGGAATCCG    GATGAGTGACACGACGGAGA    II-6A18
52  A10 II  F54C9.8 TGACAACGGATTGATCGAAA    AATCTGGGGTATTGTGGCAG    II-6A20
52  A11 II  F54C9.9 CGAACGGGAAGAACGTAAAA    CCGTCATATTTTCTTCGGGA    II-6A22
52  A12 II  F54C9.10    TTGCTCGTAAATCCACGTTTACT TAGACAATTTGTTCTGGGCTCAT II-6A24
52  B01 II  F54C9.11    CCGCAAGTTTACAACGTGAA    TGTGCTTCTTCTTCTCCGGT    II-6C02
52  B02 II  F28C6.1 TCCGGAAATTTGCCTATCAG    AGCATTTCTTTTCGGGCTTT    II-6C04
52  B03 II  F28C6.2 ATCGGGTGAAACAAGTGCTC    GCTATGGGACGCAATGAAGT    II-6C06
52  B04 II  F28C6.3 GAAGCCGTTACATAGAGCCG    TGGGTAAGTTATCTCGCGCT    II-6C08
52  B05 II  F28C6.4 ACCAAATTTCGTGTTCTTCTTCA GAAATCTGCCAAGTTATTTGACG II-6C10
52  B06 II  F28C6.5 TCTGATGGGGTACTCGTAAAAGA AATTGATATCTTGGCTGCTTCAA II-6C12
52  B08 II  F28C6.7a    AAATTTTCCTCGACGTTTTTCTC ACTCGCCAAAACATCAGATACAT II-6C16
52  B09 II  F28C6.8 TTGATCTTCTATCCATCATTGGG AGACGCCAGTGCCATATAAATAA II-6C18
52  B10 II  F28C6.9 TGTCTGTTTCAATCTGCCCA    TCGTTTACGCGTATGTCTGC    II-6C20
52  B11 II  F28C6.10    TCAGAACCTCGAGATGTCTCTTC AAACAGACAGCGAAACAGAAAAA II-6C22
52  B12 II  T22C8.1 GCTGCCGATAATGCTATTAGATG TCCTCTCTTTTTGCTCATCTTTG II-6C24
52  C01 II  T22C8.2 AACTGCCTGGACCCCTAACT    GAGCCAACGTCACCAAAAAT    II-6E02
52  C02 II  T22C8.3 TCAATTCCTGCTAACTGGAAAAA CAGCTGAGCTCTCATGCTTTTAT II-6E04
52  C03 II  T22C8.4 TTGCCCGATCCAAGCTATAC    CACGGACAGGCGTAAGATTT    II-6E06
52  C04 II  T22C8.5 AATTGAGAGAGAAAAATCCCTGG CGATTCTTTTCTGGGAAAATAGG II-6E08
52  C05 II  T22C8.6 CCTGTATCGACATTCAAACAACA CAAAAGCCTGTGGTAAGTGAAAG II-6E10
52  C06 II  T22C8.7 AGTCGCTGGACTTCTCCAAA    ACCGACCAATTGTCATGGAT    II-6E12
52  C07 II  T22C8.8 GAAATACACGTTTCGAGGAGTTG CTCTCATTTCTTCGCACTCTCAT II-6E14
52  C08 II  D2085.1 GAAGCTCGTTTCGTCAAAGG    TGTAGCTCGAATTGCAGGTG    II-6E16
52  C09 II  D2085.2 TTCAGCAATTCTGTTTCTTCTCC ATTATAAAACACGATCCGGGAGT II-6E18
52  C10 II  D2085.3 ATTCGTTATGACGCCTCCTG    CAAAATGCTCTTTCCTTCGG    II-6E20
52  C11 II  D2085.4 CCTTCTTGCACGCTGTTGTA    TGAGACACGTTTGTTGAGGC    II-6E22
52  C12 II  D2085.5 ATGAATCTACATAACGACGCGAT TTCCACATTTTTGAATGCCTAGT II-6E24
52  D01 II  D2085.6 TCACTTGATTATGGGGGAGC    TCAGGTTGGTTTCCGATTTC    II-6G02
52  D02 II  D2085.7 TGTGATTGTTAGCCAAACACAAG GGGCTGTGACCAAAACATAATAA II-6G04
52  D03 II  C34C6.1 AACGCCAGAAATTGAGCAGT    AACTATTCCGAACCCGATCC    II-6G06
52  D04 II  C34C6.2 GACCATTCTCATTTGCCGTT    GTTTTGCCGTTCGAGAATGT    II-6G08
52  D05 II  C34C6.3 CCGAGATGCTATCAACGACA    AAACAACAACTTCCATCGCC    II-6G10
52  D06 II  C34C6.4 CCGTTCCGACAAAGTTCAAT    CTGGCTGCGTTTTAGGTAGG    II-6G12
52  D07 II  C34C6.5 TGAGTCTCGTGTTCAATCGC    AAAGCCGACCTTGGAAAGTT    II-6G14
52  D08 II  C34C6.6 GTTTCAACCGCGACAGGTAT    GGAGATCGCCAACTTGAGAG    II-6G16
52  D09 II  C34C6.7 AGGCAATCAACCACCGTAAC    TTGGAGAAAGTGCTCCAGGT    II-6G18
52  D10 II  C34C6.8 GACTGTTTGTCCAAGAAATCGAC AAGACAAATTTTGCTCGAATGAA II-6G20
52  D11 II  T01B7.1 GTCTGTGATTTCATTCGTCATCA TGCACTGGTGATGCTTCTTACTA II-6G22
52  E01 II  T01B7.3 GAAGAATCGAAGGAAAATGGAGT CAGAATAAATGCTCGAAACCAAC II-6I02
52  E02 II  T01B7.4 TTTCATTTCATTTTTCAACCCAT AACGATTAGTTCAGTTGATCCCA II-6I04
52  E03 II  T01B7.5 AGAAAAACATTCAATCGTCCAGA CACTACAGGATGGATGTCAACAA II-6I06
52  E04 II  T01B7.6 GACTTCTCCCACTTGCCAAA    GTCCGAGACCGTTTGTCATT    II-6I08
52  E05 II  T01B7.7 CTTGGCACTCGTCCAAAAAT    CTTCGTCCAGCATCTCCTTC    II-6I10
52  E06 II  T01B7.8 TGCCATTATTCCGTAAAAGCTAA AATTCCAGTCAAGATCCAAGTGA II-6I12
52  E07 II  K08F8.1 CAGAATCACGCCATGAGCTA    TCATATCGTTCACGACCCAA    II-6I14
52  E08 II  K08F8.2 CCAGACTTTCGGTGGTTTGT    TTCGCTGTGAAAGAAGAGCA    II-6I16
52  E11 II  K08F8.5 GTGCATGTTTGTTCTCGATGATA AGCTGAGATGAACTGGAACGTAG II-6I22
52  E12 II  K08F8.6 GATCCGTTCCTGAAATCGAA    GGCTGTAGTGATTTGGGCAT    II-6I24
52  F01 II  F07H5.2 CGAGTGGGAGATTCTAAGCG    GACTGATGAGCCGGTATGGT    II-6K02
52  F02 II  F07H5.3 ATTCCAATTTTCCCTCAATGTTT ATTATTCATTGGGTCCAGTTCCT II-6K04
52  F03 II  F07H5.4 CCTCCTTCCTCATTTCTATGCTT CGATTCAAATCGAAAAAGAACAC II-6K06
52  F04 II  F07H5.5 AAAGAGAGTCCACCGTGTATGAA CCGTAGTCAGGAACCAATGTTAG II-6K08
52  F05 II  F07H5.6 TTTGAGAATTCGTCCAAACATCT AAAAAGGAAGCTTTATGAGTGGG II-6K10
52  F06 II  F07H5.7 ATGAACTAGTGGAGGTCACCAGA TCTTCCTTGTTCCTATTAAGCCC II-6K12
52  F07 II  F07H5.8 TCGTAACTTCTCAAGCAACACAA AGTGAAGCTTATGCATTGTGGAT II-6K14
52  F08 II  F07H5.9 TTCAGAAGCTCAAGGCCAAT    ACGTGGATCCATTCCAAGAG    II-6K16
52  F09 II  F07H5.10    TGAGCTTCGTGGATCTGTTG    TAATGGCTTTTCCCACGTTC    II-6K18
52  F10 II  F07H5.12    GCAATAGTTGAGTAATCGGATGC ACCTGTTCTGAATCCACAAGGTA II-6K20
52  F11 II  F46C5.1 AATGATAAAACTGAGGGGATGGT TATCAATCTCCGAACCACAGAGT II-6K22
52  F12 II  F46C5.2 ATTCGTTGCTCTTTGAAAATGAA ATTACCTTCGTCAGATCACCTCA II-6K24
52  G01 II  F46C5.3 ACGCCAACAAATTGGAACTC    GACAGTTGCTCCCGACGTAT    II-6M02
52  G03 II  F46C5.6 CCCCTGGATTTTCTTTCACA    GGCATTGTTTTTACCTCCGA    II-6M06
52  G04 II  F46C5.7 ACCTGTGTAATTCATCGGAGAAA TTTGAAAGAAAACCTGCACAAAT II-6M08
52  G05 II  F46C5.8 TTCTTTCACAGTTTGGAAGTGGT AAAATCAAAAGGGAAAACAGGAG II-6M10
52  G06 II  F46C5.9 GAATCTTGCCCAGCCTCATA    TCTGATCGGGGGATTAGTTG    II-6M12
52  G07 II  T14D7.1 TGGACTTTGGGGACAAAGAG    TTCCAAACGTTCCGATTCTC    II-6M14
52  G08 II  T14D7.2 GGACCATGATTTTGCGTCTT    ACAGCGGTTTTCACGTTTTC    II-6M16
52  G09 II  T14D7.3 AACTAACTGTGACGTGGGAAAAA ACCGATAATTGGGAAAAGTTTGT II-6M18
52  G10 II  T07D4.1 ATTTGCCAACTTGAACCAGG    TGATCCATGTTCCGTGTCAT    II-6M20
52  G11 II  T07D4.2 GACTGCGCATCGAGTTCATA    TAATTGCTCCGCAAGCTTCT    II-6M22
52  G12 II  T07D4.3 GTCCAGCTTCGGACATGAAT    TCGGTGAATTCCTTGGAAAG    II-6M24
52  H01 II  T07D4.4 AGGAGGACGTTTTGGAGTTTTAG CATTTTCCTTGAACTCTGGTTTG II-6O02
52  H02 II  B0457.1 AAGAAGACGTTCACCGAGGA    TTCTGCCCATTCCATAAAGC    II-6O04
52  H03 II  B0457.2 TTTTTGACAATGCGAGTAAGTGA TACGAGGAGGAAAGGTATTCACA II-6O06
52  H04 II  B0457.3 AGATGTGGAAGTGTGCAAGAAAT AAGCAACTCCAATTGTAGAACCA II-6O08
52  H05 II  B0457.4 GTTTCATCCGCCTTCGTTTA    TTCCAAACAGGACCATGTGA    II-6O10
52  H06 II  T21B10.1    GAATACCGCGTGTTTTTGCT    AAACACCTCAAAGCTTGCGT    II-6O12
52  H07 II  T21B10.2    TTTCACTGAGAAAGGTAAGCGAG GTTACAGTCAAATCGTCTCCGAC II-6O14
52  H08 II  T21B10.3    TATCTCGGATTTTTCGTGCC    TGCGGTCTGAATTGTGTCAT    II-6O16
52  H09 II  T21B10.4    GAAGACGATCATTCTTTCAATGC AGGATCGTAGTATGCTGATTGGA II-6O18
52  H10 II  T21B10.5    AATGAACGGATTCTTGGCTG    AATTTCCGCCTTTTCCTGTT    II-6O20
52  H11 II  T21B10.6    GGAGTTGGAAAATGGAGCAA    TTCCTTGGCAATTGGATCTC    II-6O22
52  H12 II  T21B10.7    AGGACAAAATTCTCATCAGTGGA ATCAAGAATCTGCTGAGTTGCTC II-6O24
53  A01 II  C18E9.1 GTTGCAGGGCATCCTATCAT    ACACAAGCAGATTGGAAGGG    II-6B01
53  A02 II  C18E9.2 GAAGAAACAGCAACCGAAGC    TGCAGAAATGTGGAATGGAA    II-6B03
53  A03 II  C18E9.3 CAGGCGGTCCATTGTAAACT    CGATTTCTTCTTGCGCTCTC    II-6B05
53  A04 II  C18E9.4 GAAGCTGAACTGCTGATACCACT GCTGGCATTTCTTTCTGATTTTA II-6B07
53  A05 II  C18E9.5 ATTCTTTTCGCATTTGCAATTTA GGAAAATGTATTCCCATGCATAA II-6B09
53  A06 II  C18E9.6 GTGACGGCTTCTCCAACATT    GCGACACCAACAGAAAGTGA    II-6B11
53  A07 II  C18E9.7 CTTCCCAATCAAGACGAAGC    GGGCAAAGTTTGAAAATGGA    II-6B13
53  A08 II  C18E9.8 GGCTTCTTCAAAGTTGTCGC    TTGTGTTCATTGCCGTTGAT    II-6B15
53  A09 II  C18E9.9 GAGAAAGAAGGGGTTTTTGTGAT CACTCCTGCTTCTCACACTTCTT II-6B17
53  A10 II  C18E9.10    CAAAGGGATGAATAGAGTGTTGC TCAGAGGATTTTCCCTACTTTCC II-6B19
53  A11 II  F44G4.1 GATGACGAAGTTGAGCACGA    AGGATAAAATTGGGGCTTCG    II-6B21
53  A12 II  F44G4.4 ACCCTTGGATGAAGTTAAGGAAA CGTCTACTTTGTCTGTGAGCCTT II-6B23
53  B01 II  F44G4.5 ATTGGTAAGACAAGAGGCACAAA GACCCATACGGATACAATTCAAA II-6D01
53  B02 II  F44G4.6 ACAAATCCAGCAACATTAGCACT TCTTCAGCTTTCCTATTGAGTCG II-6D03
53  B03 II  F44G4.7 CCTTTTCCCACTCGTTTTCA    TTGGTTTTAGGTCCTGCGTC    II-6D05
53  B04 II  F44G4.8 TCTCCGAATCCAGCTTCAGT    TTTTCGATTTCTTCGATGGC    II-6D07
53  B05 II  F37B12.1    GCAATGAGCATTAAGGGGAA    TGACTTTTGTTCGTGTCCCA    II-6D09
53  B06 II  F37B12.2    GAAGACAACAGCACCCCATT    AAGGTAGTCCGTTGACGTGG    II-6D11
53  B07 II  F37B12.3    GAATGGACCGAACAAGAGGA    TTCCGTGTCTTTTCCCATTC    II-6D13
53  B08 II  F37B12.4    TGGCATTGAGCAAAGTTCAG    CATGGTTAGGGAATGGGTTG    II-6D15
53  B11 II  T24B8.3 CATCTTCAATGAAATATCCCCAA TTCTATTTGAATTTAGCGGGTCA II-6D21
53  B12 II  T24B8.4 ATTTTCGATGCGACAGATCC    GCAGGCATGCTTACACAGAA    II-6D23
53  C01 II  T24B8.5 AGGATCTTGAAGGTTCTTGGTTC GGTAGAGCTCCATCTTTCCAAAT II-6F01
53  C02 II  T24B8.6 TGAAAATTCAAATAGGGCAGAAA TTTTTGGTTGCCATCAGTTAGTT II-6F03
53  C03 II  T24B8.7 GTCCATGCCACACAAATGAG    AAAGTGGCTCGAGGAGAACA    II-6F05
53  C04 II  C07H4.1 ATGTGATTTATGAATTATCGCGG ATTTAGTTGCCAACAAGGTTCAA II-6F07
53  C05 II  C07H4.2 CGAAAGCAACACTGACTCCA    CGACCCTTGGTTCAACAGAT    II-6F09
53  C06 II  T24H10.1    ACAATCGTTGTGCAAGCAAG    CAAATGTTGTCATCGGTTCG    II-6F11
53  C07 II  T24H10.2    GTCGGAGACTTTTGGTATGACAC TCAAAAAGTAATTGCCGGTAGAA II-6F13
53  C08 II  T24H10.3    TGACCAATGGAAGGGGAATA    GTTTGAACATGGCGCTTTTT    II-6F15
53  C09 II  T24H10.4    GCAACCCAGCCTTTGAAATA    GATTCTTCGGAGCAAACCTG    II-6F17
53  C10 II  T24H10.5    TTTTGGTCCAGTCGGATAGC    AATTGTTCTCAACCATCGGC    II-6F19
53  C11 II  T24H10.6    CTTTCGATCATGAAACTTATGCC TATCTCCTCAAGTGGAAAATGGA II-6F21
53  C12 II  C16D2.1 AAAGCAACAAGAATCAACCAAAA ATTTTTATCCTGGAAACCGAAAA II-6F23
53  D01 II  Y9C2UA.1    AGGTGCTAAAAGCGACGGTA    AATGGATTGAACCAATGGGA    II-6H01
53  D02 II  Y9C2UA.2    AAACTCCCACAAGTTACAGACCA CAAAGTTTCCCTAAACATTGCAG II-6H03
53  D03 II  W07A12.4    TTTGATCGAATGATGAGCCA    TTTGTGGGATTTGGGAATGT    II-6H05
53  D04 II  W07A12.5    AAGGAACTCCATTAGGAAAGTGG CGTTAGAATTTTTCCAGATGCAC II-6H07
53  D05 II  W07A12.6    CGATGCGTCGCAATTATATG    GTGACGTGGCAGTTTGAAGA    II-6H09
53  D06 II  W07A12.7    TTTGTCTACATCGCTGCTGG    TGGGTGGCAAAAGAAAACAT    II-6H11
53  D07 II  T23G7.1 TTTCTAGCTGCTGCCGGTAT    TAAAAACTGGGAAAAGGGGG    II-6H13
53  D08 II  T23G7.2 TTTCATGGGTGGTCCTTGAT    CCGCTTCGATTTTGGAAATA    II-6H15
53  D09 II  T23G7.3 ATCGAAAAACGACACCCTTG    AATGTCGATTTTGGCAGAGC    II-6H17
53  D11 II  T23G7.5 GAGCCACAGATTGTCCGAGT    AAATTGTGGAATCGGCTGAG    II-6H21
53  D12 II  ZK1067.1    ATGCACGATGATGGTTTGAA    GAAGCTAACCGGTTTGACCA    II-6H23
53  E02 II  ZK1067.3    ACTTTTCAGATCGGAATGGTTTT CTGGTTTTAGATCGCAAAGTGTC II-6J03
53  E03 II  ZK1067.4    TGCTGTTTCGGCTACACAAG    CGACTTCAAATCCTTCGAGC    II-6J05
53  E05 II  ZK1067.6    CTCGATCTATTCCATCAAAATCG TGAGAGGATTGCCTTATGATTGT II-6J09
53  E06 II  ZK1067.7    ATTGGCTGGCATTGAAGAAC    GAAGATTCTCTCCGCGATTG    II-6J11
53  E07 II  T26C5.1 ACGTTTTATGTACCTGCCTCGTA ACCAATATGTAATTCCTGACCGA II-6J13
53  E08 II  T26C5.2 CCAACTCTTCTTCCAAATTCCTT TTGGATAGCAGAACTTTGTGGAT II-6J15
53  E10 II  T26C5.4 CTCACAGTTTTTCTTTTGGCATT AACTCTTTGTCATCTTCTCGCAC II-6J19
53  E12 II  C01G6.2 CCTTGTGTATTCGGTGAGTTTTC AGTGCTGACTCCGAACCATATAA II-6J23
53  F01 II  C01G6.3 TCTGCATTCTCCACATGCTC    AGGAACGGTTGATTTTGTGC    II-6L01
53  F02 II  C01G6.4 GACGTTTGTAATGGGGACAAATA CGTCTGAGAAATACTCCGATGTC II-6L03
53  F03 II  C01G6.5 TGCTGATTACTGTGAAGGCG    AAATACGACCATCCAGACGC    II-6L05
53  F04 II  C01G6.6 CAGACGATCAAGTGGGGTTT    TCGGTGAAATCCTTCATTCC    II-6L07
53  F05 II  C01G6.7 TCGGGTACAACTGGAAAACC    AGAAGTTTTCCTGTCCCCGT    II-6L09
53  F06 II  C01G6.8 TCTGAGACGCCTCCTTTTGT    TGGAAGGAGAGGAGACCAGA    II-6L11
53  F07 II  C01G6.9 GAATCCAAAGTTTCACGAAGTTG CCAATCTGTGTATCGGAAACATT II-6L13
53  F08 II  D2013.1 GAGAAATTATCAACATCCGCAAG AATGGAAACAAACTTCATTGGTG II-6L15
53  F09 II  D2013.2 GACAGAATCCCGAAAATGGA    CGAGAGTTTCCTGGAGATGC    II-6L17
53  F10 II  D2013.3 TTGTGCTGAAATCCCACGTA    ACAACAAGTTTCACGGGCTC    II-6L19
53  F11 II  D2013.4 ATTCAAAGAGAAACGGAAAAAGG CGCCTTCTCAATTTGCATAATAC II-6L21
53  F12 II  D2013.5 AATGGAGGATCGTGCTGTTC    CGAGTTTCTCTTGGATTCGG    II-6L23
53  G01 II  D2013.6 ATCCGCTTCTGGGTACCTTT    TTTCTTCGCCTCAATCCATC    II-6N01
53  G02 II  D2013.7 TCAAAATGACCGAATGCTCA    AATTAGGCCGACACAAGACG    II-6N03
53  G03 II  D2013.8 TCCATGGAATGCAACAGAAA    GGACAGCTGACAGGTGCATA    II-6N05
53  G04 II  D2013.9 ACAAGCAACTTTCGGAGGAA    TTGGTGTGACTTTGGTTGGA    II-6N07
53  G05 II  D2013.10    GAACAATTTTCGGTTAAGAGGCT ACAAGTTTTGCACAGAAAGCAAT II-6N09
53  G06 II  F42A8.1 ATAACAAGAGAAAGCTCGCTGTG GTAGGTACGAGGTAGGCGTAGGT II-6N11
53  G07 II  F42A8.2 TGTGAATCCAGTAAGCAGCG    GAAGACCGGAAACCGTATCA    II-6N13
53  G08 II  F42A8.3 ATTTGGATGGACCCTGTCAA    TTGGCCATGTGGATCTGATA    II-6N15
53  G09 II  C06C3.1 AAAAGGAGCCGATGTGAATG    GGTGGAAATTGCAGGAGAAA    II-6N17
53  G10 II  C06C3.3 TCTCGTCACCAGAAATGTGC    GAACCCCGCTCTACATCTGA    II-6N19
53  G11 II  C06C3.4 TTGAAATTGCAACCAAAATTACC ACATGCACATGGAAGAAGAAGTT II-6N21
53  G12 II  C06C3.5 TGCTCAGTTTTCACCCAAGTAGT TTCTGAGAGCGTATTTTCCAGAG II-6N23
53  H01 II  C06C3.6 TGTTTGGAAATTCTGGCACA    AATCCACGGCAAATGTTGAT    II-6P01
53  H02 II  C06C3.7 ACGTGTGTGTCTACCCAGAGAAT CCTCTTATACCGTCCTCCAGAGT II-6P03
53  H03 II  C06C3.8 CAACTCCTTCATCCCCTTGA    GATCTCAAAATCTCCGGCAA    II-6P05
53  H04 II  C06C3.9 TTGGAAAACCGAGATATGCC    CTGCGTTGAACTGCGATAAA    II-6P07
53  H05 II  Y51B9A.3    ACGGCTGATTTGATAATACATGG GAGGAGGTCAAAAGAAAGTGACA II-6P09
53  H06 II  Y51B9A.4    ATACCTGCCTGGCGACTATG    ATGGTTCCGTCTACATTCCG    II-6P11
53  H07 II  Y51B9A.5    AACTTAGGCAAGAAGCTAGAGCC TTTCTAAACAACCCAAGAAACGA II-6P13
53  H08 II  Y51B9A.6    GCCATAGGAATTGCTGGAAA    TCTTCCACTTTCCCAACGTC    II-6P15
53  H11 II  M176.1  ATAAATCGAAAGGAGCTCAAAGC CTACAGAATGTTCGTATCCCAGG II-6P21
53  H12 II  M176.2  GGAGTTTTGATAGCGGTGGA    GATGACCGGATTTTGCTGTT    II-6P23
54  A01 II  M176.3  TGCGCTAGCTATTTATTTTACGC CGCACACACACCTATACAACACT II-6B02
54  A02 II  M176.4  AAGATAGGCATCTAAACTTGGGC GGTCATTCAATTTAGAAAGCACG II-6B04
54  A03 II  M176.5  TCTTCTTGCGTGGAAATCCT    AGCCCAAACCATGAACAAAG    II-6B06
54  A04 II  M176.6  ACGACCACACATCCGATTTT    GAAGCAATCCTGAAGTTCGC    II-6B08
54  A06 II  M176.8  ATTGTTCCAAATTCTTGCCG    ATTCCAATGTCAAAGGCGTC    II-6B12
54  A07 II  M176.9  GTAGCAAGTGACTCCCCAGC    AGCTCCCGAGGAAAAGTCTC    II-6B14
54  A08 II  R09D1.1 TGCCATTGATTAATTTCGCA    TCACAACCCAACAACATTGG    II-6B16
54  A09 II  R09D1.2 TATTGAATTTGCCGGGTTGT    GATCACGGCGAATGATTTCT    II-6B18
54  A10 II  R09D1.3 AGAAATGCCATTCAATTCGG    CGATTTTTCCTCTGCTCTGG    II-6B20
54  A11 II  R09D1.4 TGTTTTCATCAGCATCTGCC    ATTTGTATTGCAACGGGCTC    II-6B22
54  A12 II  R09D1.5 TCGCAGAAGCTGAACAGAGA    ATTCCTCCATACAACGGTGC    II-6B24
54  B01 II  R09D1.6 TTCCTGCTTCGTAGTTGGCT    TAGAAATGCCGAGGTTGTCC    II-6D02
54  B02 II  R09D1.7 GTTGATTGGGCCTTGAACAT    AACTGTTTCAAGCAAGCCGT    II-6D04
54  B03 II  R09D1.8 TCATCCATATCAACTGCCCA    CCGCGTCTACATATCCAGGT    II-6D06
54  B04 II  R09D1.9 GGGTGGTACTACGATTGACAAAA ATCATTCATTGATGGCAGGTAAT II-6D08
54  B05 II  R09D1.10    GACGTTTTTCCAGAGCCTTG    GGGGTAGGAAGAGAAAACCG    II-6D10
54  B06 II  R09D1.11    CTGAAGGACCAGCAATGTCA    TGGTTCTTCTCTTGGTCGCT    II-6D12
54  B07 II  R09D1.12    TCAATTGGTGTGCCTCACAT    TTTCGTTACAGGGGAAATGC    II-6D14
54  B09 II  T19H5.1 TGCAAATACCACCCAACAGA    ATCGAATTGCAATAAACGGG    II-6D18
54  B10 II  T19H5.2 TAGAAAGGATGACAGGGATTTCA ACCATATCGATACTCCTCCCATT II-6D20
54  B11 II  T19H5.3 TGAGAAAAATGACAGGTTGGTCT TTGAAAATGTCGACGGTAAGTTT II-6D22
54  B12 II  T19H5.4 GGATAGACGACGAGCTGAGG    GCCCGTGTCATATGTTGATG    II-6D24
54  C01 II  R134.1  CCACTTGTTTTGGGAGCATT    TGCTCCTTCGACAATCACTG    II-6F02
54  C02 II  R134.2  GCAGTATTCCATGAATTTTAGCG TTTTATCGAGAGGCAATTTTTCA II-6F04
54  C03 II  AH6.1   CCATCTGTGCCTTCTGTGAA    CATCAATCGGATGGTCAGTG    II-6F06
54  C05 II  AH6.3   CTTGGATACCTCGTTTTTGTGAG TTTTTAATGGGGAATCAAAGGAT II-6F10
54  C06 II  AH6.4   ATTGCTCATGTTGCATCGAA    GAATTTCCGTTTCGCAGTGT    II-6F12
54  C07 II  AH6.5   TCGACAATCACAACGACGAT    TGGAGTGGTAAAGTACGCCC    II-6F14
54  C08 II  AH6.6   TTCAAGTTGTGCCGATGAAG    TTGAATCCGATGTGAAACCA    II-6F16
54  C09 II  AH6.7   ACATAAACCCAAACGACCCA    ATCTCCCACTGCACGTTTTC    II-6F18
54  C10 II  AH6.8   TTGGAAAAGATGCAGCAATG    CCTTGACGAAGTGTGCTTCA    II-6F20
54  C11 II  AH6.9   TAGATCAGAAGCAGTGGGAGAAG TGTCCGATTAATGCTCAAAAAGT II-6F22
54  C12 II  AH6.10  GACAACAAAGCACCTGCTCA    GAGGCAATTGGGATGCTCTA    II-6F24
54  D01 II  AH6.11  ATATTAGAAGCCATGTCTGCACC TGAAAATTCGGAAAAGAAGATCA II-6H02
54  D02 II  AH6.12  TTCATGCAGGAGGAAGTGTG    TTTGGAACACTGCGAACAAG    II-6H04
54  D03 II  AH6.13  CTAACAAAGAGCCGGAAGAAAAT GAATTTGCTTAAAAAGCGGAAAT II-6H06
54  D04 II  AH6.14  TGACAAGCGATTTCTGCAAC    TGCGTTATGGTACGCTGTTC    II-6H08
54  D05 II  F35H8.1 CAAATTTAAGGTCGTCAATGCTC GAAATCGTCATGCGTTATCTTTC II-6H10
54  D07 II  F35H8.3 GCTCCACTTGACACACAGGA    GTAGGGATGTCGTTCGGCTA    II-6H14
54  D08 II  F35H8.4 GTTCAGGCCTTTCCTTCATTATT TTCGTATACGGTAGCAGAAAAGC II-6H16
54  D09 II  F35H8.5 AAAGGCGTTGGATTTGTACG    ACAGTTGCTCATGAAAGGGG    II-6H18
54  D10 II  F35H8.6 TGAACAGTGAACCCAGTGGA    CCTTTTCAGTCCGACATCGT    II-6H20
54  D11 II  F35H8.7 GACTGACTTCCGGCATTGTT    AAAAGTTTGGCGGCATATTG    II-6H22
54  D12 II  E02H1.1 GCGAAATTCAACAAAACAAAGAA ATAGCACTTCCATTTAACACCGA II-6H24
54  E01 II  E02H1.2 CGTAAGTGTGTGTTTGCAATGTT TCTCCTGGAGCTGTTAGTACGTC II-6J02
54  E02 II  E02H1.3 AAACCCTGGATTTTCTCGCT    GAGTGTCCGAGGCTAAGGTG    II-6J04
54  E03 II  E02H1.4 TCGATTGGAGGAAAATCAGG    GCTGCATAAACCGACGTCTT    II-6J06
54  E04 II  E02H1.5 TCACTTCATTCATTTTCTGCTCA ATTTACAGCGTGCTACAGAGACC II-6J08
54  E05 II  E02H1.6 ATGAATGAGTTTATCAGCATGGC GTATACCTTTTGCAAATTGAGCG II-6J10
54  E06 II  E02H1.7 GTTAGCACAATGCGACGAGA    ACCAACACCTCCAAGACCAC    II-6J12
54  E07 II  T15H9.1 GGGTTTTTGAGGGAATTCGT    CAGCCCCAATTTCTTTGTGT    II-6J14
54  E09 II  T15H9.3 TTCGTATTCCAAATAACAATCCG AATAAATATCATGCATGGATCGC II-6J18
54  E10 II  T15H9.4 ATCGTGAAAGTTGGGAGGTG    AAATGCTTCGCTTCTTTGGA    II-6J20
54  E11 II  T15H9.5 AGTGACAGAGCAGCAAAAGAAAT ATGCTCTGTGCCAAAAATAAAAA II-6J22
54  E12 II  T15H9.6 CCACTCCAATGTTCCTTCGT    CAAATGTTCAATGCTGGTGG    II-6J24
54  F01 II  ZK1307.1    ATCCAGCCATCAATTCATCC    TTCCACCAAAGCATTTCACA    II-6L02
54  F02 II  ZK1307.2    CAAATTTAACGTTTTCCAAACCA GTTTTGAACCTTTTCAGCTTTCA II-6L04
54  F03 II  ZK1307.3    ACAATTCCCTCTGAGAATCAACA TAAAATCTTGGCACGTGTAAACC II-6L06
54  F04 II  ZK1307.4    GTATTATTCATTCGGCAGCAGAC CTCGAGAACGAGTTTGGTTAAGA II-6L08
54  F05 II  ZK1307.5    CACTTTGCAAGCTACCGTGA    TCCGCAAGTGGTTCCATATT    II-6L10
54  F07 II  ZK1307.7    GTGATTGCCTTCATCTCGGT    CACATCGAATCCTTGCATTG    II-6L14
54  F09 II  ZK1307.9    ACGTGCCAAAAAGATTGACC    AAAAGTTTCTGAGTCGCGGA    II-6L18
54  F10 II  ZK1320.1    TACGGATTTTTGTCTTGCAGATT TGTCGATTGTCAGACTGTTTCAG II-6L20
54  F11 II  ZK1320.2    GCACTGTTAGTTGTGGGAAAAAC CCGATAATTTGACCATTTGCTAC II-6L22
54  F12 II  ZK1320.3    CAGTTGAATGTGTTGATAACGGA AATCAGTTTTGTTAAGCTGCTGG II-6L24
54  G02 II  ZK1320.5    AGATGGCCAATAACCAACTTTTT TGTCGGAGTTTACCTCAATCTGT II-6N04
54  G06 II  ZK1320.9    TCCGATTTTTCTGTTTCGCT    AGCACTTTGTCGTCGTGTTG    II-6N12
54  G07 II  ZK1320.10   ATAGTGTGGGTGGATGAAAAATG ACCCACGCAATTTTTATTAGGTT II-6N14
54  G08 II  Y53C12A.1   CCGGATGATCAAGCAAATCT    AAAATGGACGACACAGAGGG    II-6N16
54  G09 II  Y53C12A.2   CCAGCTGAAGGAATTGAAGC    TCAACCTGGTGATCCAACAA    II-6N18
54  G11 II  Y53C12A.4   CGGAAAGGGGATGGATATTT    AAATACGGTACGCGGTCTTG    II-6N22
54  G12 II  Y53C12A.6   ATAAGCAATCAAACCAGCGAATA AGCGGAAAAGCTTCTATGAAAGT II-6N24
54  H01 II  Y53C12B.1   CTCGTTGTGCAACTGACGAT    CTCTTGCTCCACTCTGGTCC    II-6P02
54  H02 II  Y53C12B.2   AGAATCAAACTGCAAACAGCATT CCAATGGAGGAAGGTAAGAATTT II-6P04
54  H03 II  Y53C12B.3   AACAATATATGCAAATGGTTCCG GTCTTGTTCGACTATTTGATCGG II-6P06
54  H04 II  Y53C12B.4   TCCACAGAATCAACAGCAGC    GCTTGACCGACTTGGTGATT    II-6P08
54  H05 II  Y53C12B.5a  GGCACTGAAAAATAAACAAGACG GGAAAATTAAGCAAAGAAGGGAA II-6P10
54  H06 II  Y53C12B.6   CCCGACAATACCGAAAGAAA    TACCGGGAAGAAAACAGTCG    II-6P12
54  H07 II  ZK1321.1    TTCAGATGCAGTTCTCACTTTCA GACCTTCATTTGCAGGTTATCAG II-6P14
54  H08 II  ZK1321.2    AAACGACCTGAAATTGTGCC    ACTTTGAGTTTGGCTCCCCT    II-6P16
54  H09 II  ZK1321.3    TGGCTTTCTTTTCGGCTTTA    TCCCATTGTATTCGGCTCTC    II-6P18
54  H10 II  ZK1321.4    CTGCTCCAACAGCGTGACTA    TCAGCTCAACATTCCACTCG    II-6P20
54  H11 II  T10B9.1 TGGCTCAATTCCAGCTTTTT    CCGGTGCTCTGTTTATTGGT    II-6P22
54  H12 II  T10B9.2 GCTCAATTCCAGCTTTTTCG    TTCCGTCATTCATTTCCCAT    II-6P24
55  A01 II  T10B9.3 ACCAACTTCACCGGAATCTG    GCTCTTGGCCAGTCTGAATC    II-7A01
55  A02 II  T10B9.4 CCTTTCTGCTCCAAAAGTGC    CACCTTTGACGTGATCTCCA    II-7A03
55  A03 II  T10B9.5 TGGGGTTCTCCAGATGACTC    GAGAAAAGGGATCAAAGGGC    II-7A05
55  A04 II  T10B9.7 CATCGGCACTCAATTCCTTT    TGGCACTCAGCGAACATTAG    II-7A07
55  A05 II  T10B9.8 CAATCTTTCGGGCGATTTTA    TGTTGAAGATAGCGCATTGG    II-7A09
55  A08 II  Y53C12C.1   GTGCTTCTGGCAAATTGGTT    GCTTTTGCATTTTTGGGGTA    II-7A15
55  A09 II  ZK938.1 CTCCCATCGAGTTGTTATCTTTG GTATTTGGGTGCAGAGAAGATTG II-7A17
55  A11 II  ZK938.3 CTGGTGCCAGAAAACCAGAT    GAGATGTGCAGAGAGGGAGC    II-7A21
55  A12 II  ZK938.4 ATCATGGCCACTTGTTTGGT    GGTAGAGCGGTGCAAACTTC    II-7A23
55  B01 II  ZK938.5 TTTTATGTCTCCTAGCCAATCCA GTTTGCATATAGTTCGAAGACGG II-7C01
55  B02 II  ZK938.6 CAATTGTCCACATGGTTATTCCT ACATTGTGTTCCTGTTTGCTTTT II-7C03
55  B03 II  ZK938.7 CCAGGGCAATATGATGCTTT    GGCGTTATCGCGAAGTCTAC    II-7C05
55  B04 II  C08H9.1 TACGGACCTATGCTATCGGC    ATTAACACTCGGAACGCAGG    II-7C07
55  B05 II  C08H9.2 CAGACTTCGACTTGGCATCA    GGACGTCTCATTGGAAAGGA    II-7C09
55  B06 II  C08H9.3 ACAGTTCCAAGTCGATACCGTAA ATTTTCAGACGCGTCACACTTAT II-7C11
55  B07 II  C08H9.4 CCCGATTCGTTAACTTTCCA    AATTGTAATCACGAAGCCGC    II-7C13
55  B08 II  C08H9.5 TTCAGGTGCCATCCAGTGTA    GGCAATTATTTTGCTGGCAT    II-7C15
55  B09 II  C08H9.6 GTCATGCCATTGTGGAATTG    CCCTTTCCACGTAACCAGAA    II-7C17
55  B10 II  C08H9.7 TCCTCCAGGTTCCATTTCTG    AACCATTTCTCCACCTGCTG    II-7C19
55  B11 II  C08H9.8 CTCGGTGGACACACTGAAAA    TTAGGAGCTCCGACCGTAGA    II-7C21
55  B12 II  C08H9.10    CCTACTGGGAAAGAGTTGGCTAT CACTGAAACAATTTTTCCTCCTG II-7C23
55  C01 II  C08H9.11    AGTTCAGTGAATGCGCTCCT    ACTTGCACCATCCTCCTCAG    II-7E01
55  C02 II  C08H9.12    TTCCAATATGTTGCGTGGAA    AAACCTTTGGAAAACCGGAC    II-7E03
55  C03 II  C08H9.13    CTGCGTAATCCATTTTCGCT    TACTACACCGACTGGGAGCC    II-7E05
55  C04 II  C08H9.14    TCTGAAACGAAAAAGCTCACTTC ATGTTTCTAGTGACGAGGGATCA II-7E07
55  C05 II  F26C11.1    GTTCAGATTTACATTCGCTCCAC GTAGTTCTTGTTGGCTCTCATGC II-7E09
55  C06 II  F26C11.2    AATATTCTTCGCGGAAAAAGAAG CTTCCAAAAAGTGAAAATGATCG II-7E11
55  C07 II  F26C11.3    GATGGGAGCATCCACGTAGT    ACCACTTCCTTGCCAACAAC    II-7E13
55  C08 II  C05C10.1    TGCCAGATGCTGAAAAGTTG    AGTCAAAATTGCCCATGTCC    II-7E15
55  C09 II  C05C10.2    TCGGGCATCAGTGAACATAA    TGGTGGCAGTTGATGAATGT    II-7E17
55  C10 II  C05C10.3    GCAGCCGATGTAGATGGTTT    TCTCTCAAAAATATGGGCGG    II-7E19
55  C11 II  C05C10.4    TCACTTGGTTCCCTGGATTC    GTCTCGGCCAAAGTCTGAAG    II-7E21
55  C12 II  C05C10.5    TTGATCTGCCTCTATTTTACCGA GATAAAAATGCGATCTCAACTGG II-7E23
55  D01 II  C05C10.6    TGGTGATCCTCTTACCGGAG    GGCAATTTGGGCAATGTTAC    II-7G01
55  D02 II  R53.1   TGCCTGGAGTTCCAAAATTC    GAAGGGCTGGGTGTTTTACA    II-7G03
55  D04 II  R53.3   CCTCTTTCCTTCTCTTCCTCAAG AGACTTCGTTGACGATGATGATT II-7G07
55  D05 II  R53.4   ACAGAAGACGTCTCGAGAATGAG TTGCTAAATTGAACAAAATGCCT II-7G09
55  D06 II  R53.5   TTGTCGGTATTTTGTTTTCAACC TTTCGAATAACTCCAAGTTTCCA II-7G11
55  D07 II  R53.6   ACTAGTTCACAAGAGCCGAAATG AGTCAATGAACAAGCTCGAGAAC II-7G13
55  D08 II  R53.7   GGAACAACGGAAATCGAGAA    CTACTACCCGGGCATTCAGA    II-7G15
55  D09 II  R53.8   GTCCTGTTTGCTGCTCCTAGTAA TTCCCAAAGTGCTTTTATTTTCA II-7G17
55  D10 II  ZK892.1 AAATCTGTTTTGAGAAATGGGGT GATATTGGATTGTGAAGGGATGA II-7G19
55  D11 II  ZK892.2 GGAATGCTAAGAGCTGTCAATGT TGATTTCTCGTCGTTTTCATTTT II-7G21
55  E03 II  ZK892.6 TCGGTTAAACACCCAAGCTC    TTGATCTACTTGCAATGCGG    II-7I05
55  E04 II  ZK892.7 GGGAGGAGTCTAGTCAACAAGGT CCTCCATATTTTTCGCCTAAATC II-7I07
55  E05 II  F52H3.1 GCCGCCTTAAAGTTATGCAA    TCTATTCGGAGCTGAGCCAT    II-7I09
55  E06 II  F52H3.2 GGAGAGTCGAGACCTTCGTG    ATGAGCTGCAATCCGAGTTT    II-7I11
55  E07 II  F52H3.3 GCGAGATGAAGGGAAATGAA    TCTTTGGTCTTGTGACGCTG    II-7I13
55  E08 II  F52H3.4 GCCGACGAAAATTCAAAGAA    CGACCCGAAGAATTGACATT    II-7I15
55  E09 II  F52H3.5 CGACCTACGTCTACTTTGTGTCC GATTAATCCTCTCCTGTTTTGGC II-7I17
55  E10 II  F52H3.6 CTCTTATGGCTGGCTTCAGG    ACAATGGTTGAGGTTCAGGC    II-7I19
55  E11 II  F52H3.7 TCTTGCACTGTTGTTGGCTC    GTTCTTGCAGATGGCACTCA    II-7I21
55  E12 II  C18D1.1 TGTTGCCTGAGCTGATTACG    ATTTGCAGATTTGAGTGGGC    II-7I23
55  F01 II  C18D1.2 TGCACAATTTCACTGCAACA    TACCTTGACAAATGCGGTGA    II-7K01
55  F02 II  C18D1.3 CCTTCTCCTCTTCCCTTAAAACA ATCCATCGTTGAGCTGAAAATAA II-7K03
55  F03 II  ZK945.1 AAAGGTCGATCAGTTGGACG    CCCAAATTATGGCGCTATGT    II-7K05
55  F06 II  ZK945.4 TCGGTCGACATTTACGACAA    GGGAGAAATGGATCAAGCAA    II-7K11
55  F07 II  ZK945.5 TTTCTCATGATGTGCTAGTGTGG CGAAATTTCCCATTCATTTCATA II-7K13
55  F08 II  ZK945.6 GTTTTAGACTTTGGAGACGCAGA TTGAGAGAACTGTTCGAAAGGAG II-7K15
55  F10 II  ZK945.8 ATTGAGCAGATTGTTTAATCCGA ACATAAGAACAAAGGCATGATGG II-7K19
55  F11 II  ZK945.9 ACGGAGTTCAAGGATTGTGC    GGTGCATATAGTGCCTCCGT    II-7K21
55  F12 II  ZK945.10    ATGACGGCTCTGTGACTGTG    GCAACTTTGTCGTCTCTCCC    II-7K23
55  G02 II  F27E5.2 AATAGAACGTATGCGGAACTCAA GCTCAAGAACAATAGCGTCATCT II-7M03
55  G03 II  F27E5.3 AACACAATGAAAACGAGGAAAAA TTTGAGTTGCTGAAATTGTCTGA II-7M05
55  G04 II  F27E5.4 GGGATCAAATGAAGAAGGAGACT TATTTTCCGAGCAAATTTTTCAA II-7M07
55  G06 II  F33H1.1 GGTGCACCATGACACTATCG    AAACGAGCGAGAAAGGACAA    II-7M11
55  G07 II  F33H1.2 GATGCGGTTGATTTTGCTTT    GTCATCCATCGAAGCTGGTT    II-7M13
55  G08 II  F33H1.3 CTGGATGAGACAACGAGCAA    CAGCAGGTTCATTACTGCGA    II-7M15
55  G09 II  F33H1.4 CATCCTGAAGTGATGCCTGA    GATCGCTTTGGCACGATATT    II-7M17
55  G10 II  F33H1.5 GCCCCTTCGTTTGACTTGTA    TGTGTGGCATCTCTTCTTGC    II-7M19
55  G11 II  R05H5.1 GGCTAAACTTACATCGACAATGC GGATTTCTCCCTCGTCTACATCT II-7M21
55  G12 II  R05H5.2 ACGCGAAGTCGTGTTTTTCT    AGCAGAAGCCACTTGATCGT    II-7M23
55  H02 II  R05H5.4 GGTGGTGCCGAAGTAGTGAT    ACTCTTCTTGGCAGTGCGAT    II-7O03
55  H03 II  R05H5.5 CACGGAAGACAGGTTTTTGATTA TGTGTCAGTAAACGATGATCTGG II-7O05
55  H04 II  R05H5.6 ACTGCGACGAGGTGAGTTCT    CACCTCTGACCGACATCAAA    II-7O07
55  H05 II  R05H5.7 CGTTTCACAAAATTTCTCTCCAC ATAGCACATCAATCGCAAAGAAT II-7O09
55  H06 II  T01E8.1 AATGCCCAAACCTTTCACAG    TCTTTTGAGGTATCCCACGG    II-7O11
55  H07 II  T01E8.2 TCATCAAATCCAAATCGCAA    CATTGGGAAGAATGGGAATG    II-7O13
55  H08 II  T01E8.3 GCGGGTACCTACTGAAACCA    TTTTGGATTTGGAGGAATGC    II-7O15
55  H09 II  T01E8.4 CTTATCCCCTTGAACAGCCA    ACGAATTTTTCTGCGGTGTC    II-7O17
55  H10 II  T01E8.5 GGCATAAAGATGTAATTGAAGCG TAATTCAAAAGAACGGGAAGTCA II-7O19
55  H11 II  T01E8.6 GACATTTTTCGAAGACATCCTTG TCAAAGTGAGAAAGAATTGCACA II-7O21
55  H12 II  F54B3.1 CAGTGCCTGAGAAGGAAAGG    TTGGGGCACCAACAATAAAT    II-7O23
56  A01 II  F54B3.2 TTTTTGTGGATTTTCCCTCG    TTTCCAGCTCTGTCACGATG    II-7A02
56  A02 II  F54B3.3 CGCTAAACGAGGAACTGGAG    GTTCATGTTGAACCATTGCG    II-7A04
56  A03 II  ZK971.1 AAAAGTTGGGAAGAGAGGTTCAC ATTTTTACGTCATCACACATCCC II-7A06
56  A06 II  ZK970.3 GGCTTGAAGTTGCAAAATATCAC GAAGATAGAAATTTTCCGCGATT II-7A12
56  A07 II  ZK970.4 TTTGTGCTAGAAAACGGTTCATT GTTTCTGGTTTGTTTTCACCATC II-7A14
56  A08 II  ZK970.5 AAATCCCATGCTTCCCTTTT    GAATGACCGGCGAAGTTAAA    II-7A16
56  A09 II  ZK970.6 TTTCTGCTCACCATCTGCAC    TCAAAATCTCTACCGCGTCC    II-7A18
56  A10 II  ZK970.7 TTCTTCTCAAATTCAGCGACTTC CTACGTTCAGCTACTTGCCTTGT II-7A20
56  A11 II  M02G9.1 CTCCATCTCAAGCTTCTGGC    GGTGGGCTGGCTGAATATAA    II-7A22
56  A12 II  M02G9.2 AACGAACAAAACGCCAAAAC    TCCAAGTCTTGCCCAAAATC    II-7A24
56  B01 II  M02G9.3 TCGAGTTCATCGTGTTGCTC    CATGCTGGAATGCAGACACT    II-7C02
56  B02 II  C07E3.1 GTCGAATTGGAGGCATCACT    AAGGTAGGCAAAGGGTTGCT    II-7C04
56  B03 II  C07E3.2 GATGTGGGCCAACCAACTAC    TTGCCAAAACCACACAAAAA    II-7C06
56  B04 II  C07E3.3 CAGGTTGGAGTGGGGTTAGA    CTAAGCCAACCAACTCTCGC    II-7C08
56  B05 II  C07E3.4 CATTTTCCAGTTCGAGCACA    ATCTCCCACCACTTGCAGTC    II-7C10
56  B06 II  C07E3.5 GTCGTCGTTTTTGTTGCTGA    TCAGATTTTCTCAATCGGGG    II-7C12
56  B07 II  C07E3.6 TTTTCCGTTTACGGTTACTGAAG CACGTATTGATTGGTTGAACAGA II-7C14
56  B08 II  C07E3.7 ATTGTTCGAAAAACTGGCAAATA TTCAGTAACCGTAAACGGAAAAA II-7C16
56  B09 II  C07E3.8 CACGATGTAGTGGAAAGCGA    AAGCTCCCACGGGTATTCTT    II-7C18
56  B10 II  C07E3.9 ATTTTGGCTGCATGTTGTTTAGT AACCTGACGTAACATTGGAGCTA II-7C20
56  B11 II  C07E3.10    GGGAGATAGGTACAAAAGCCATT ATTAGAACTTGTCGGGGAGTAGG II-7C22
56  B12 II  T09F3.1 CATTTCTCGGTTTCCTCTATGTG CCCGAATATAGCAATGAAAACAG II-7C24
56  C01 II  T09F3.2 TAAAAGTGGAGGAACCAACAAGA TAACTATCAGGGCCAAATGAGAA II-7E02
56  C02 II  T09F3.3 GAATCAACGGTTTCGGAAGA    TCGACAACACGGTTCGAGTA    II-7E04
56  C04 II  E04D5.1 GCTTGCAATGTGTTCGCTTA    CGTCTCCACATCCCAAAACT    II-7E08
56  C05 II  E04D5.2 ACGATTTCAGACGATACCGC    TTTTCCAGGGGTAAAAGCCT    II-7E10
56  C07 II  E04D5.4 TAATTCAAGATCAATCGCCCTAA TGCTCAATGATCAACAACAAATC II-7E14
56  C12 II  ZK673.5 ACGAAGATAGATATTCCCGAAGC AATTTCAAGGGGTACACGAAAAT II-7E24
56  D01 II  ZK673.6 CGCGTCATCCATTCCTTTAT    GACCAGCGAATTCGGAAATA    II-7G02
56  D03 II  ZK673.9 TGTGCTGCTTGCTTGAACTT    TCCAACTAAATACCCAGCGG    II-7G06
56  D07 II  ZK666.3 GCTGCCGTGGAAATATGAAT    ACCGCTGAACTGGATATTGC    II-7G14
56  D08 II  ZK666.4 CATCGTAAAAGGTGCAAGGTATC AATTGGCACTTGGAGAGTTGTAA II-7G16
56  D10 II  ZK666.6 GTGGTTGAGGCATTCCTTGT    TAGCTGTGGTGGACAACTCG    II-7G20
56  E01 II  ZK666.10    TCACCTTGCAACTCAACAGC    TTTAATCGGAGGCGTTTCAC    II-7I02
56  E02 II  F59B10.1    ATGTGGTTTACGATCGGCTC    ATTGTGGTGAAGAGGCGAAG    II-7I04
56  E03 II  F59B10.2    TCTTCATACGGAATGGGCTC    GAGAGCCACGAAGAAAAACG    II-7I06
56  E04 II  F59B10.3    AGCACACTCGTAATCCTTCTCTG GTATCGGTAATTGTCACGGTCTC II-7I08
56  E06 II  F59B10.5    TTGACATGGAGCAGGATAGATTT GATCCATTTGAAATTTTGTGGAA II-7I12
56  E07 II  F59B10.6    GTTCTGGGATAATGATGGATGAA AGAAGTAACGGAAAAGCATGTGA II-7I14
56  E08 II  R166.1  TAGTTCTCCCAAACCGATGC    ATTGAGGCCAATGCTGTTTC    II-7I16
56  E09 II  R166.2  CTTTTTGGCGAAATTGTGGT    TCTCAATCACTGGCATCCAA    II-7I18
56  E10 II  R166.3  ACGCCGGATAATTATATTCACCT ATTGGTGTTGCTGTTGATCTTTT II-7I20
56  E11 II  R166.4  ATTTTCCAGAAGCATCACCG    GAATTCCCGTTTTCCCATTT    II-7I22
56  E12 II  R166.5  TCGGAGATCATACCCCACTC    AATTCCGCGCATTAGAAGAA    II-7I24
56  F01 II  C06A1.1 GTGAATGCGCAGAATCTCAA    ATCCTAACACCACGCAAAGG    II-7K02
56  F02 II  C06A1.2 ATTCCTATGCAGCTTCATCCATA TCGGTGTTGTTCCTCAGTATCTT II-7K04
56  F03 II  C06A1.3 AGGAGAATCCGAAATTGGCT    GTTATCAGACGGCGTCCAGT    II-7K06
56  F04 II  C06A1.4 CGACCTTCATCCCTGAAAAA    GTCTACACGCCTTCTGGAGC    II-7K08
56  F05 II  C06A1.5 GAATTCAAATTGCCTCTCACAAC GATCAGAAATGAGGAGAGCAAAA II-7K10
56  F06 II  C06A1.6 GATATGCCGTTAGTAAATGCAGC TCTTACGTGTTTGTCGTCTCTCA II-7K12
56  F07 II  C14A4.1 GAGAGGCATTAAACGACACAAAG ACAAGAACAGGAGGAAATCAACA II-7K14
56  F08 II  C14A4.2 GCAATGGATCAAAGCAAGGT    TCGTACTCCAAATCGTTCCC    II-7K16
56  F09 II  C14A4.3 CTCCATTTGGCTTTCCTCTG    TTGGCAGAAAGGAATGGAAC    II-7K18
56  F10 II  C14A4.4 AAAACGACATTCTTGGCAGG    CGGAGAGTGAGGTAGGCAAG    II-7K20
56  F11 II  C14A4.5 GTTGTTGTGCTTTTTCTTTTGCT ACAACGACAACAACAAAACATTG II-7K22
56  F12 II  C14A4.6 TTGAATATTCGTAGACTCCAGCC TCAAGATTCAAGAAAATCCCAGA II-7K24
56  G02 II  C14A4.8 TAAAAGTTTTTCCTCTTTTGCCC CAAAGTTTTAACGTAACCTCCCC II-7M04
56  G03 II  C14A4.9 ACGGAAAAATCCAAAAAGAGAAG TCCCATTACATATCCCAAGTCAG II-7M06
56  G05 II  C14A4.11    GATGAGTGTGTGGATGAGAACAA GTATTTCTCCAACTTTTCGCCTT II-7M10
56  G06 II  C14A4.12    CATCTCCTTGGTCCTGGGTA    TCAGTGGTCTTCCAGCTCCT    II-7M12
56  G07 II  C14A4.13    ATTCACCGAGACGTCAAACC    CACTGTGCTTCTCAATCGGA    II-7M14
56  G08 II  M28.1   GGGGAGGAAAATAACGGAAA    GTTAGTTGCTCGCCGAGTTC    II-7M16
56  G09 II  M28.2   TCCTTCACCTCGATTGCTTT    ATCTTCAATTCCCGGTTGTG    II-7M18
56  G10 II  M28.4   AAGCTCGCCACAATTGTTCT    TGGACTTCACGGATGGTACA    II-7M20
56  G11 II  M28.5   ATGTATTTGCAATTTGGGACAAC CTCTTTTCTTTTGTTTCTCCCGT II-7M22
56  G12 II  M28.6   ATCTCATCAAGACGATTGAGCAT AAAGGCAATCGCTGATAACTACA II-7M24
56  H01 II  M28.7   AACTCCGAGGCGACTAGACA    TTTTGTCAGACAGTGCCAGG    II-7O02
56  H02 II  M28.8   TCTATGCGGGACTTTTGGTC    AGCCATCCCAGTACAAATGC    II-7O04
56  H03 II  M28.9   TCGCTGTGATTCTTTCGTTG    AAGAACATTGCGACTCCACC    II-7O06
56  H04 II  D2089.1 ACCCACGCAAGAGTACATCC    CCATTAGTCGGTGTTGGCTT    II-7O08
56  H05 II  D2089.2 TCAGTGTATCCTCGCCAATCTAT AATTGTCGGTTGCAAACTTTCTA II-7O10
56  H09 II  C09G5.1 TTTCCAAGAGAAATGGGTCG    GAACTTTTCGTCGCACACAA    II-7O18
56  H11 II  C09G5.3 GTTTGCGAAGGAGACGAGAC    TTTCCCGTTTCAATGGTGTT    II-7O22
56  H12 II  C09G5.4 TGCTCGCAGTGTCTTTGTTC    TATTCATTAGCTCCCCCACG    II-7O24
57  A01 II  C09G5.5 TTGTGGTCTTCGGAGCTCTT    AGCTGGGCATGGACAATAAG    II-7B01
57  A02 II  C09G5.6 CACACCGACAAACTCCACAC    GGGGAAGGGGTGAAAATAAA    II-7B03
57  A03 II  C09G5.7 AAACGAGAAATGCCGAAGAA    CGACGCTGAAATGCATAAGA    II-7B05
57  A04 II  C09G5.8 ATTTCGCCGAAGTATGTTGG    AAACATCACCTTTGCCTTGG    II-7B07
57  A05 II  C52A11.1    TCTCCGGAGGATACACCAAG    GGGGCCATAGATATCAAGCA    II-7B09
57  A06 II  C52A11.2    GCCACCCTCTTCTTCTTCCT    GCCACGTCATAATTGAGGCT    II-7B11
57  A07 II  C52A11.3    TCTCATGAAAATGATCAGAGGGT GCGAGATTTGAATTTTGGTACAG II-7B13
57  A08 II  C52A11.4    ATCCAAAACCGATCAACCAA    GGGCCTAGTGATGTTTCCAA    II-7B15
57  A09 II  T19E10.1    CTCTGATTTCTGCCAAAGCC    GGCAAAGAAATCCGATTCAA    II-7B17
57  A11 II  R06F6.1 GAGGAAGACGATGAGCTTGC    TCAACTTCTGGTCGCATCTG    II-7B21
57  A12 II  R06F6.2 ACCGGCATTTCATCAGAATC    CAAATTCCATTTTTGCCGTT    II-7B23
57  B01 II  R06F6.4 GCTAGAAACCGCAAAAATGC    CCGGAAAGTTGAGCAGAAAC    II-7D01
57  B02 II  R06F6.5 GTTCCAGAACTTGTTGAGCAATC TCAGTTCATTGGTCTCCATCTTT II-7D03
57  B03 II  R06F6.6 CCGCGGGAAGTATGAAGTAA    TGGGTCGAATAATGGAGGAG    II-7D05
57  B05 II  R06F6.8 TCGGAAAATACCTACGTGCC    CGACAGCTCATCTTCATCCA    II-7D09
57  B06 II  R06F6.9 CCGCAAGTGTAAGTCTGCAA    TAATCCTTTGCAGTTTGGGC    II-7D11
57  B07 II  R06F6.10    GATTTTTCGCCGACTTTCAA    CTTCAATTCCCTTTTTGGCA    II-7D13
57  B08 II  R06F6.11    CAGATTTCAAGTTCAATTTTCGG TTTATCACCCCTCCCTTCTTTTA II-7D15
57  B09 II  VM106R.1    GGACAACAAAAAGCTTACCCTCT ACTTTGTGTTTGACACTCCGAAT II-7D17
57  B10 II  M106.1  AAATCAATTCGACAGGGTGC    GAAAGATGAGCCGCTGAAAG    II-7D19
57  B11 II  M106.2  TTAGAAGTTGTCCGGAATTTGAA TATGAAAAGCAGGTAAAAACGGA II-7D21
57  B12 II  M106.3  GTAACCATTCTGACAACTGAGCC CAATCGATTCTCCATCAGAAAAG II-7D23
57  C01 II  M106.4  GAAAGGCCAGTGATGACGAT    ATGACACATTTTTGGTGCGA    II-7F01
57  C02 II  M106.5  GACGGACCTCATCGATCTGT    ACTCGCGAACGATCTCATCT    II-7F03
57  C03 II  F59E10.1    AATTTCAGAAAATGCCACGG    GATACCCACCGAATTCCAGA    II-7F05
57  C04 II  F59E10.2    ACTCGGCTGTACCGAACTGT    CCGATTTGTTTTCGCAATTT    II-7F07
57  C05 II  F59E10.3    GCAAAAGAGAGGATTTGCAATAA AAACACCATTTTATCCGAGGTTT II-7F09
57  C06 II  F44F4.1 TCAGCAGCACTTTGAAGATAACA ATGCATCTCACTCCCATATCACT II-7F11
57  C07 II  F44F4.2 GGAAGACCATACGCCAGAAA    AGTCATCTTCCGCTCTCGAA    II-7F13
57  C09 II  F44F4.4 TTTCAGAAAAGTGAGCGCAA    GGCTTATCCAATGGTGCAGT    II-7F17
57  C10 II  F44F4.5 AATCCGAGAAACTGTGACGC    TTCCCCGAGATGTGTTCTTC    II-7F19
57  C11 II  F44F4.6 GCATCTGGGCTTAAACTTCG    TTATTTCAGATCGGCGAACC    II-7F21
57  C12 II  F44F4.7 TCATCCTGGGTCTCCTTTTG    TGTGCATCAGAAATCCAAGC    II-7F23
57  D01 II  F44F4.8 TTGGTCATTCAGCAATGGAA    AACGAAACTTTGCCCATTTG    II-7H01
57  D03 II  F44F4.10    CAAATAACCACGCGAATAAATCT ACAAGGGAGATTTTGTGGATTTT II-7H05
57  D04 II  F44F4.11    GGCGCAACACTATTTCCCTA    GTACTTTCCGTTGCGTGGAT    II-7H07
57  D05 II  F44F4.13    GTGCCAAGACCAGACCAGAT    AAATTGCTGAGCTGTTGCCT    II-7H09
57  D06 II  Y19D2B.1    CATTCCAAAAGCTTCTCATTTTG TTTGAAGGAGCACTTTCTGTAGG II-7H11
57  D07 II  R03D7.1 TGTTCGTGATGCTTTCTTGC    CGCTCAACTTCTTCCTTTGG    II-7H13
57  D08 II  R03D7.2 TCGTAGCTAGCGATCCCAAT    CCGATTTCGTGCAAATTTCT    II-7H15
57  D09 II  R03D7.4 GCGCCATATCGATTACCATC    ATTGGCGAAATATGCGAAAC    II-7H17
57  D10 II  R03D7.5 ATTGATTAAACGATGATGAACGG TTCCAAACCAAATCATGTAAACC II-7H19
57  D11 II  R03D7.6 ATTGTTTGTTTGCAATCCACTTT TCTCGATCCATTTCTTGATTTGT II-7H21
57  D12 II  R03D7.7 TGGCAAAGTGTGAAGTCTCG    ATACGAAACCACAGGCCAAC    II-7H23
57  E01 II  R03D7.8 CGGAACAGGTGATGAATGTG    CTGCTCAATCACTTGCGGTA    II-7J01
57  E02 II  C09D8.1 ACCAATGAGCGAGAAGCTGT    AAGATCAAAAACGGTGTCGG    II-7J03
57  E03 II  C09D8.2 TCCCCATTATCCACATTGGT    TGATGAGAAACAGGCCACTG    II-7J05
57  E04 II  F38A3.1 TCAGAACCCGGTCAATTTTC    TCCCTCTCAATTCCAGCATC    II-7J07
57  E05 II  F38A3.2 CACCGTTCACTTTTCGGATT    GTAAATCAGCAGCATTCGCA    II-7J09
57  E06 II  F33A8.1 TCGACGGATGCTATTGACTG    TCAGATGAGAGGAGCGGAAT    II-7J11
57  E07 II  F33A8.2 ACAAAAGGATGATGGAAATGAAA TGATAGCTCTTACTCAACTCCGC II-7J13
57  E08 II  F33A8.3 GTGTTTTAGAGGGGGAGCTTAAA TTTCGGAAAACAACACTTTCATT II-7J15
57  E09 II  F33A8.4 ATGGTGGATCGGTGATCATT    AGCGAAACGACTTGAAAGGA    II-7J17
57  E10 II  F33A8.5 AACTCGGAACTAAATCTTGAGGC AAAAATCGCATTGATATTCGCTA II-7J19
57  E12 II  F45E10.1    CTCAAGATCTTTTCCAGGCG    ATTGTGCGGTCCGTAGATTC    II-7J23
57  F01 II  C09H10.1    GCGCTTGTTTTTAATTTTCATTG TCCAACTGCTTCTTGAGATTTTC II-7L01
57  F02 II  C09H10.2    CGTGAAGCTCCTGACTAGATTGT CAATTTCCAGGTAAAATGGTCAA II-7L03
57  F03 II  C09H10.3    GTCTCTCTTGGGGCTAGGCT    TATCCCATCCACCGATGACT    II-7L05
57  F04 II  C09H10.4    CATTGTATTTTTCATTTTTCGGC ATAAAACCTCATTCATTCAGCGA II-7L07
57  F05 II  C09H10.5    GAAAATACACGAATGGAAATGGA CAAAAATCCTTTCAAAATGCAAA II-7L09
57  F06 II  C09H10.6    AAAGCATCGGATTCGTTGAG    CGACGAACCTGGAAATTTGT    II-7L11
57  F07 II  C09H10.7    TGTGGTGGACCTGATACGAA    AACGGCGAAGCATAACACTT    II-7L13
57  F08 II  C09H10.8    ATAGCTGATGTCCGTCAAATTGT GATCTACCAGAGACTATGCACGC II-7L15
57  F09 II  C09H10.9    ACCGCGACTTATTGGTTGTC    CTCGATGGCACATTGTTGAG    II-7L17
57  F10 II  W10C6.1 CTGGGAAGAAGCATTTCGAG    AAACGTTGACCTCATCCTGC    II-7L19
57  F11 II  F40F8.1 ATTCAAAAAGGGTCCGAAAAATA GAAGCTTTAGGGGTAAGTACGGA II-7L21
57  F12 II  F40F8.3 CTTTCGCTCTGTGTCGTTTATTT TTTTCTGAAATATCCCATCTGGA II-7L23
57  G01 II  F40F8.4 AACCTGATTGCTTCGAAATACAA TTCAGTCGACCATGAAATACCTT II-7N01
57  G02 II  F40F8.5 ATGCTCTTCGTGTCGGAGAT    GGAGACCAACGGACTTCAAA    II-7N03
57  G03 II  F40F8.7 GGCAGACAACCATACCTCGT    ATAATGATTTCGGCAGTCCG    II-7N05
57  G04 II  F40F8.8 CCTTCAACTTTGACCTCCCA    CCTCGCCTTCTCCATCATAA    II-7N07
57  G05 II  F40F8.9 CGAAAAACACTATCAGGAACTGG CCTTGGATCTTCTAAATACGGCT II-7N09
57  G06 II  F40F8.10    AAACGAATCACTGGAAGACGTTA GAAAATCGCTGAATTTTTGAATG II-7N11
57  G07 II  K07C10.1    TTTGTTTGGGGGAAGCATAG    TTGAAATGTTTGGCGATCAA    II-7N13
57  G08 II  F37H8.1 ATAATTTGGCGATGAGAGCG    AGCGAGCACTTCAGTTGGTT    II-7N15
57  G09 II  F37H8.2 CTCATTTGGGCCTTTGTCAT    CTTTCAGGAATGTGTGGCCT    II-7N17
57  G10 II  F37H8.3 GCAGACACACTTAGCTGCCTATT CTTTTCTGCAGCTTCAATGTTTT II-7N19
57  G11 II  F37H8.4 GGTCGTGTCCGTCACTTTTT    TCGGAGTATTTCATCCAGGG    II-7N21
57  G12 II  F37H8.5 TTTTGCTCCTTGGAGCTGTT    TGACCCTCTTCTCGATGCTT    II-7N23
57  H02 II  T06D8.2 ATTTTCAGATGAAATCACTGCGT GCTAGAATTTCACTTGTCTCGGA II-7P03
57  H03 II  T06D8.3 TCTTCCCTTACCATCATCGG    GGACGCAGTAGCACTGAACA    II-7P05
57  H04 II  T06D8.4 TCGAGACGTTAGATTGCTTCTTC CGATTTTCGGTTATAATTCCCTC II-7P07
57  H05 II  T06D8.5 ACGAAAGCACCCATAATTGC    ATCCAGAATGTGAGGCAAGG    II-7P09
57  H06 II  T06D8.6 AAGCAACAACCATTCGATCC    GTTTGCAACGACACTCCGTA    II-7P11
57  H07 II  T06D8.7 AAATGACGGTTAAATAGGCAGGT AGTACTGTGATTGTTCCAGCCAT II-7P13
57  H08 II  T06D8.8 GAGTTCCTTCGAGCGATTTG    ATTGTCTTTCGCGTCTCGAT    II-7P15
57  H09 II  T06D8.9 CCAGTTGAAGTGTGTCGGTG    TCGGAACTTGAGAAGCCTGT    II-7P17
57  H10 II  T06D8.10    GATCCACAGGCTCACTCATATTC ATGGACAATCCAGTCAAGAAGAA II-7P19
57  H11 II  T05B9.1 AACTCGTGATCGGATGGAAC    GATGCGTCACTGTCGAGGTA    II-7P21
57  H12 II  T05B9.2 CATCGCCTCGTTAGTTATGAATC ATGAAGGTATTGGACATGAATGG II-7P23
58  A01 II  C47G2.1 GGTCGTACCAATGCCAGTCT    TCATGGTGGGGCAAATAAAT    II-7B02
58  A02 II  C47G2.2 CTCTCCGAGCCATCAACTTC    TCAGGGGAAATGAAGAATGC    II-7B04
58  A03 II  C47G2.4 CCTCCAACATTGGTCGTTCT    AGTTTGGCACCGAAAATACG    II-7B06
58  A04 II  C47G2.5 ACAAATGCCTCCGAAACATC    TTCTGATTGGGAATTCCTGC    II-7B08
58  A05 II  T24F1.1 AACTTCCTCGTCTCGCAAAA    CGGAAAATCTAAGCGGTGAA    II-7B10
58  A06 II  T24F1.2 TTTTCAGACCTCGGATAAAGACA GGCACTGAAAATTGAAAAAGTTG II-7B12
58  A07 II  T24F1.3 AGTGCGGAGATTTCATTTGG    CTTTTGCCCATGACGTTTTT    II-7B14
58  A08 II  T24F1.4 AATTTTCAGACTCCTGAACCTCC ACATTGTCTCATGCTCCAAAACT II-7B16
58  A09 II  T24F1.5 CTCATCCCAAGAGTTGAAAAATG ATAATCCAGCAAAATCCCAAGAT II-7B18
58  A10 II  T24F1.6 CAACCGTACCCCTCTCAAAA    TCTCCTCTTCTCCGTGCATT    II-7B20
58  A11 II  B0491.1 ATGTCTCAAACGGTGGAAGC    GGCCAGGAACATCAAAAAGA    II-7B22
58  A12 II  B0491.2 CCTAATGGGAAAACGCTCAA    ATCTGCTCCACCAGGTCAAC    II-7B24
58  B01 II  B0491.3 AGATTGGAACGATAACGCAGATA TTTGCCAATTTGCATTTTATTTT II-7D02
58  B02 II  B0491.4 CAGCGTAACCGGGAATAAAA    TTGGGTGGTCTCACAGCATA    II-7D04
58  B03 II  B0491.5 AAAATCCAATCAGTATCGTGTGG CGTTCTGGAAAACTTCGTCTTTA II-7D06
58  B04 II  B0491.6 CGAAATTGGGATAAAATGTGAAA ATCCGGTTCCAATTGAATCTAGT II-7D08
58  B05 II  B0491.7 CTCGCGTTCATCTAGAAGCC    GGCGAAACTGGATACGGATA    II-7D10
58  B06 II  B0491.8 GCCAATTTTCTTGCTCTTAGGAT CCACTGATCCGAGTAGAATTTTG II-7D12
58  B07 II  C33B4.1 CGCCGATTGGAGGTACTTTA    ATGGATACTTTTTGACGCGG    II-7D14
58  B09 II  C33B4.3 AGCAAAAATCGGACACAACC    TCTGCCGGATTGAATAGGTC    II-7D18
58  B10 II  C05D12.1    AGGGCATGGAACAGCATTAC    TGCATCAAATGCCATCCTAA    II-7D20
58  B11 II  C05D12.2    CCGTCTCCAGCAAACTTCTC    TGGCTCTTGAAGTCTCGGAT    II-7D22
58  B12 II  C05D12.4    TTTCCCACGGAGTTTGAAAG    GTTCTCCGAGACTTTCCACG    II-7D24
58  C01 II  C05D12.5    TCAATCGATATCTCAAGAACGGT TTCAATGGAAATGTGCTTTTTCT II-7F02
58  C02 II  C05D12.6    GTGAGCAAGTGAAAGAGCCC    CCATTCCTTTTCGCTGTCAT    II-7F04
58  C03 II  VW02B12L.1  GCAATCTCTGGTGGGAATGT    AGGCTGGCCCAATTAGTTTT    II-7F06
58  C04 II  VW02B12L.2  AAATTGAAAATGCTTGTCATGCT GGTGTCACACAAAAGAAATCACA II-7F08
58  C05 II  VW02B12L.3  GTTTTCAGAAACCGAGGCAA    AACGAGCAGAAATTGATGGG    II-7F10
58  C06 II  VW02B12L.4  ATTGATATCTCTGAAACAAGCCG CAATCCAGCATTACTCGAAAAAG II-7F12
58  C08 II  W02B12.2    CACATGAGAGGTGCAATGATAAA TTATAACTCTGTGGCATCGTCCT II-7F16
58  C09 II  W02B12.3    TAATTTAAGAAATGTAGGGCGCA AGAACTGTGCTTATTCAGCTTGG II-7F18
58  C10 II  W02B12.4    GCAATATCTGGCGTCTGGAT    TTTGCCGAACACTTTGTGAG    II-7F20
58  C11 II  W02B12.6    AAGCTCGTCGCATCATTTTT    TCAACGTGTATTCAACCGGA    II-7F22
58  C12 II  W02B12.7    CGATCCTGCACCCAAATACT    CTTGCGCTGATGTATCCAGA    II-7F24
58  D01 II  W02B12.8    TTCCCTCACATCTCTCACCC    CAGTTCACCGAGCTCACAAA    II-7H02
58  D02 II  W02B12.9    AATTGGGGGAAAAATTGGAG    AGTACTGGGCAAAATGGGTG    II-7H04
58  D03 II  W02B12.10   ATGAATGTTGGAAGTAGGCAGAG GCACTTCACGATCTTCTCATTTT II-7H06
58  D04 II  W02B12.11   AAGCCGTCACAAAACCAAAG    CAATCCATCGTACGCAACAC    II-7H08
58  D05 II  W02B12.12   AAATGCACAGAGAATGTCAGGAT TTCCAAAAGTGTGATAGTGCCTT II-7H10
58  D06 II  B0334.1 TGTGAAAAATGAGAAATGTGTCG TGCCAAAAACAACACAGTGTAAC II-7H12
58  D07 II  B0334.2 CCAGGCTGTGCTGACTAACA    GCTCCACAAGCCATAATCGT    II-7H14
58  D08 II  B0334.3 GTCCACGATAGATTCCAGAGTTG TCACACAATTCCTGCTCATATTG II-7H16
58  D09 II  B0334.4 TCCACACTTTTCTCATCGATTTT GAAAAGCCTTATTGAGAAGAGCC II-7H18
58  D10 II  B0334.5 GTCTTGAAATGGTTCGAAAACAC CATTCTAATTCGCCACATTCTTC II-7H20
58  D12 II  B0334.7 TGAAAACTTTGGAGGTTCAAAAA ACGTCAAAACGGAAAGTGTAAAA II-7H24
58  E01 II  B0334.8 AAACACAGGGAGAGAGGAGAGAG TGGAATAATCGAGATTTGTTCGT II-7J02
58  E02 II  B0334.9 CGTTTGAGCCGAAACTCATATAC GACAAGTGGTTGGTCTTTAATCG II-7J04
58  E03 II  B0334.10    TCGTAATCAATAGCGGGAAATTA ATTTCTTGGCTGAACATTCATTG II-7J06
58  E04 II  B0334.11    TTATGTTATGGGCAACTGGAATC GGCAGGATACATTTGTGACTCTC II-7J08
58  E06 II  Y62F5A.b    ATGGCGTTTAACAAAACATTGTC TTTTTCTCTACCAACCTGATGGA II-7J12
58  E07 II  Y62F5A.c    ATATTCTGGCTGATTTCCACTGA ATCCGAATTACAATCCACAAATG II-7J14
58  E08 II  Y62F5A.d    TTCGTCTTGGTAATAAGCTCGTC ATTATTTGAGCACCTGTTGAAGG II-7J16
58  E09 II  Y62F5A.e    CGACGATATATGGGTCAAATGTT CTGTTCTACATTTGGGATCAAGC II-7J18
58  E10 II  F54D5.1 CAAAACATTGCCCGAACTTT    AGAAACTTTTCACCGAGGCA    II-7J20
58  E11 II  F54D5.2 ATTTTTAGGGAAGCAGTAGCCAG CAATTATTGCAGACCAACTGACA II-7J22
58  E12 II  F54D5.3 GATTGTTTGATTTCCACCATCAT CGATAGCTATTTCATCCATTTCG II-7J24
58  F01 II  F54D5.4 TGCCATTTAAAGGTATTCTTCCA ACATTGCGACTTTGAGTCAGTTT II-7L02
58  F02 II  F54D5.5 TAAAAAGTTTCGGACGCACC    TTGTTAATTTCCAGGCTCGC    II-7L04
58  F04 II  F54D5.8 TCAGCAAAGGTGCAACAGAC    TGGATTGAGTTGTGATGGGA    II-7L08
58  F05 II  F54D5.9 GAGTTGCGCAAGATGATTGA    TGTGCTCACGAGTCAAAACC    II-7L10
58  F06 II  F54D5.11    TAAGAAAACAAACGGCTGGG    AAGCAGCAAAAGCGAAAAAG    II-7L12
58  F07 II  F54D5.12    TATCCGAGTTTTGCAAGTTTGTT AGCCGAGCTTTGTCTCCTACTAT II-7L14
58  F08 II  F54D5.14    CATGCACGTGGTACTTTTGG    ACGAATGCTCGTCGACTTCT    II-7L16
58  F09 II  F54D5.15    CAACTTTTCAACTACCGTAACCG AACGACAAAGAGCAGAAGATGAG II-7L18
58  F10 II  D1043.1 GTCGTTTTGGGCCAGTTTTA    TGCCTGATTTCAGTGCAGAC    II-7L20
58  F11 II  F07A11.1    TTTTCAGTTCTTGCCGCTTT    TTCTTCCCGCCAATCTTATG    II-7L22
58  F12 II  F07A11.2    CCGACGTCCTGAAAAATCAT    GTCATCACAGCCCATTCCTT    II-7L24
58  G01 II  F07A11.3    AATACGAGACGGTTTGCACC    GATAGAACAATCGCAGGGGA    II-7N02
58  G02 II  F07A11.4    GCCAAGGACCAAAAATCAGA    TCTTGGGGTTTCCAACTCAC    II-7N04
58  G03 II  F07A11.5    TATTTGACACGTGCTATCAATCG AAGCAGGACACCTACAATTCAAA II-7N06
58  G04 II  F07A11.6    GCTGACTCGGAAAGTGAAGG    CCACCATCGAGAAGAAGCTC    II-7N08
58  G06 II  ZK20.3  CAGAAGTTATTGGCATGGGTAAG TTTTGTCCGTTACATTCAGGACT II-7N12
58  G07 II  ZK20.4  CCTCCCACAACCACTTATCTGTA GAGTCATCACGATTTCGTACTCC II-7N14
58  G08 II  ZK20.5  AAATCTTCTGGCTGTGTGGG    TGCTAAAACAATGCATCGGA    II-7N16
58  G09 II  ZK20.6  CTCCGTGTTTCTCCAGATATGAC ACTGACACTTTCAACCACTCCAT II-7N18
58  G10 II  C47D12.1    GTGACCAGAATCTTTGGATTGAG GTGCAAATACTTGATGGAGAAGG II-7N20
58  G11 II  C47D12.2    CGTCGGATGAGGAAGATGAT    TCGAACCAGCACAAGAGTTG    II-7N22
58  G12 II  C47D12.3    GGTGTGGAAAAAGCCAACAT    TCTTGTCAAAATGCACGGAG    II-7N24
58  H01 II  C47D12.4    TAGACCGGCCTCTGACTGTT    GTTTCGAAATGGAACGGAGA    II-7P02
58  H03 II  C47D12.6    AGACGGTGGTTTTTGGAGTG    GCAGCTTCTTATGGGAATCG    II-7P06
58  H04 II  C47D12.7    TGCAAGCAGTCTTGAATTGG    CCATTTCCCACCAGTGTTTC    II-7P08
58  H05 II  C47D12.8    GTGGAGTGTGATCCGAAGGT    CAGGATCCCATAAAGGCTCA    II-7P10
58  H06 II  VF13D12L.1  CAAGTTCTTTCCGTCATTGTTTC ACTCGTTCAAGACGGTACTCAAG II-7P12
58  H08 II  VF13D12L.3  AGGAAACAGAAACAATCGAATCA AAAAACGTCTAAACATCCCCCTA II-7P16
58  H09 II  F13D12.1    CATTGCAATTTCAAAACACTTGA TTGTGGAATTATTGAACCAGGTC II-7P18
58  H10 II  F13D12.2    GTTGTGCCTTGTTGATGTGG    CGGAGTTGTGCAATTTCTGA    II-7P20
58  H11 II  F13D12.3    CTTTCCTTTTTGTTTTGGGTCTT CGTATGAAAGTACTTGAGTCGGG II-7P22
58  H12 II  F13D12.4    GCAGAGGTCTTCAGGTCGTC    AACGAGAACATTGGGAGTGG    II-7P24
59  A01 II  F13D12.5    TTCAGCGAGCCTATTCCCTA    TTAAGACGACGCAGAACACG    II-8A01
59  A02 II  F13D12.6    CCTTCGCACCAATCCATACT    CTGTGGAGCATGTAGGCAAA    II-8A03
59  A03 II  F13D12.7    CTCGGTGACTCCTAGACAAGAAA AATCAGCAAATGACACAACACTG II-8A05
59  A04 II  F13D12.8    AATGGGGGAAAATAATCACAGTT TTGATCGTCATAACATTCAGCAC II-8A07
59  A05 II  F13D12.9    GATCGATGAGACGATCAATTTTC TTCAGACGTTGCTTTTTCTTCTC II-8A09
59  A06 II  F44E5.1 ACCGACAAATCTGGACAAAACTA TTGTCTGTGAAACTTGATGTTGG II-8A11
59  A07 II  F44E5.2 CAAACCCTCATCGTCTGTCA    AAAACACCCCATTTCCTTCC    II-8A13
59  A08 II  F44E5.3 ACTCCAATTTGTTCAATGTTTGG CCCTACTTGAAGGTAAGCCAGTT II-8A15
59  A09 II  F44E5.4 CCGTTGTTCACCATCTTCCT    TGATACCCATCTCGGAGGAG    II-8A17
59  A10 II  F44E5.5 TGATACCCATCTCGGAGGAG    CCGTTGTTCACCATCTTCCT    II-8A19
59  A11 II  F43G6.1 CCCACTCGGCTGTTGATAAT    GTTCGCTTTTCTTCGTCGAG    II-8A21
59  A12 II  F43G6.2 GAAGGTTAACTTTGGCATCACAG CTATAATGGTTGCCTCCAGATTG II-8A23
59  B01 II  F43G6.3 AACTATTTGGATCTCAGCGACAA GATGACAACTTCCCATCAGCTAC II-8C01
59  B02 II  F43G6.4 TCCAGATGTCGTCAAAACCA    CCATTTCTACATGCCTCCGT    II-8C03
59  B03 II  F43G6.5 ATTCACGGGGATTAAGTTCATTT AGTTGCTGAGAATTTGTTGAAGC II-8C05
59  B04 II  F43G6.6 ATGTATCAGGCCCACGAGAC    ATGGCATTGTTGGAGAAAGC    II-8C07
59  B05 II  F43G6.7 AACAGAAATTTGTTCATTGACCG CGACTTGTGTGAATCTACTGCTG II-8C09
59  B06 II  F43G6.8 CCAACGTCCAGTTTTTCGAT    TTGACATGGATCACGGAAGA    II-8C11
59  B07 II  F43G6.9 CCACGCTTTCTACTTGAGCC    AAAGCATCCTCTTGAAGCGA    II-8C13
59  B08 II  F43G6.10    GCAAGCATCTATAGCCACTCATT TAAAAGTTAGTTGCCTTCAAGCG II-8C15
59  B10 II  Y6D1A.c TTTTGAATGACTTGGAGAACGAT TTTTGCATGTCAATTTCTGTTTG II-8C19
59  B11 II  Y6D1A.d AAAGTGGGAACTAGGAGATTTGG AGTCCAGATAGAAGACAAAGCCC II-8C21
59  B12 II  T27D12.1    GGAGCCGTCTCTCTCCTTCT    GGAGATTCCGGTGTTTCTGA    II-8C23
59  C01 II  T27D12.2    AGCATGGCAGAGCAGGTAGT    TCCAGGGTTCAAGAAAATGC    II-8E01
59  C02 II  T27D12.3    TCACGCTATATCCTTCATCAGGT TGAAGTTACAGTAATCCTGCCGT II-8E03
59  C03 II  K12D12.1    GCGTGAAGTCAAAGTAGCTCAAT CATCTTGATCAAAACATCGACAA II-8E05
59  C04 II  K12D12.2    TATTCCGGTAGAGATCTGTGCAT TAATTGAAGAGACGAACGGGTAA II-8E07
59  C05 II  K12D12.3    GACGCAATGTGGAAGGATTT    CGATGCCTGCTATGTGCTTA    II-8E09
59  C06 II  K12D12.4    TCCAACGGATCCACCATAAT    ATCGTTCCGTTTAATGCCAG    II-8E11
59  C07 II  K12D12.5    TATGTGCGCACTGAAAAAGG    GCAGACTGTAACAGGGGGAA    II-8E13
59  C08 II  ZK930.1 CTTGGCTTCTGTGTCCAACA    GCTCACTTGGCTCTTCGTCT    II-8E15
59  C09 II  ZK930.2 GAGAGAGGAAAAGTTGGAACCAT GCCGGCGTGATATTAGTATGTAG II-8E17
59  C10 II  ZK930.3 AACTACCTTCATTGGCGGTG    ATTTTGTGCCGCTTCAATTC    II-8E19
59  C11 II  ZK930.4 CGACATTCAATCAATTCTTCACA CTCCTGGGAGATGTGTGTTAGAC II-8E21
59  C12 II  ZK930.5 TTGCTATTATTTATCGGCGTGTT CTTATGTCGAGTTCTCACCATCC II-8E23
59  D01 II  ZK930.6 AAAAATCCTTTTAGAATCGTCCG AAGTAGGGCATTCATTGAAGACA II-8G01
59  D02 II  ZK930.7 ACTGCTCGAAAAGCTAAAGAGGT GGTGAGATTCAAAGTTTATTGCG II-8G03
59  D03 II  Y17G7A.1    TATGGATCGGAGTCTTTCCG    GTCTGAGCCATCGAAGAAGG    II-8G05
59  D04 II  Y17G7A.2    AATGTTTTATTAACCAGACGCGA CATTTGCCAACTCATCCTATCTC II-8G07
59  D05 II  W03C9.1 TTGTCGTTCAATTTCGGTGA    TGAAAACGGCTTGGAAGTTT    II-8G09
59  D07 II  W03C9.3 CAAAGGGTGACTACCGTAATCTG TTTTGCTACGGGTCAAATTGTAT II-8G13
59  D08 II  W03C9.4 AGAGCACAGATTTTTGAACGAAG ATTTAATTTTACAGCCGATGGGT II-8G15
59  D09 II  W03C9.5 AAAATACAATTTGACCCGTAGCA CACTTTCCATGCTTCGATAATTC II-8G17
59  D10 II  W03C9.6 GCTGCATTCTCATCGATTCA    GCCGAGCAGAAATATCCAAA    II-8G19
59  D12 II  Y17G7B.1    AACGCCAAGAACAAATATGAAGA AGAAAAATGAAATCGACGTGAAA II-8G23
59  E04 II  Y17G7B.5    ATTTAACAACCGCCAACTGC    CATGTCTTCGGCGGAATTAT    II-8I07
59  E05 II  Y17G7B.6    CCTAAAATTTCAGAGAACCCCTG CGGTGTACACACACCAAATACAC II-8I09
59  E06 II  Y17G7B.7    TTACGACCAAAATTTAGGGGAAT TTTTTGAAAAGAATACAGGGCAA II-8I11
59  E07 II  Y17G7B.8    TAACCCCATCCCGTTCATTA    AGTCCATCGGCAATTTTACG    II-8I13
59  E10 II  Y17G7B.11   ATCATCTGAAAAGTCGGAACAAA ATCTTCAGGTAAACCTCCCAAAA II-8I19
59  F01 II  Y17G7B.14   CTAGAAGCGCCAAAACTACTGAA TTGTTCCAACAGTAATCGGAAGT II-8K01
59  F02 II  Y17G7B.15   GCATATTAATCTTCGCTCCATTG TTTAGAATCACCACGTAGCACAA II-8K03
59  F05 II  Y17G7B.18a  AGAATCTCCTCATTCCATCATCA TGCCAGAAAGTTCAGAAAAACTC II-8K09
59  F06 II  Y17G7B.19   GTGTCCGCAGTCACTGAAAA    TTAAAGAGCAGGCTCCGTGT    II-8K11
59  F07 II  Y43F11A.2   GTACCAAGATTGGAAGGGAAAAC TACGTTGCTGTGTGTGCTCTACT II-8K13
59  F09 II  Y43F11A.4   ATCGCCTAGTGTCTAGTGCAGTC CGCTTTTCATATCCGTAGTTCAC II-8K17
59  F10 II  Y43F11A.5   TCAGATCAAAACGAACCGATTAT TAAAAAGCTGGAAAATCGATGAA II-8K19
59  F11 II  Y43F11A.6   AAATTTCTTTGCAAATTGGATGA ATAGAAACGTGGAAAAATGCTGA II-8K21
59  F12 II  Y57A10A.a   CGATGGCCAGAATATCACTACTT AGTAAACTTGCAGTTTTTCGGGT II-8K23
59  G01 II  Y57A10A.b   AAAACTAAAGATTCGGTTGAGCC CATCAGTGTGCAATAATGGAGAA II-8M01
59  G02 II  Y57A10A.bb  TTCTCGGATTTCAAAGAAAATTG AATCCGGAAAAAGAGAAAAGATG II-8M03
59  G03 II  Y57A10A.c   CGTCATTTCCTGAAGTGAAAATC TTGTGGAGAGTAGGTTTTGGAGA II-8M05
59  G04 II  Y57A10A.cc  TCGCATTTTTGAGATATTTCGTT AATATTGATTTTCGCCCAATTTT II-8M07
59  G05 II  Y57A10A.d   ACGGAATTCAGTGAAAGTGAAAA TTGTGGAGAGTAGGTTTTGGAGA II-8M09
59  G07 II  Y57A10A.e   GAAAGCTGAATTTGGAAGGAGAT ACAGGGAAATTTCAAGAGCAAAT II-8M13
59  G08 II  Y57A10A.ee  AGGGTACGGAAATCACCATAGAT TTCCAAGAATTTGAGGACAAAAA II-8M15
59  G09 II  Y57A10A.f   ACGGAATTCAGTGAAAGTGAAAA CAACAAAACAAGGTGAAAAACCT II-8M17
59  G10 II  Y57A10A.ff  CTAAAAACCCCCTAAAAATCCCT GGTTTCTCGCTTAAAAACCTCAT II-8M19
59  G11 II  Y57A10A.g   GGTTCATGAATTTTCTCGTTGAG AATTTGACCAGGAAATCCTTCAT II-8M21
59  G12 II  Y57A10A.gg  CTGCAATCTATCCACAACAACAC TCAGGGTAAAAGCTTCAAAATCA II-8M23
59  H01 II  Y57A10A.h   AAGTTTGGATCGTGATTCTGAAA CAGATATTGTACAGCGTGTTGGA II-8O01
59  H03 II  Y57A10A.j   AAAATATCAATGAGGAAGGCGAT TAAATTTTGCACCGAAGCTTTTA II-8O05
59  H05 II  Y57A10A.l   AACGATTTTTAAGAACCTCGGTC CATATGGGAAAAATGATGAGGAA II-8O09
59  H06 II  Y57A10A.m   CGTCTTCTTTTGCTCACAAGTTT TTCAAACCTATTTCAGAATGCGT II-8O11
59  H11 II  Y57A10A.r   CTACTATTTTCCCCGTTCATTCC GTTTTAAACCCGATTTCCTCATC II-8O21
59  H12 II  Y57A10A.s   AATTGCCAAAGAAATTTTTCAGA ATTCCATTCAGCATCTCCAATAA II-8O23
60  A01 II  Y57A10A.u   TTCTTTTCTCCATCATTCGTCAT TCGAGAACCAGTTTATTCGTGAT II-8A02
60  A02 II  Y57A10A.v   GTTTTCTGGGAGAAGAAGACCAT GCAACCTACACAGATTCAAAAGG II-8A04
60  A03 II  Y57A10A.w   AGATTATGAAAAATTGGCAACGA GAGAACCCTCCCTTATTTCTCAA II-8A06
60  A04 II  Y57A10A.x   CTTCTCTTCAAAAAGCACCTTCA AATAATTCTCCCACCTTTTCCAG II-8A08
60  A05 II  Y57A10A.y   AAAGTTTCATCCAAATTCTGCAC CGAATTCCAGATGATAATCGAAG II-8A10
60  A06 II  Y57A10A.z   TCATTATCATCTCTCATTCCGCT AAGTGATTATGCCTTCTTCCACA II-8A12
60  A07 II  C50E10.1    CACGTGTATTGATCGAAAAACAA TTTTCTGAACTGATCACGGATTT II-8A14
60  A08 II  C50E10.2    TTTTCGACTTTTTACGGTTTTCA GCTCCTCGAACAACTGTCTTTTA II-8A16
60  A09 II  C50E10.3    TTCCTTTTTCCTTTATTTCCAGC TTTAAAAGTTAAGGTGCTCCGTG II-8A18
60  A10 II  C50E10.4    CTGAAAATGGTTACCTCGACAAG TTTGGCAACTCGTAACTGAATCT II-8A20
60  A11 II  C50E10.5    TTTGTCGGAAATGTTTAGAGGAA TTCACAACAATTTGACGTCACTC II-8A22
60  A12 II  C50E10.6    CTGTTTTCATTGGGAAAGCATAG TTTGGCCACTACGATTCTAAAAA II-8A24
60  B01 II  C50E10.7    CTCAAAAATTCAAAATCAGTCGG TCTTTAATTTCAATTTCCTGCCA II-8C02
60  B02 II  C50E10.8    AACTCTCAAATTCTCTTTCGCCT TCTTCACCATTTCCAACAATACC II-8C04
60  B03 II  C50E10.9    CGAAACATGTATAAAGGACGGAG AGGGGGACCTTTGATGAATATAA II-8C06
60  B04 II  C50E10.10   ACAAAGAACGTGGCACAACTTAT TCAAATTTCCCAGTTGCTTAAAA II-8C08
60  B05 II  C50E10.11   TTGCAGAAAATAAGTGTCCGTTT ATGATATTCTCCGTGAACAATGG II-8C10
60  B06 II  Y57A10B.1   TCTAGATTCGAACTCCAGCAAAG TCATCTGTATACTCATTGGCACG II-8C12
60  B07 II  Y57A10B.2   AATAATTCGGTTGAGGGAAAGAG TGAAGAATCAAAAACCCATCACT II-8C14
60  B08 II  Y57A10B.3   CGCAATGATTTCCAGAACCT    ATGGTTTTCCACAAGACCCA    II-8C16
60  B09 II  Y57A10B.4   CAGGAAACCTTAGGGAAACCTTA ACAATGTGCGTAGGAATTCTGTT II-8C18
60  B10 II  Y57A10B.5   GACGCATTTCTCAAGCACAA    TTGGCCGAGACAAAAATAGC    II-8C20
60  B11 II  Y57A10B.6   ATTTCCAGATAACCAAAGCCTTC TATTTTCGATTAAGCGGACTTGA II-8C22
60  B12 II  Y57A10B.7   TAAACGATTCGAACATTTTCTGG GAAGTTACTGGAATCACTGCCAC II-8C24
60  C02 II  C44C11.2    ACATTTTTGTGTATCGTTCGCTT GGTTTAAGCATAGGTTCAGGCTT II-8E04
60  C03 II  F57G9.1 TTCCATTTCAGTTTATGAGGGAA AGCAGACCACTAGTTCAATGCTC II-8E06
60  C04 II  F57G9.2 GAAGAATTTTGCACATTGACCTC CACACTGTTTTCTGGACAAATGA II-8E08
60  C05 II  F57G9.3 AATCCGTGTGCCTGGACTAC    TGTGAACAATGGAGCAAAGC    II-8E10
60  C06 II  F57G9.4 TTGTTTGATTTTTACGCATGTTG TTTGTTCTCGGAAACTCACAAAT II-8E12
60  C07 II  Y57A10C.1   TACGTTTCCAGGATGAAGAAGAA CTACAAGATATACTTGGGCACCG II-8E14
60  C08 II  Y57A10C.3   ACCAGTGACGGAGGTACCAG    CCTCCACCAATGTCCCATAC    II-8E16
60  C09 II  Y57A10C.4   ATTGCTCCCAAATTCTCCCT    ATTGCATCTTTCCAATTCGC    II-8E18
60  C10 II  Y57A10C.5   TTGAAATTCGAGGAAATGCC    TGGAATGTCGGTTTACGGAT    II-8E20
60  C11 II  Y57A10C.6   CTTGACCTACTGGGCAGAGC    GGACTTACCGGAATCCCAAT    II-8E22
60  C12 II  Y57A10C.7   CCAGATGTCTGCTGCCACTA    GCTCTGCTGCTTGACAGTTG    II-8E24
60  D01 II  Y57A10C.8   TGGACCGTGTTGGTGAAGTA    CTAGCCATCGGAGACTTTGC    II-8G02
60  D02 II  Y57A10C.9   AAAAGGTTAGAACTGGGTAACGC AATGGCCTATGTCTATCTCGTCA II-8G04
60  D03 II  Y57A10C.10  AAGCCTACCGTACCATGCTG    GAAAATTTCCTCAGGGCTCC    II-8G06
60  D04 II  W05H5.1 TTCCGCCACTTGTCATACTACTT AATGCTCTATGCTCAGACGAAAC II-8G08
60  D05 II  W05H5.2 TTCAAAATGGAACATTTATTGGC CCCCATCCCTTCATTATTTTATC II-8G10
60  D06 II  W05H5.3 AACGAGGCATTTTCCTGCTA    CCTGAACCGGGAATAGTCAA    II-8G12
60  D07 II  W05H5.4 ACGTTGCCAGTGTATGCTGA    GATTCCAGCTGTCGATCCAT    II-8G14
60  D08 II  W05H5.6 GCAGCTGAAATAGTTGGCTTTTA ACAATATGCACAGGTTTTCGTCT II-8G16
60  D09 II  W05H5.7 ACGTCTTCGGTTTTGTCCAC    TTCCACCCGGAAAATGATTA    II-8G18
60  D10 II  F15A4.1 GCACGGAAATTATAGCCCAA    ATTGCACACAACACCACGAT    II-8G20
60  D11 II  F15A4.2 CCGAGATATATTGTTAGGCCCTT TTAAGAAAATTTTGCAGGTTTCG II-8G22
60  D12 II  F15A4.3 CAGCCGACACCTTACTGGTT    TGAGCCTCCTGATAATTGGG    II-8G24
60  E01 II  F15A4.4 AAAACATTTCGGAAACAGATTCA TCATTTACCTGTGACACTGCAAC II-8I02
60  E02 II  F15A4.5 CAACCACACAATATGAAGCTCAA GTGACACATTGGGAAAATTTGAT II-8I04
60  E03 II  F15A4.6 GCATATTCCTCACTTGATTTTGC CCGGAAATTATTGTGGTTATTGA II-8I06
60  E04 II  F15A4.7 TCTTCATGTACATCCCGCAA    TGCGGATCTATCTCCTTGCT    II-8I08
60  E05 II  F15A4.8 ATATGTACGGTTCCCCCACA    GTCCCCAAATTCAGTAGGCA    II-8I10
60  E06 II  F15A4.9 AGAATCCGTCGGTGAACAAG    CGAGAAGCTTCACTATCCCG    II-8I12
60  E07 II  F15A4.10    AGGGCAGCGATTTTTATTAACTC AACTTCTAGGTGTTGCTGCTCAC II-8I14
60  E08 II  T21B4.1 AAAATGAACCTAAGCCAGGTAGC CTCCTACAATTCCGACAAATCAG II-8I16
60  E09 II  T21B4.2 TGAACAATTCTGAGCTGTGAAAA ATGAAGCAAATCAAACACGATCT II-8I18
60  E10 II  T21B4.3 ATGCAAGGTCAAACAATCACTTT GATCTTCGAATTTCGGTTTTTCT II-8I20
60  E12 II  T21B4.5 TTAGGACGCACGATGTACCA    GATCGAGCCTGAGCTTTTTG    II-8I24
60  F01 II  T21B4.6 CTTTTGGCTTTTCCTTTCCC    TAATGCAGCCACAGGTTGAA    II-8K02
60  F02 II  T21B4.7 CTGATTGTACTCTGGTCCTTTGG TCATCTCATTATCCTTTAGCCCA II-8K04
60  F03 II  T21B4.8 CGTTGTTTTTCTTGCTGGGT    TGGTCAGAACAGTGAGACGG    II-8K06
60  F04 II  T21B4.9 TCGTACGCTTCATGCTTCTG    TTTCCTCAGTTGGCAGCTTT    II-8K08
60  F05 II  T21B4.10    ATTCTGAGAAAAACGCCGAA    CAAACTACCGGCCGCTATAA    II-8K10
60  F06 II  T21B4.11    ACTCTGTTTGTTGCACTGGATTT AGGTTGCAAGGAAATGACAATTA II-8K12
60  F07 II  T21B4.12    TTCGGAATTTTCAACTCCAAGTA GAATTCTGCGAACCTACATCAAC II-8K14
60  F09 II  F49C5.2 TTTGGGATGCATTTTTATATTCG GTTGAGTTTGAATTTTTCGCAAC II-8K18
60  F10 II  F49C5.3 GTTCGTCCAGGCTCTCAGAC    GAACCTGTCCCCACTTGAGA    II-8K20
60  F11 II  F49C5.4 GAAATTCAGGCAATGGAGGA    AGTCCCCTAGGTGGCTTGAT    II-8K22
60  F12 II  F49C5.5 TATTACCTGGAAAGCTGAACCAA CAGTTTTCCGATCTGAATGTTTC II-8K24
60  G01 II  F49C5.6 TTGCGTATCCCTTGTCATCA    AGTGACGGTTGTCGGAAATC    II-8M02
60  G02 II  F49C5.7 TCCGCGCAGTAAAAGAAGTT    GAAAAGTCCGTCGGAATGAA    II-8M04
60  G03 II  F49C5.8 GAAAAATTGTCATGGCAGATAGG CAGTCACTACACCAGCGATGATA II-8M06
60  G04 II  Y38E10A.a   TATCATCGCTGGTGTAGTGACTG GATCCATATGCCCTGGTGTATTA II-8M08
60  G05 II  Y38E10A.b   GAGTTGGCATGGACACTAAAAAC TTTTGCGAAAATTCTGTCATCTT II-8M10
60  G06 II  Y38E10A.c   CAATGAGTGACGTGCCTTTATTT ATTTTCCAGTCTCCTTCACAACA II-8M12
60  G07 II  Y38E10A.d   AAAACATTGAGAAAAATTGCGAA CAAGTGATAAGGGCAAATAATGC II-8M14
60  G08 II  Y38E10A.e   ACAACATCGTTGACCTTTTCAGT CGAGAGCTGCTTAAATAGCAAAG II-8M16
60  G09 II  Y38E10A.f   TTTTTAGTCAAAAATCGGCTCAA TTCCAGATCACCAACTTCTTCAT II-8M18
60  G10 II  Y38E10A.g   AGAGAACCCCTAACTCCACAATC ATATGCGGATGGATTTATCAGGT II-8M20
60  G11 II  Y38E10A.h   GGAAGGTATGATGTCGTTGATGT TGCAAGTGAAAAATAAATGCAGA II-8M22
60  H01 II  Y38E10A.j   CAATCCGCACATACATAGTTTGA CATGTCGTTCTCCATACTTCTCC II-8O02
60  H02 II  Y38E10A.k   GTAAGTCAGAAATCCGTGACCAG TCCTTGACGTTCCAAAATAGGTA II-8O04
60  H03 II  Y38E10A.l   CTTTTCTTTGATTCCTGCTGCTA CTATTGCTATACCTCCGCAAATG II-8O06
60  H04 II  Y38E10A.m   TTGAGAATGGGCTGTTGAGTAAT TATGAACACCCAGCTTTTAGGAA II-8O08
60  H05 II  Y38E10A.n   ATATGAGGGGCGGAGAAATATAA GCACTATTTCCAAGCAATCAAAC II-8O10
60  H06 II  Y38E10A.o   TCAAGCCCTGTAAATTTCAAAAA AAGAGATCAAATTCGACGATTCA II-8O12
60  H07 II  Y38E10A.p   ACAAAACTAAAGTCGCCATGTGT TTTTGTTTTGGAAAGGACAGAAA II-8O14
60  H08 II  Y38E10A.q   ACAGAGTAACAGCAGCTGGAAAC AGAAAGGCGAGAAAAGTAAGGAA II-8O16
60  H11 II  Y38E10A.u   TCCTCAAATCATTAAAACCGAAA TACACCCTAAACGCTTTCCATAA II-8O22
60  H12 II  Y38E10A.v   GTGCACGAGATCTAATGAAAACC ATCTGGAATAAAATGAGCGATGA II-8O24
61  A01 II  Y38E10A.w   TGTTCTTCTTTTCAGCGAATCTC TTTCAAGAAAATTTGGGTTTTGA II-8B01
61  A03 II  Y38E10A.y   GTTGTTCACAGTCGATTCATTCA TTTTCTACTCGGTGAGTGCTTTC II-8B05
61  A04 II  F35C5.1 AGTTTTATCGGCAAGTTTTCCTC ATACATGGTCTTCTCGTCAGCAT II-8B07
61  A05 II  F35C5.2 GATCCTCCGGCTCAACATAA    CAACTTCCACCCGCATAAAT    II-8B09
61  A06 II  F35C5.3 CTACTTCCGAGGGTGCTGAG    TTCGGTTCTGAATTTTTCGC    II-8B11
61  A09 II  F35C5.6 TCGCTGACTTGAACCTCCTT    ATCATTACGTGACAACGGCA    II-8B17
61  A10 II  F35C5.7 GGCATGACAAACGAAGGAAT    TCATGCTTCCGATCATCAAA    II-8B19
61  A11 II  F35C5.8 AGCAGCATCGCCAACTCTAT    TGAAATTGAAATCCCGCTTC    II-8B21
61  A12 II  F35C5.9 GCCTCCAATCGTCATTTGTT    TTTCCGGCAAATCTGATAGC    II-8B23
61  B01 II  F35C5.10    TCGGTCACTACAATCCATTTTCT AATAAAACAAACGCCAACTGAGA II-8D01
61  B03 II  F35C5.12    TAAGACCTCTTCTGAATGCTTCG ACTGTGTGCCTCTAGGAAATGAG II-8D05
61  B04 II  F58G1.1 CATTGACGGTTGGTATTCAAAAT CAACTTCACATTGGTCTTGTTGA II-8D07
61  B06 II  F58G1.3 ATCTTGGACGACTTGATGGC    ATAAAACCCCGTTTTCCAGG    II-8D11
61  B07 II  F58G1.4 AAAAATTCCAGCATGCTATTCAA AAGTCTACAATTCCTCGTGATCG II-8D13
61  B08 II  F58G1.5 CTGTCCACAAACAGTGTATCCAA CTTCCAAATTCACACCTGACTTC II-8D15
61  B09 II  F58G1.6 TTACCAAAACTTTGCCTGTTTGT TGATCATTCGATCTCCTCAATCT II-8D17
61  B12 II  F58G1.9 ATTCTATGAGGGGATCTCGTAGC TATTGCTGCTTGTAGTGGTGGTA II-8D23
61  C01 II  Y38F1A.1    GGAGCTTTAACCAGAACCAAGTT AAACCGCTTACATTTGCAGATAA II-8F01
61  C03 II  Y38F1A.3    ATTAAGACCGACCAATCAAGGAT CGTAAAACTATCGATTGGAGCAC II-8F05
61  C05 II  Y38F1A.5    TCTTCATTCTCAAAAATCCCAAA TGGACTAGGTGGAATGAAAGAAA II-8F09
61  C07 II  Y38F1A.7    CATCGAGTTCACTTCTGAGCTTT CAAAGTTTTCACAATTCGAGGAG II-8F13
61  C08 II  Y38F1A.8    AAAGTTTAGACGAAATCCTTCCG GTGCCGGAATGTGACTAGTTTAG II-8F15
61  C09 II  Y38F1A.9    CCTCTTTTCCAGTGCATTTGTAG CTCTTCGAGCGTTTTCATTACAT II-8F17
61  C10 II  Y38F1A.10   TGTTTCTCTCAAATATGGTGGCT AGATTTTTGCACGAAATTTTGAA II-8F19
61  C11 II  F18A11.1    TACACGTCATCAGAGAATGCAAC CCTAATTCCCAAAATTTTTCAGC II-8F21
61  C12 II  F18A11.2    ACGTTTTGGTGAGTCTTGCTTTA AAGAATTCATACTCACCCGTCAA II-8F23
61  D01 II  F18A11.3    TTATTGATCCTTCTTCGTTTCCA GTACTCTTTAAAGGCGCACAATG II-8H01
61  D03 II  F18A11.5    ACGAAGATGGATCCCACTTTAAT CGTTTGTCCGTTATATGGTTGAT II-8H05
61  D04 II  F18A11.6    ATTTACCGCCAAATTGAGTAGGT TCAAAATTTTCGATTTTTCCAGA II-8H07
61  D06 II  F42G4.2 AGTGTTCCATCAAAATCGCC    TGTTCGGTAGAGCACGTTTG    II-8H11
61  D07 II  F42G4.3 CTGACGGAGATCGGACGTAT    CCCCTTCTGAATTGAATGGA    II-8H13
61  D08 II  F42G4.5 GACGGTTCAAATGTGAAGAAAAG CTCAATGAAGTCGGTATGTCCTC II-8H15
61  D09 II  F42G4.6 AATGGCAGAAAAAGAACATTTGA TCTTCTTTCGCTCCTTACTTCCT II-8H17
61  D10 II  Y81G3A.1    AATTGAAAAGGAGAGGAAAAACG AAAAAGCAACAACGTAGATTTCG II-8H19
61  D11 II  Y81G3A.3    GCGAAAAGTGATAAATTGAATCG GTACTTTGCAATGATTTTGAGGC II-8H21
61  D12 II  Y81G3A.4    TATGTGTTCCATCTCTCATGTGC TTTCGATTGCTGATTTTGATTCT II-8H23
61  E01 II  Y81G3A.5    TTTCTGCAACTTTCGCATAAACT CAGCCTTTTGAATATTTTCGTGT II-8J01
61  E02 II  F29C12.1    TCCACAACAAGGACAAGGACTAT ATACATATGGATCACCCGTTGAC II-8J03
61  E03 II  F29C12.2    GAATAGTAATCTTCCTTGCCGGT CAATACGCATTCTCCGAATTTAG II-8J05
61  E04 II  F29C12.3    ATCATGAAATTGGGTGTTTTCAG TCAAATATTCGTCCATCTTCACC II-8J07
61  E05 II  F29C12.4    AACGTTTTAAATGCACTTTTCCA TTGGTTTTGTGCATTTTTATTCC II-8J09
61  E06 II  F29C12.5    AAATAACAGAACATGGATGGGTG GAAGAACTCCTTCGACTGTGAGA II-8J11
61  E07 II  F29C12.6    CGTGTACTCCACACGAACAAATA CATGGCATTTTACCAACGATTAT II-8J13
61  E08 II  F32A11.1    TTTTTGAACTGTTTTTCTGGAGG TTTCGCATTTGAAAAGAATTTGT II-8J15
61  E09 II  F32A11.2    CTGTTCTCACTAGCGGCTCC    TTGCTCACAATTGAGCTTGC    II-8J17
61  E10 II  F32A11.3    GGCAGCTGATACTCCGACTC    GATCCTCTGACTCCATCCCA    II-8J19
61  E11 II  F32A11.4    TGAGTCTCGCAATCATCTGG    GTGTCGGAGAATCAAGCCAT    II-8J21
61  F01 II  F32A11.6    ACAGTAAATTGAACGTTTTCGGA AATTTCTGCATTTGCCAGTTTTA II-8L01
61  F02 II  W09H1.1 GGCATCGTGTTTCTTCCATT    AGGCACTGGACTCTCTCCAA    II-8L03
61  F03 II  W09H1.2 GAATGGTTTTTCCCAGATTTTTC GGGTTCGGTAAAGTTTTGAGATT II-8L05
61  F04 II  W09H1.3 AATCTCAAAACTTTACCGAACCC GACGGACAATAGCTAGATTGGTG II-8L07
61  F05 II  W09H1.5 AGTATAATCTGAAAAATGGCGCA AATGAAGGATTTGGGAAAGTGAT II-8L09
61  F07 II  F15D4.1 ATTTTATTCCAGGGATCGTGTCT AAAATTTTCAGCAAAATCCGTTT II-8L13
61  F08 II  F15D4.2 TTTACAGAAAAATGCCGAACACT AAACAATACACACCTCGAGCAAT II-8L15
61  F09 II  F15D4.3 TACACATGTTTTTATGCGGAGTG TCGTGTTTTACAAAGGTCTGGTT II-8L17
61  F10 II  F15D4.4 TGTCAGAGTGCCTCATTTCG    TTCCGGAAATATGCAGGAAG    II-8L19
61  F11 II  F15D4.5 AAACTCTCCGACAACTCCGA    ATTGGTGGCATTTCTTTTGC    II-8L21
61  G01 II  F15D4.7 CGAAAAGTGCAGAAGCTACAGAT TGCTAGTTTCTGATCATTGGGAT II-8N01
61  G03 II  Y48C3A.b    GTGAACAATTTGGGTAATTGGAA TCGCAAAACGAATTTTTGTAGAT II-8N05
61  G07 II  Y48C3A.f    AAAGGACAGTCATTGGCTGAATA CGGAATATGAGCAATTGGATTTA II-8N13
61  G10 II  Y48C3A.i    CCTGATTTTTCACAATTTTCTGG AAAATACTTTAAGCCGGAGCTTG II-8N19
61  G11 II  Y48C3A.j    ATGGGTGTTTTAGACGGAATTTT TCACATTTTCCTCTTCTTTTCCA II-8N21
61  G12 II  Y48C3A.k    TTTTTCTTGGGTGAATTTGCTTA TTATCAGTAAATTTCCGATGCGT II-8N23
61  H02 II  Y48C3A.m    AAGTTTCTTGGCATTTTTGTTCA TAGTTGATGGCCTGGTTTTTCTA II-8P03
61  H07 II  Y48C3A.r    CATGTAATAAATGTCCGTCGGTT GGCAAAATTGTGGAAAAATACAA II-8P13
61  H09 II  Y48C3A.u    TTTTCCGAGAGGAGTACAATTCA AAATACAGAATTTGTGACGTCGG II-8P17
62  A03 II  E01G4.2 CCAAGAGTTGGCACAATAAAGAC AATCGTTATTTCGTGAGGATTGA II-8B06
62  A04 II  E01G4.3 ATTTGTGTGAAGATAGGGGGAAT AGGTGCAAAGTCGATGATTTTTA II-8B08
62  A06 II  E01G4.5 TGATACAAAAGGCTGAGGGG    TTCTCACAATGAGGAAGGGC    II-8B12
62  A07 II  E01G4.6 CAGAACTTGTTCGGTCAGCA    TCTTGATTTCCGATTCGACC    II-8B14
62  A08 II  F45H10.1    AGAAGCCAAAAATAGCCAAAGAC CAGTACATATCCAAACTAGCGGC II-8B16
62  A09 II  F45H10.2    ATCGAGAGAATTAGATATCCGGC TTCCAAATACTTCCACTTCCAGA II-8B18
62  A11 II  F45H10.4    AAGTCGGGCTTTTTAGAGTCAAT CAAACTACACAATAACCCCCAAA II-8B22
62  A12 II  F54F11.1    AAACAATGGATAATTTGCACACC AGTTCCGTCTTAGGGAAGTTTTG II-8B24
62  B01 II  F54F11.2    CCAAAACTTCCATCCGCTAA    TTGCATAGGCCTTCTGCTTT    II-8D02
62  B02 II  F54F11.3    ACATAGCAAAAACCGAGTGGTAA TTTGTTTTGGAATTTCAGCTCAT II-8D04
62  B03 II  Y48E1B.1    CATTTTCCATCAACCATTTCAGT ATTTTCGCCAAATTTAGCTTTTC II-8D06
62  B06 II  Y48E1B.4    AAAACCCCCAAATTTTCCTG    ATAAGTGGGCGGAGCCTAAT    II-8D12
62  B07 II  Y48E1B.5    GCCCAAGGCATTGTAACTGT    CAAACAATGGGGAAAAATGG    II-8D14
62  B08 II  Y48E1B.6    AAAGATGTCGCTTCAAACTATCG CCCGAAAACCTTTAATTTTGATT II-8D16
62  B12 II  Y48E1B.10   TTTATGTCTGATGGGAAGGAAAA CCGCCATATCCAATTACAAATAA II-8D24
62  C01 II  Y48E1B.11   AATGTGTCGAATATTCAATTGGC CGTTTTTCCATTTGCATACACTT II-8F02
62  C04 II  F37B1.1 TGCCTACTGTCAAAACCATCTTT AACAATGCCACAATACAAGCTCT II-8F08
62  C05 II  F37B1.2 ATGCGCATTATTTTTGGTTTTAG GAAGCGAACCGAGAATTTTTATT II-8F10
62  C06 II  F37B1.3 GAGTATTGACAAGGACATTTCGG AACATGCCTATTGTGCCTACCTA II-8F12
62  C07 II  F37B1.4 ACTGAAAAATCATATGGAGCCCT TTTCCACTCAATTTTGTCGATTT II-8F14
62  C08 II  F37B1.5 AAATAAATAAAAATCATGGCGCA TTTCTCATCAATTCCCACTGACT II-8F16
62  C09 II  F37B1.7 CAAATTGACGGAATTGAAACATT GAGCCAATCAGACATTTATTCCA II-8F18
62  C10 II  F37B1.8 GCCGAATATTCATTTTAAGCCAT TGACAGAATTCAAACAATCATGC II-8F20
62  C12 II  C31C9.2 CGACCTCGTTCACAATTCCT    TCCCAATTTCCAGAATGAGC    II-8F24
62  D01 II  C31C9.3 ATTTTCAGACAGGCGTGAGG    GAAGTTGGGCGCACAGTATT    II-8H02
62  D02 II  C31C9.4 TGCAAGTTTTTGCAGAAATACAA CTGATAAATTGTTGGAAAGGCTG II-8H04
62  D03 II  C31C9.5 CTCCTTGCTCTCTCCGATTG    GCGATTTCGAGTTTTTCGAG    II-8H06
62  D04 II  Y54G9A.1    TTCTGACAAGAGGTAGTGGTGGT CTCAAAGTGAAGAACGAAATTGG II-8H08
62  D05 II  Y54G9A.2    CCCTTTTTCCATTAAGCTGACTT GATGCATACCTACTGCCTACCTG II-8H10
62  D06 II  Y54G9A.3    TGCTTGTAGTCTTTTTCTCCGTC CTTTTTCAGCACAATTATTTCCG II-8H12
62  D07 II  Y54G9A.4    TAGGTAGCCCAAATCATGTTGAC GTGACTACCCATTCGTCCAACTA II-8H14
62  D08 II  Y54G9A.5    ACCTGTTCTGAAAACACCATTTG ATCCGGAGAAATATGTGAAGGAT II-8H16
62  D09 II  Y54G9A.6    TTTCCAAAGTTCAGTTCCAAAGA GTTTTCAGCCTATTTTCCTCGAT II-8H18
62  D10 II  R06B9.1 CCCTCGTGCAAATTAGGAAA    GGTTCCTCCCACTCCATACA    II-8H20
62  D12 II  R06B9.3 ACTCACCCAAATCAACGACC    ACAATATTCGGCAAAGCAGG    II-8H24
62  E03 II  C01B9.2 TCATCAATTTTTGAAGCGAATTT ATAAGGTCATTGAGCATCTGCAT II-8J06
62  E04 II  ZK131.1 AGGCAATTTCAATCAGTTCTTCA GACGTCATAATGAGTTGAGAGGG II-8J08
62  E05 II  ZK131.2 TTTTTCATTTCAAATATCGCAGG TGAAGAACTGATTGAAATTGCCT II-8J10
62  E06 II  ZK131.3 TGAAGAACTGATTGAAATTGCCT AAAAATCGGGTCCAAGAAGAGTA II-8J12
62  E07 II  ZK131.4 CATACAAACGCTACAGCAAACAG AGGCAATTTCAATCAGTTCTTCA II-8J14
62  E08 II  ZK131.5 TAAAAGAGAAGGGAGACAAGGGT CTGTTTGCTGTAGCGTTTGTATG II-8J16
62  E09 II  ZK131.6 TAGGAATGAATCCGTCTCAAAAA AATAGTGTCTCTGCAGTTGCCTC II-8J18
62  E10 II  ZK131.7 TGAAGAACTGATTGAAATTGCCT TTTTTGAGACGGATTCATTCCTA II-8J20
62  E11 II  ZK131.8 GACGTCATAATGAGTTGAGAGGG AGGCAATTTCAATCAGTTCTTCA II-8J22
62  E12 II  ZK131.9 TTTCAAGTCACCAACTCTCAACA TGCTGTTCACTGCACTCTTTTTA II-8J24
62  F01 II  ZK131.10    CCTCATCCCCATCTTCTTAAATC AATAGTGTCTCTGCAGTTGCCTC II-8L02
62  F02 II  ZK131.11    TGTTTCAAGTTTTCCTTCTTCCA GATTTAAGAAGATGGGGATGAGG II-8L04
62  F03 II  F08G2.1 TGCTGTTCACTGCACTCTTTTTA TTGTTTCAAGTCACCAACTCTCA II-8L06
62  F04 II  F08G2.2 AATAGTGTCTCTGCAGTTGCCTC TAGGAATGAATCCGTCTCAAAAA II-8L08
62  F05 II  F08G2.3 TTTTTGAGACGGATTCATTCCTA AAGTACATCAATACCACCATGCC II-8L10
62  F06 II  F08G2.4 AAAAGACTCCAGTCAAGTTGTGC TCTATTCGATTTCGGTTGTGATT II-8L12
62  F07 II  F08G2.5 ACTTAAATGGTCATATCCCGGTT CAATATTTGCCCACCTTATCAAA II-8L14
62  F08 II  F08G2.6 TTTCTTTCTAATCAACTTGCCCA TTTTTGGAACCTAGGGAAGACTC II-8L16
62  F09 II  F08G2.7 TTTTCGCTGCACCATCTAGTATT TTCAAGGGTATAAGGAAGAAGCC II-8L18
62  G03 II  Y51H1A.5    ACTGCGCTGATTGATTAGAAAAG ATTCTTCATCTCCCCAAGACTTC II-8N06
62  G05 II  Y51H1A.7    GATCGGAATCTATCAAACACTGG AAATGGGAGAAATTGTTGGAAAT II-8N10
62  G07 II  W02B8.2 CAAGCCTTGAGAATCAGAGAAAA ACAATGTGAGCATTTATTGGCTT II-8N14
62  G08 II  W02B8.3 TTAGCTGTATTTTCAGATCCCCA CTTATCTGCCACATCCTTAATCG II-8N16
62  G09 II  W02B8.4 AGAAGCTTATAGTAGGCGAGGGA ACTTTTCATCTGCCACATCCTTA II-8N18
62  G10 II  W07G1.1 CAAAATTTTCGAGAGGGAGTTTT TTATTTCACTCCATGTCCAAACC II-8N20
62  H02 II  W07G1.5 CATTCGGTATAGGAATCGATGAA TCAAACTTCCAAACTTTCCAAAA II-8P04
62  H05 II  Y39G8B.a    TAACGGAGATGTTCTCGATGATT AACTTTACCCTTGCCACTCTCTC II-8P10
62  H06 II  Y39G8B.b    GTAACTGTTCCTCCTGAACATGC TCTTCATTTAAGCTCAGGACTCG II-8P12
62  H07 II  Y39G8B.c    CAGCTTCTCCCAAATACTGCTAA GATGTTCGTGGTGACGGTATATT II-8P14
62  H08 II  Y39G8B.d    ACTCTCCCAAAATCTAAAACCCA TCAAATCAAAAACACATCATTGC II-8P16
62  H09 II  Y39G8B.e    TTCGATCAAAGGTGTTTTCATTT GAAAGTGTTCAATTTCGAACCAG II-8P18
62  H10 II  Y39G8B.f    CAAAGAAAGACCAAAAGACCCTT ACTAATCCTAGGCTGGGAACATC II-8P20
62  H11 II  Y39G8B.g    AATGTCTGCTTATTCCCTGAACA AACCCTTATACTTTTCTACGCCG II-8P22
62  H12 II  F01D5.1 TATCTGGTAGGCGTTTCTTCTTG TAAGTTTTTCACTAAAGGCGCAG II-8P24
63  A01 II  F01D5.2 AACGTCGGCTGCATACTATAAAA GTTAAAACCTGAACCAGAAGCCT II-9A01
63  A02 II  F01D5.3 CGGGAAATGGTGATAAATGATAA CAGTTTCTCCAAAAATTCCCTCT II-9A03
63  A03 II  F01D5.5 CCGTATTCCTATCCTACCGTACC TATAAAAACCTCGGAGCAAACAA II-9A05
63  A04 II  F01D5.6 TGACATTGAAAAATTCGCCA    GACACCTAACGGGTCTGGAA    II-9A07
63  A05 II  F01D5.7 ACGAGTTGTCGGCTGCTATT    CCACCAAGTCGTTTCCTTGT    II-9A09
63  A06 II  F01D5.8 GATCCCGAGAAACGATTCAA    TGTTGTTGTTGCTGTGACGA    II-9A11
63  A07 II  F01D5.9 GGATTGCCTACCGTATACCTACC TCTTATGTCCAAAATCGATGGTC II-9A13
63  A08 II  F01D5.10    TTTAAAATGGGTATCCAAACACG CTGACCGAAATACTTTAAATGCG II-9A15
63  A09 II  F01D5.11    CGGCGTAGAAAAGTATAAGGGTT GCAATGACAAGTTTACCCAAGTC II-9A17
63  A10 II  W01G7.1 CAGAGGAAGCTTGATCCCAG    ACAACCAAAGCCATTTCCAG    II-9A19
63  A11 II  W01G7.2 TTCTGGCTACTTTGCCGTTT    AACACCGGCGGTAGTACAAG    II-9A21
63  A12 II  W01G7.3 TATACAAACATTGAAAATCGGGG AATCAGTTATATCCACGCTCCTG II-9A23
63  B01 II  W01G7.4 TTTTGAAACACTAAAATTCCCCC CTTTCCGAGGTATTTCTCGATTT II-9C01
63  B02 II  W01G7.5 TTTGGTTCAAATTTCACAACCTT ATCCTCTTCTCCGGTAGTGTTTC II-9C03
63  B03 II  Y39G8C.1    TAACTGTAAATTGGCCGAAAATC GGGAAGTACACATCCATTTTCAC II-9C05
63  B04 II  Y39G8C.2    TCGAGCATCAAAACCTCATTTAT CTTCGTGGAAAGCCTACTGACTA II-9C07
63  B06 II  Y39G8C.b    TGAAAATCTCGTAGAAAATCCGA CAATCGATACAGACTTCCTCGTC II-9C11
63  B07 II  Y39G8C.c    CTCTTCAAAATTTGTTTTCCGTG GTGGACGGAGCTTAAAATTCTTT II-9C13
63  B08 II  Y39G8C.d    TTTCCAGAATTATCAGCCAAAAA GATGAATAACCAGGCAAATACCA II-9C15
63  B09 II  K09E4.1 CTCTTCTCGCAAGTTCACAAGAT GTTCAAGGTAGAGTGCCTGAAAA II-9C17
63  B10 II  K09E4.2 TTCCTAATTGGAGGCCTAGAAAC GGTGACTAATTGAAAGCTTGTGG II-9C19
63  B11 II  K09E4.3 GCTTGCAGCAAAAACAGAGTTAT TTTTCTGCTCATTTCCAGGTAGA II-9C21
63  B12 II  K09E4.4 ATCTAGGCCACTTCACCACTACA CGCGTGACAACTAATTACTACCC II-9C23
63  C01 II  K09E4.5 CTAGGAGCCCAATTTTGAATTTT AGTTGGCATGCATAGAATCAAGT II-9E01
63  C02 II  W03H9.1 ACTTCCTTCGTACATAGCAACCA TAAATTCGACGAGCTTCAAGAAC II-9E03
63  C04 II  W03H9.3 CAATATTAACCGGTGGTGAGAGA AAGATGATTGGGTACGGATTTTT II-9E07
63  C05 II  W03H9.4 AAATATTGTGCGGAAAATAGGGT AAATTTCACGTGTTCACTATGGG II-9E09
63  C06 II  Y48B6A.1    GCCAACAACGGATACTTCTTATG GGAAAAACGTTCGAAAGAGAAAT II-9E11
63  C07 II  Y48B6A.2    TTCATGGCTTCAAAACTTCAAAT AACAAAAAGGCGAATGTAGAACA II-9E13
63  C08 II  Y48B6A.3    ATACTTTTTCTCCGTTCGTCTCC CTGTCTTCGCTTGAAAATCTCAT II-9E15
63  C09 II  Y48B6A.4    ACTATGCCATTTTGACTCTTCCA ATTCGTGAGAAAAATGACCTTGA II-9E17
63  C10 II  Y48B6A.5    GTGATATTCTGAGTTCCGACGAC GAGAGCATGCACAGGTTAGAGAT II-9E19
63  C11 II  Y48B6A.6    CACCTTTGGAAATCAAAACTGAG ATGTGATGAAATTTTGAAAACCG II-9E21
63  C12 II  Y48B6A.7    TATCAGATTTCGCATGATGTCAC AAGTCAGAGATGCAGGAGATCAG II-9E23
63  D01 II  Y48B6A.8    GTCGTGTTTGAGGGTCTTACAAC TTCTAGTCTTACCTGGATGGCTG II-9G01
63  D02 II  Y48B6A.9    GTGCATTCCTTTTGTCTTTTGTC TGAGTTTATTTCACAGCCGATTT II-9G03
63  D03 II  Y48B6A.10   TCTTCTGTGGATCCTGAAACAAT AATTTGAATCTTCCCCTCAAAAA II-9G05
63  D05 II  Y48B6A.12   TCTGCTTTACTTGTAGGGTTGGA GGAAAATCTGAATTTTTGCCATT II-9G09
63  D06 II  Y48B6A.13a  TATCACGTATCCATATGCGAGTG TCCGTAAAATCAAAAATTGGAAA II-9G11
63  D07 II  Y48B6A.14   GCAAATTGCCACTCTCTCTCTTA GACAAAGCCTATTGGGACTTCTT II-9G13
63  D08 II  Y48B6A.15   CCCCTCCTTCTACGAATTTCTAA AAGTGAGTTAGGCGATGTGAAAA II-9G15
63  D11 II  Y54G11A.4   AATTGACGCTGAAAAGTATGGAA TTCACCAACGAATCTCTCAATTT II-9G21
63  D12 II  Y54G11A.5   AACAGTCCGAGTAGAAAAGGGAC TTAGAGTTTAAAGGCACAGACGC II-9G23
63  E01 II  Y54G11A.6   CTTGAGCAGGCTGAAAAATAGAA TAAATCTTCAAAATGCCAATGCT II-9I01
63  E02 II  Y54G11A.7   ATTTCCTACCTAGCGAAACTTGC TCGACAGATGCTCTATCTTCCTC II-9I03
63  E03 II  Y54G11A.8   TGAGGAAAAACATTAAAAGGGGT GGTTTCCCACCGTATTTTCTATT II-9I05
63  E04 II  Y54G11A.9   AAAAATACAGGGACAAAGGGAAA GCAAACATTGATTAGTTTAGCCG II-9I07
63  E05 II  Y54G11A.10  CAGAAGATCAACTGCTTTTTCGT CACCGGTAGTTTTCAACAAATTC II-9I09
63  E06 II  Y54G11A.11  ATTGTTTTGGAGACTACGGTCAA TTTTGGAGGCTTATAAGGAGGTC II-9I11
63  E07 II  Y54G11A.12  TGGAACAACATTTATCCCAAGTC CCGCGTGTCTAATCACTCTATTC II-9I13
63  E08 II  R06A4.2 GCAAAGAAGAACAAGCCGTC    CGCTTCTGAATCTTTTTCGG    II-9I15
63  E09 II  R06A4.3 TTGACGCATTCATTCACGTT    GGTTCCTGGAAAGCATGAAA    II-9I17
63  E10 II  R06A4.4 ATTCGTGCGACAGTAGGTATCAT ATTCTAAATTCTCACATTGGCGA II-9I19
63  F01 II  R06A4.8 AGCGGATCTCTCAAAGTCCA    GCTCGATGGGTGAAGAAAAA    II-9K01
63  F02 II  R06A4.10    TTCCAATAGAGGTCAAAACGAAA GGAAAGAAATCTCCGATTGAAGT II-9K03
63  F03 II  F26H11.1    AGGTGAATCCAAATGGAGAATTT TCATTGAATTTTTGCAGGTTTTT II-9K05
63  F05 II  F26H11.3    CAAAGTCAAAAGAGCGTCGTACT ACGCTTTCTGATAGAACTCATCG II-9K09
63  F06 II  F26H11.4    CGCGCACACATATAAAATGG    TCGTTTATTGGTGGTTCGGT    II-9K11
63  F07 II  F26H11.5    CTCTTCGCGGACCAGTTTAG    ACCCTCCAATATCCTCCCAC    II-9K13
63  F08 II  K04B12.1    TGGAATTCCTCTTTCATCGG    TGTAATCGACAGTGCTCCCA    II-9K15
63  F09 II  K04B12.2    ATCAGCTTGCTTCAGACGGT    AAATCGGCAGGTGATTTACG    II-9K17
63  F10 II  K04B12.3    CACCAATCTAGCCCGAAAAA    CAATCGCCTACAGCACTTGA    II-9K19
63  F11 II  Y54G11B.1   CTGCCAATGCCATACACATC    CTGAACAGCGTCTGTCGGTA    II-9K21
63  F12 II  Y54G11B.a   TTTCTTGCAATTTTGCCTATCAT CACGTAGCAATTGATTAACGACA II-9K23
63  G01 II  C13B4.1 ACAATTGTTTGCCGCCTATC    ATTCAGCTATAACCCCGGCT    II-9M01
63  G03 II  K10H10.1    AATTGGAAGCATCCTGATCG    CACAACGAACACGTACGACC    II-9M05
63  G04 II  K10H10.2    CCATTGCAATAGCATCATCG    TCGTTTACTCATCTCGCACG    II-9M07
63  G05 II  K10H10.3    CGAAGTTCTGGCCTTAGCAG    CCAATTTCTTCCACAACGCT    II-9M09
63  G06 II  K10H10.4    TCGGAACCAATGATCAATAAAAC AAAGAACGCTTGAAATCAGAACA II-9M11
63  G07 II  K10H10.5    TTCTGATTTCAAGCGTTCTTTGT TTGTTCGTCAGAGTTGTCTGAAA II-9M13
63  G08 II  K10H10.6    CAATAGAAATTTACGAGCATCGG TATTTTCGGCTTTCATGTTCACT II-9M15
63  G09 II  K10H10.7    GGACTGCTATAAATGTCGTCAGG TAAAATAGCACCGAAAGACCAAA II-9M17
63  G10 II  K10H10.9    TTTGTAGGTTCAGATTTCTCCCA TTTCTCCAAGGTTTTTGTTTGAA II-9M19
63  G11 II  F57C2.1 TAACACCACGTGACAAGTATTCG AATGGCTGATGAAGTGATTGAGT II-9M21
63  G12 II  F57C2.2 TTCCGTATCTATCCGCCATC    AATGAATGAGTGGCGAAACC    II-9M23
63  H01 II  F57C2.3 ATTTTTGTTCTCCGTTGTTGAAA GTGTGTAGGTGAACAAAGTGCAA II-9O01
63  H02 II  F57C2.4 CTGGAAAGCTTGGTTATTCACAC TTTCATTATCAAAAGCGGAAAAA II-9O03
63  H03 II  F57C2.5 CAATAAGTTCCACGGCCACT    TATGTGCAAAACGATGGGAA    II-9O05
63  H04 II  F57C2.6 TCGAAATTCTTTATTTTCAGGCA CGTCAATCGAGTTCATCATACAA II-9O07
63  H05 II  C01G12.1    ATTTTTCCGTTTCAGACCCC    GAAAATCACGATCCTTCCGA    II-9O09
63  H06 II  C01G12.2    GAAAGGGAAACCGAAAGAGG    GCTGATGGGTAGTAGGCTGC    II-9O11
63  H07 II  C01G12.3    AAATTTATCGAGCGAGTCATTCA CCGTCTCCTATTGTCTCATTCAC II-9O13
63  H08 II  C01G12.5    TGAGCTTGCACTTCCATCAC    GAATGATCAAAATCCGACCG    II-9O15
63  H09 II  C01G12.6    CCGCGGTTCTTGTTTATATGTAG GTTTTATTTGCATGAACCGAGAG II-9O17
63  H10 II  C01G12.7    GACTGGCAAGATTGTCACCA    CTCCAATCCTTTGCGATCAT    II-9O19
63  H11 II  C01G12.8    GCCTCACTCTTACTGCCGTC    AATTGGTGACCACTGCCTTC    II-9O21
63  H12 II  F19H8.1 TGCACATCGGTGTTCTTGAT    GACATTTTGCGGGTTCTTGT    II-9O23
64  A01 II  F19H8.2 TTCCCATTTTGCGATTTCTC    GCGGATATTTGCGACATTCT    II-9A02
64  A02 II  F19H8.3 TATCCCTTGACCTCTCACAAAAA AAATTGGATGTGAGCTGATGAGT II-9A04
64  A03 II  F19H8.4 TATCCCTGGCTCATGCCTAC    TGGTAATTCTCTCAACGGGC    II-9A06
64  A04 II  C38C6.2 GTTGCTTGGCAAGTCTGTCA    CGCCAAATGGTACAGAACCT    II-9A08
64  A05 II  C38C6.3 TCCTCCAACTCACCAAAACC    GAATCTCGACAGCTCCGAAC    II-9A10
64  A06 II  C38C6.4 TTACGAATTGAGTTGGCAATCTT AAAAATCACCTGACCACTTTTGA II-9A12
64  A08 II  C38C6.6 TGATGTCTCCATCCAACCAA    CCCGATCTCGTAGTTCCAAA    II-9A16
64  A09 II  ZC101.1 CCGACGATGGTGTTCTTCTT    CCAAGATCTGTCGATGGGAT    II-9A18
64  A10 II  ZC101.2 CTCGAGCTCTCTGCTGAAATAAC AGTCAGACTGGAAGTCACTGAGG II-9A20
64  A11 II  K02B7.1 CCATCTCGATTTCGTTCGTT    AACCACTGCATGTCCAACAA    II-9A22
64  A12 II  K02B7.2 CTGCACCTCCTCCTTCTTTG    TTGGTTTACTTTTCGGGTGC    II-9A24
64  B01 II  K02B7.3 ATGATAAACGTGGGCTTTGAGTA CAACACTGCTGCTTTTTCTCTTT II-9C02
64  B02 II  C09F9.1 GAATTTCACCGCCTAATTATTCC CCTCTTTTCAGTATTTGGACGTG II-9C04
64  B03 II  C09F9.2 CTTATGCCACCAATGCACAC    AAAAATTTGACGAACCGCAG    II-9C06
64  B04 II  C09F9.3 TTCCATTTCCAAGCTCATCC    CCAACTGTGCTCACTGGAGA    II-9C08
64  B05 II  C09F9.4 TCACCAAAGAAGTCACTCAATCA GCACACCGAAGATTGAGATAAAG II-9C10
64  B06 II  C09F9.5 GTTTCTCCAAATCGTCAGTCAAC ACCGAACACTGTTTAACCTTTGA II-9C12
64  B07 II  C09F9.6 GGTTGGCCGGAAATTTTTAT    CTGACGTCCTTCGGGTACAT    II-9C14
64  B08 II  Y54E2A.1    GTGTTGGCGGTTTTCAAGTT    GCATTTCTCGCTGCACTGTA    II-9C16
64  B09 II  Y54E2A.2    CTCTCGTAACTCTGCGATTTGTT ATTTTTCCAGGATCTCCTCACAT II-9C18
64  B10 II  Y54E2A.3    TATAAGGCGGAAAGCGAAAA    TGTCGCTCAACACAACCTTC    II-9C20
64  B11 II  Y54E2A.4    TAAAAGTGCAGTTGGCCTAGAAA GGCTCTTCACCTCGAAAACTATT II-9C22
64  C01 II  Y54E2A.6    CGAGAATCTTATCATCCATCAGG TAGACGAGACGAAGATCAACACA II-9E02
64  C02 II  Y54E2A.7    TCGAAAAGAAGATTCAAGTGCTC AAATGGGTGTGTCTAGCGAATAA II-9E04
64  C03 II  Y54E2A.8    ATTTGCCCGGTTTAGTTGATTAT GGCAATTGTTCTTTTTCCTTTTT II-9E06
64  C04 II  Y54E2A.9    TGTGGAATTTCCCATAAAAACAC CTCAAGAAAACAGGGAGGAAAAT II-9E08
64  C05 II  Y54E2A.10   GTCACTGAAGCAGCAAGTCCTAT CTAGGATTGTCTAGGGTCGGTCT II-9E10
64  C06 II  Y54E2A.11   ACGTTGGAGATCTCTGGTGG    TGGCTGTTAGCCTCGATCTT    II-9E12
64  C07 II  Y54E2A.12   GATTTTCAGACGAACTCCGC    TTTTCGTAAATCGACAGGGC    II-9E14
64  C08 II  W01D2.1 TCACGTTTCTTTTCACGATTTTT GTTTCTGAAAGAAAAAGGGCATT II-9E16
64  C09 II  W01D2.2 CGTGGTTAAAGTGCGAACAA    TGAAAAAGAAGTCGCACACG    II-9E18
64  C10 II  W01D2.3 GTCTGAGTTACCATAAGTTGCCG TTGGGAACACTAAAAAGACTGGA II-9E20
64  C12 II  W01D2.5 CCCAATTTTTCCAGGTAGCA    ACGACTAGATCGGCTGGAGA    II-9E24
64  D01 II  R05H10.1    TAGAAACCCCTCGACTACAATGA AACCAATTCCCAATTTACTGGAT II-9G02
64  D02 II  R05H10.2    AGCAGGCAAAGCTGAAAGAG    TTCCATCACGAATCAGTCCA    II-9G04
64  D05 II  R05H10.6    CCACCAAAGTGCACATCAAC    TCATTCCCTTCTCATCGGAC    II-9G10
64  D06 II  Y53F4A.a    TATCAACGAGATTGACCAGGAAC TTCACTAAAATCACTTCCGCATT II-9G12
64  D08 II  Y53F4A.c    CATGAACATTTCTGATGTTTTGG TCTGATCATGTTCGTCAAAAGTG II-9G16
64  D09 II  R03C1.1 ATATAGTTTTTGAATGGCGCAAA GAACAGAAAAATTTCATGCGAAG II-9G18
64  D10 II  R03C1.2 GCCAGTGTAGAAGCAAAGGC    CCTGAATACCAACACCCCAC    II-9G20
64  E04 II  Y53F4B.c    TTGTAGTTGATGGCCTAGGAAAA TATACTCCGCCCCGTTATCTTAT II-9I08
64  E05 II  Y53F4B.cc   TAATGTAGCGCTGGTTTTGATTT CCAATTTCGATGATTTTTGGTTA II-9I10
64  E06 II  Y53F4B.d    ATTAAAATTCAACAGCGACGAAA TTTTCAGATTTAAAACATGGCCT II-9I12
64  E07 II  Y53F4B.e    CAGTTTTACGGAAAATCAATTCG AAATCCGGGAAATTAAACTGAAA II-9I14
64  E08 II  Y53F4B.f    TCTAACATCACATTTTTCAGGCA TGCACCACCTTTAATAGGAACAT II-9I16
64  E09 II  Y53F4B.g    TAAATACCGGAAAATGTCTGTGG AAATCGAATTTTTAGCTTCTGGC II-9I18
64  E10 II  Y53F4B.h    TCGATTTTTCAAAATTTTTCAGG TTTCAATATTTCAGCTCTCGGAA II-9I20
64  E11 II  Y53F4B.i    GTAACCGAAATTGACTCTTCGTG AAAAAGGTCCTGGAAATTAGTGC II-9I22
64  E12 II  Y53F4B.j    CCAGAAGTTGCAGAAAAAGAAGA AATTATAAAACTGCGTTGCGTGT II-9I24
64  F02 II  Y53F4B.l    GAGCTTTTCGTTGAAAATAAGCA TCCAACAATCTCAAAATTCTGGT II-9K04
64  F03 II  Y53F4B.m    AATTTGTTTACGGATAGCCCAAT TTATCCTAAACGCCAGATCTTCA II-9K06
64  F04 II  Y53F4B.n    GCAACCCTGAATTAGAGCTTTTT TCCAGTTTTTGGCGTTTTTAGTA II-9K08
64  F05 II  Y53F4B.o    TTCGAGAATGTTCGATTTTGATT AGCATCTGCAAAATTGGTTAAAA II-9K10
64  F08 II  Y53F4B.r    ATTTCATATCCTTTCCCCAAAAA AAATATCGGACGACACACAAAAA II-9K16
64  F09 II  Y53F4B.s    ACGCGTTTTTACGCTGTATGTAT TTGCTTTTGACCTAATTTCCGTA II-9K18
64  F10 II  Y53F4B.u    CATCAGTAGCTAGCCATTCTCGT TCCGAAAACACTGAACAATTTCT II-9K20
64  F11 II  Y53F4B.v    TGGGATTTTTATGGAGACTTTGA AAAAACCCCAGATAATTCCAAAA II-9K22
64  F12 II  Y53F4B.w    CTCGCGATTAAAGATTCAAGAAA TCTACACGATTCGTTTCGTTTTT II-9K24
64  G01 II  Y53F4B.x    AAACCTGAAACTTATGTGCTCCA AACCCAAGTTTTTACCCAGTCAT II-9M02
64  G02 II  Y53F4B.y    AAAATGAAAAATCTTCGGCAAAT ATTTGGAATAGGAAGTAAGGGCA II-9M04
64  G05 II  Y53F4C.b    TTGTTTCAAGCTCAAATTTTGGT ATCACTGAAAATGGGTGAAACTG II-9M10
64  G07 II  Y53F4C.d    CAAAGTATTTTATGCCTGCCAAG ATTTGAAAGGTAATTGGGGAGAA II-9M14
64  G09 II  Y53F4C.f    ATTATGGGTGTTGATCGAAAATG CACCCAAAGTCAGTGAGAGTTGT II-9M18
64  G10 II  Y53F4C.g    AAATTTGAATTTCCCACCAAAAT AATTCGTTTCAAGACCCAAAACT II-9M20
64  G11 II  Y53F4C.h    AACATCTAATCCCTCCACCAAAT CGTCTGTTAAGTTCGAAAGGAGA II-9M22
64  H01 II  Y53F4C.j    TTCACATCTCCATTGATTGTTTG CAGACAGATCACTATGCCTTCCT II-9O02
64  H02 II  Y53F4C.k    CTCAACCCATTTCTTTATTGCTG ATCCATTTCTTGGTTTTTGGTTT II-9O04
64  H03 II  Y53F4C.l    GGTGTTGTTGAGAATGATGTTGA TAAAAAGGGTTGGCAAAGTTGTA II-9O06
64  H04 II  Y53F4C.m    TATTTGCCTATTTGCCAGAAAAA TACATTCAGCGAGAAATCGAAAT II-9O08
64  H05 II  Y53F4C.n    TGCTCTCTCTCTCCTTATTCCCT CAAAAACTTATGGGACAACCTGA II-9O10
64  H06 II  Y53F4C.o    TCGAGACGTTAGATTGCTTCTTC GTCAAAACCTTCCCATTTTTCTC II-9O12
64  H07 II  Y53F4C.p    TTAACACGAGCTGCATACTTCAA AGTGAAACCACTATGCCAACCTA II-9O14
64  H08 II  Y53F4C.q    GCATGCAAGACGAATTTTTAAGT ACCGATTTGATTGGAAGAAAAAT II-9O16
64  H09 II  Y53F4C.r    TATCTGGACGAGTTTCTACCCAA GGCAAATATTGGGAAAAGAGATT II-9O18
65  A01 II  F43C11_37.d TTCCAAACTAGCCAAAAACACAT GCTTGTTGGAAATCCAGTTACAC II-9B01
65  A02 II  F43C11_37.e CTACTTCCTACATCGCAGGCTTA GAGCTGAAGCTAAATTCCACTCA II-9B03
65  A03 II  F43C11_37.f ACAAAACAGATCTTCGGTTTGAA CATTTTAATTTCGAGTACGCCAG II-9B05
65  A04 II  F43C11_37.g GAAATTTTTGGCATGAAATTGAA ATGTATGTTCTTGTGCCGAGATT II-9B07
65  A05 II  F43C11_37.h CTAATATCTGGCCACTGTGGAAT TTTCACATTTTTGATTTTGCCTT II-9B09
65  A06 II  F43C11_37.i GTTGAAATGGAGTCATGGACATT AAACTTTATGTTACGGGGCGTAT II-9B11
65  A07 II  F54A3_30.a  TCCGAATAATTTCTGTGCATTTT ATCGAATTTCAGTCGATTTTTCA II-9B13
65  A08 II  F54A3_30.b  GCGAATATGGCTTCTGTTATTTG GAGGTGTCTACAATCTTGATGGG II-9B15
65  A09 II  F54A3_30.c  AGATAGTCCCTGATTCCATCCAT GAAACTAGCTGAAAATCGCTTCA II-9B17
65  A10 II  F54A3_31.a  AGCCCTAAAAATTCAGAAAATGC GTTTCTGATTGAAATTTTGCAGG II-9B19
65  B01 II  F54A3_31.e  TTTTGAACTGGAAAATGCTCAAT CGATTTTCGTCAAATTTTCACTC II-9D01
65  B02 II  F54A3_31.f  CACTCAAAAGCCCAATATTTCAG AATTCCTCGCCATTTTCTTAGTC II-9D03
65  B03 II  F54A3_31.g  AAGGATAAAAAGGCGATTTTGAG GTTTCTGATTGAAATTTTGCAGG II-9D05
65  B04 II  Y110A2A_54.a    CATTTGGATTGATAGGCAGACTC CTACCCTCTCGTTCTCTCTGTGA II-9D07
65  B06 II  Y110A2A_54.c    TGTAAATTTCCAGGATAGGCTCA AAAAGAGGGCTAGCAGTTAGGAA II-9D11
65  B07 II  Y110A2A_54.d    TAGTAACCAGGATAACTCCGCAA AACTAATTTTTGTTCCGCTAGGC II-9D13
65  B08 II  Y110A2A_54.e    TCCCAAAAGTAGTTGGAAACTGA GAGTATAATGAGAAGCTCGCCAA II-9D15
65  B09 II  Y110A2A_54.f    ATCAAGACATCCAAAAAGCAAAA TCCAAGTGACTAAGTCCACGAAT II-9D17
65  B10 II  Y110A2A_54.g    GGATTCTCAAGCTGGAAGTTTTT ATTCTTCCATTACAGCTTCACCA II-9D19
65  B11 II  Y110A2A_54.h    AACTTATTTCTTTTAGGTGGCCG ATTCAGCACCATCTTAGGCAATA II-9D21
65  B12 II  Y110A2A_54.i    TTTCAGCTAAACCTTTTCCACAA CTTTCATGTTTCTGTTGGGTCTC II-9D23
65  C01 II  Y110A2A_54.j    CTTGATCCTGTTCACCTGAAATC TGTTAGTGATCGTCTCACCATTG II-9F01
65  C03 II  Y110A2A_54.l    ACCCTTATTTTCAGCCTAACTCG GTCTGCGTCTAGTCGTTTCCTTA II-9F05
65  C04 II  Y110A2A_1231.a  AAGCGATTTTTAGCGAATTTTTC TGAGTATTGTGATGTGCAAAACC II-9F07
65  C05 II  Y110A2A_1898.a  TCAATATGTACACTTTTTGGGGG CCCCATTATTTACAGTTCCAACA II-9F09
65  C06 II  Y110A2A_1898.b  ACAGATGCTAAAACAATTTCCGA ATTTTCAGTGATTTTTGCTCCAA II-9F11
65  C08 II  Y110A2A_1898.d  CCAATTGCAAAAATGATCAGAAT AAATTTTCCCCTCTTAAATTCCC II-9F15
65  C09 II  Y110A2A_1898.e  TTTTGAAATTTTGGCGTTTCTTA AAATTTTCCCCTCTTAAATTCCC II-9F17
65  C10 II  Y110A2A_1898.f  TCAATATGTACACTTTTTGGGGG TCTACCAAGAGCAGCCAAACTAC II-9F19
65  C11 II  Y110A2A_4083.a  TAACAGTGCTCCAACTCCAATTT CCCAAATTTTAGGGATTTTATCG II-9F21
65  C12 II  Y110A2A_4083.b  CAGTTTTTCAGGCAATTTTTCAC AAAACCCTCGAAACTTGAATCTC II-9F23
65  D01 II  Y110A2A_4093.a  GACCCACAAGTCTGTCTAACCAC AAATAGCACAAAACCTGACGAAA II-9H01
65  D03 II  Y16E11A_119.b   CAATATTCCGTGGTACGTTGATT CACTTTTCAATTCCTTCCAACTG II-9H05
65  D04 II  Y43H11_157.a    AATTTTCCACTTTTCAGCAAACA TCTCAAAAAGGCAATAAAATGGA II-9H07
65  D05 II  Y43H11_158.a    TTCATTCCTATGCTTTCCAAAAA ACATATCTGACAAAACGGCAACT II-9H09
65  D07 II  Y43H11_159.b    ATCTCCTCTTCTTCATCCGATTC TTTGCAGGAAAGATAGATCTCCA II-9H13
65  D08 II  Y43H11_160.a    CCAACTGTACCCAAGGTATTCAA ATTCTCCAAGGCTTTACCTCAAC II-9H15
65  D09 II  Y46G5.a GAAAATCCTCCAAAAATCCCTAA AGTGATGGGGAATAAAAGGTTGT II-9H17
65  D10 II  Y46G5.aa    CACAAAAGATCATCACGATCAAA TGTGGTAACATTCATAAGATGCG II-9H19
65  D12 II  Y46G5.bb    AAGGTTCCGGTCAAATACAAAAT GCATTTAAAAAGCCACAAAACTG II-9H23
65  E01 II  Y46G5.c TCTCTGGCTCATTCTTGAGATTC CGATACGTCCGATTAATATCCAA II-9J01
65  E02 II  Y46G5.cc    CTCCCATTTCAAAAACTCATCAC TAACCCTACAAAAATCTTCCCGT II-9J03
65  E03 II  Y46G5.d GCTCCATAATCTTGTCGTACACC GACTACAAACTACAATGGCCGAC II-9J05
65  E05 II  Y46G5.e GGAATTAAATGGAAATCGGAAAC TTATTAGCTAGCCAAATGAAGCG II-9J09
65  E06 II  Y46G5.ee    TGAGTTAGTTCGGAAAATGGAAA AAGAATGGAGTTCGGGAAGATAG II-9J11
65  E07 II  Y46G5.f TGTTCCATTTCAGAAAGGTGAGT CATCGTTGAGATAACGGAAGAAC II-9J13
65  E09 II  Y46G5.g AAACGTATGCCTTTCACTCGATA AAAAATACCTTGCCACCCTAAAA II-9J17
65  E10 II  Y46G5.gg    TCTCCACAATCAACATGAACAAC CTGTGCTCCAACTTCTGAATCTT II-9J19
65  E11 II  Y46G5.h ATATACAGTGCTGGCCAAAAAGA AAGTGGGCAATGTAATATGATGG II-9J21
65  E12 II  Y46G5.hh    AAAACTATTTCCCACATTTCGGT GTTCTCACATTGATCTTTCGGAC II-9J23
65  F01 II  Y46G5.i TTCAGTAATTTCCCCACATTCAC ACTCTAGATGTCGTCTCCTGCAC II-9L01
65  F02 II  Y46G5.j TTCAGTTATTTCCCCACATTCAC ACTCTAGATGTCGTCTCCTGCAC II-9L03
65  F03 II  Y46G5.jj    CATCAGGAAGAAGATGAAACACC CCATCGTAAATTTAATGAGCGAG II-9L05
65  F04 II  Y46G5.k TCTCCCTCACTATTGTCTCTTGC TCTGATTTTGTGAACGTCTGCTA II-9L07
65  F05 II  Y46G5.kk    ATGGAAGACAACTTTCACACGAT AATCACTCCTTCGTTTTTGTTCA II-9L09
65  F06 II  Y46G5.l TTTATGCCCCTAATTTTCAGGAT ATAATATAGTGTCGGAGCGGGAT II-9L11
65  F07 II  Y46G5.ll    ATTATTTTGTTGAAGAATCCGCA AATTGAATTTCAGATCGCAAAAA II-9L13
65  F08 II  Y46G5.m AGATCATCGTCAACATCATTTCC TCATTTCTCACCCAGAAATCAAT II-9L15
65  F10 II  Y46G5.o GTGGCCTAGTTTTATGCTTTCCT ACTATTACGGAGCCATCAGATCA II-9L19
65  F11 II  Y46G5.p TCAGGAAGCTGAAAAGTTCATTC AGCAAAGTTAGACACGAAAGTGC II-9L21
65  G01 II  Y46G5.r CATTGAAATTTGCATGTGAGAAA GTGCATTTTTCCAAAATTTACCA II-9N01
65  G02 II  Y46G5.s TCGCAATATTTCGCCTCTAGATA ATGGTTTAAAAGCCGTAGAAAGC II-9N03
65  G03 II  Y46G5.u AAAATTAAGCTGAAAAAGCAGGG TTTTGAGCCATCTTTGTTGAAAT II-9N05
65  G05 II  Y46G5.w CCTTCTTCATCAGTCTGCTCATT CAGAAATGTTATTGTGCAATGGA II-9N09
65  G06 II  Y46G5.x ACCAAAACTCTTCCTTCACCTTC AGAACGCAGTAAGAAGGACTGTG II-9N11
65  G07 II  Y46G5.y CCAGAATTCGAGAAGTTGAGAGA TAGGTGCCTACACTGCCTACAAT II-9N13
65  G08 II  Y46G5.z AACCGCAGACTACAAAATTCAAA AGTTTAGCGATCAAGTCAGAACG II-9N15
65  G09 II  Y51H7B_4.a  TCGCAATGTTCTACTCGACTGTA TTGACTTTACCGAAATTGAAGGA II-9N17
65  G10 II  Y51H7B_4.b  AGATTGCAAAACCAAAAAGTTCA TCCGGGAAAAATATAATCTAGGC II-9N19
65  G11 II  Y51H7B_5.a  GTACCTGTTATATTGGCTGCTGG ACTGTACTGGATTTTGCACTGGT II-9N21
65  G12 II  Y51H7B_5.b  GTACCTGTTATATTGGCTGCTGG ACTTTTTATCGATTGCCGTGTAA II-9N23
65  H01 II  Y51H7B_6.a  TTTTTCAAATTTTCCCAAATCCT AAATTGCACAAAATGCAGAGAAT II-9P01
65  H02 II  Y51H7B_6.b  AAAGGGCCACTCTATTCTCATTC TAGCCCATGGTTCATAAAAATTG II-9P03
65  H03 II  Y51H7C_254.a    GAATAGGCCGGTTTAGACTTGTT CCGAAACATCTCCTACAGAATTG II-9P05
65  H04 II  Y51H7C_254.b    ATTCCAGGTATCCCTAATCCTCA AAATTCATTTTTCCGTATTGCTG II-9P07
65  H05 II  Y51H7C_255.a    ATAACCGACAGACGAATTACACG GTAGTCTAGCAGACCCAAAGCAA II-9P09
65  H06 II  Y51H7C_255.b    TATCGCCAGATTTGTGCTTATTT TTTTTCCGTCATTTTAAAGCAAA II-9P11
65  H07 II  Y51H7C_255.c    GAATTTCTGCCAATTTTAAGCCT AATGGGTCGTGAGCTTCATAGTA II-9P13
65  H08 II  Y51H7C_255.d    ACCAACGTGTTGGATTTATTCAC GTGGAAAATTGTGTTTTTCTTCG II-9P15
65  H09 II  Y51H7C_255.e    TTTTCCACCAAATATCATTCCAG ATGGAGATTTTATCGCGAATTTT II-9P17
65  H10 II  Y51H7C_255.f    CTCGGCTATTGTTCAGGTTAATG ATTATTGAGCCGAGTGACTGCTA II-9P19
65  H11 II  Y51H7C_255.g    TTGTAGCCTAGCAGACCAAACTC GTAGTCCAAAACCTACCCTTGCT II-9P21
66  A01 III cTel54X.1   AGGGGAAAATTTGGAGTCAATTA CTCGACGAGAGTTGTTGAAGAAT III-1A01
66  A02 III H10E21.1    TTTTTCTTGCCATTTCAACACTT AGGAGAATGCGAAAAAGAAAAAT III-1A03
66  A04 III H10E21.3    TATCCGTCTCATCCTCCCAG    CACAAAAAGTGCCTGAGCAA    III-1A07
66  A05 III H10E21.4    AACCTTTGGAATTGTTGATCTGA GGTTTTGTCTAGTTCATTGCCAG III-1A09
66  A06 III H10E21.5    CCAGCTTTCTCAACAACTCACTT ACCATCCAACTATTCTCCCATTT III-1A11
66  A07 III W05G11.2    TTCAAAAGAAGCTCCAAACTCAG TAGATTCTGTATTAGGCCCCCAT III-1A13
66  A09 III W05G11.4    GTTTCGCGCAGCACTATACA    CCCTCTCAAATCCGAACAAA    III-1A17
66  A10 III W05G11.5    CTAACAGGTTCGAGGCGAAG    GCCCAAATTTCGCTACGTTA    III-1A19
66  A11 III W05G11.6    ATGTGCTCCCTAAAAAGAGTTCC TAACACAATTTTCACAAACGTCG III-1A21
66  A12 III F54C4.1 CACTTCAAATTCCAATTTTTCCA TAATGCGTCATCCTATGTCACTG III-1A23
66  B01 III F54C4.2 GCTGCATACATGAATTACCCATT TTTCGAAAATTTCCAGAACTTCA III-1C01
66  B02 III F54C4.3 CACTGACAAAGTGGAAAATGACA TATCCTTTTCTTTTTCTCTCCCG III-1C03
66  B03 III F54C4.4 CGGGAGAGAAAAAGAAAAGGATA CACCGTAAATCTACACAAGCTCC III-1C05
66  B04 III C29F9.1 CTCAAATTTTCACTTTTTGCCAC TCGAGTCTGAGGTCTACCATAGC III-1C07
66  B05 III C29F9.2 TGAGTGCTTCTGAAACTAGGAGC TCTGAAACTGGCAAATTCAAAAT III-1C09
66  B06 III C29F9.3 AGAACTTTGCGACCAGCATT    TGTCTCGCAAAGGGAGTCTT    III-1C11
66  B07 III C29F9.4 ATGAACAACACGGATTTTATTGC TGCGGTCCAATTTTTATCATTAC III-1C13
66  B08 III C29F9.5 TTCAGCATCTCCTGGTTCTACTC TCTGAACCATCACTTTCATCCTT III-1C15
66  B10 III C29F9.7 TATATAGACGGAAAATGCGATGG AAATCCCAAAAATTTCCAGCTTA III-1C19
66  B11 III C29F9.8 TCACAGCTAACTCCTGAAAAAGC GTCTGTGGTCCTGACTCTGACTT III-1C21
66  B12 III C29F9.9 GTGTGCACTGCTACAGACAAAAA TACGAAATTATGGGAAGAAAGCA III-1C23
66  C01 III C29F9.10    CTTGGCAGAATTGAACCAACTAC GAAGTCGAAATGAATTTGAGTGG III-1E01
66  C02 III C29F9.11    CCACCAGTGTAGTCCGGTTT    TGTGCTGCGCAGAATTTAAG    III-1E03
66  C03 III C29F9.12    ACCGTTTAACCATATAAAACGCA AGCTCAGATAAATCGAACCACAC III-1E05
66  C04 III C29F9.13    TGCACTTGTCTAAATTTTCCGTT AGCACACTTTCTTGTTATCAGGC III-1E07
66  C05 III T17A3.1 TCATGGGAGCCCTAAAACAG    CCCTGTAACAGCCCACCTTA    III-1E09
66  C07 III T17A3.3 GTTCCATCGTTCCGTCTGAT    TTGATCGATGCACCATGTTT    III-1E13
66  C08 III T17A3.4 GCACTCTCCCACTCCTTGTC    GCTGGAATGCGGTGTCTAAT    III-1E15
66  C09 III T17A3.6 CACTTTTCAAATAATGACGGCTC TTGTTAACTCAGCGTTTGGTTTT III-1E17
66  C10 III T17A3.7 TAGTGACTACTTGGCGAGCTAGG GTCATTCATTCCCTTTACAACCA III-1E19
66  C11 III T17A3.8 CAAGCCATTCCATTCCAGTT    CGGGATATCCAGATCCAAAA    III-1E21
66  C12 III T17A3.9 CATCAATTAATTTGGGTGGAAAA AGAAGATGTGACGCTAAAACTGC III-1E23
66  D01 III T17A3.10    CCCGATAACGTTGATCATAAAAA CTATTTTTACAGGGACACCCCTC III-1G01
66  D02 III F40G9.1 CCACGTGGCTCTATTGTTTATTT ATATTTAGCCCGAAAATTCCAAA III-1G03
66  D04 III F40G9.3 CTGTGATTTAAGCAATTTTTCGC CACAAACTTCAAGACAAGAGGCT III-1G07
66  D05 III F40G9.4 AATGTGTTTGCACAAAAAGTGTG TCAGAGGTTCTAACTTGTCTGGC III-1G09
66  D06 III F40G9.5 CTGAAGCCCAAGATACAAATGAC AAAAAGTTCATCTTCCGTCCAGT III-1G11
66  D07 III F40G9.6 GAGAGAGAGAGAGGAGATGGGTC GGAAAGTGAAACAGGTGAAAGTG III-1G13
66  D09 III F40G9.8 TTCAAATAAACTCCCCAGGTACA AGAATTCTACACTCCCGGAACTC III-1G17
66  D10 III F40G9.9 ATCGATCCCAAGGATGATTTTAT GAAATTGCATCTTGTGAAACTCC III-1G19
66  D11 III F40G9.10    TTCAATTGCAGAAAAATGGAAGT CGTTGTTGGGTCATTTAGACATT III-1G21
66  D12 III F40G9.11    CGCGTTGAATAATACATTTGTTG TTGAGAAACCCGTTCAGAAAATA III-1G23
66  E01 III F40G9.12    TCTCTTTTAATTCCCTCAAAGGC ATTCAGTAAACTGCTTCTCGTGC III-1I01
66  E03 III F40G9.14    TTGATGGGCACTCTGTAGAATTT TCTTTCAGATTGTGCTCTTCCTC III-1I05
66  E05 III W10C4.b AGAATTGTCGAATTTTCGTTGAA CGGAAAACAAAGCAAGATAAATG III-1I09
66  E06 III W07B3.1 GATTATAGACCCTCCGCTCATTT TCACAGAAAGTCCGAAAATTGAT III-1I11
66  E07 III W07B3.2 TTTGGAGTGTAGCGTTTTTGATT CACTGAAAACACGAATTGAATGA III-1I13
66  E08 III K10F12.2    GCCGAAATAAAACACTCTGACAC ACTCCCCACTTGTTACCAATTTT III-1I15
66  E09 III K10F12.3    TAGCGTGACCGATAATTCCC    TACGAAGTGTCCCAAGGACC    III-1I17
66  E10 III K10F12.4    CCGGAAAATTAGGATTTCCATAG CAACTTTGGAAAGAATTTGATGC III-1I19
66  E11 III K10F12.5    GGACAATTGAGTCGAACAGATTC GTTCTACACGGAGCTCTTCAAAA III-1I21
66  E12 III K10F12.6    CCTAAGGGCCAGGATAAACTAGA CCATGCTTGAAAACTTTTTATCG III-1I23
66  F01 III F10C5.1 ACAGTGAGCATGCGATCAAG    ATCTCCTCTTCGCCTCCTTC    III-1K01
66  F02 III F10C5.2 CTCAGTTTTTCCCTTTCCCC    AAATTCCACGTTTCATTCGC    III-1K03
66  F03 III F30H5.1 AATTGTTGAAGTTCTTCAGCGTC CCTCCTCTAATCTCTGCAAACAA III-1K05
66  F04 III F30H5.2 ATTTTTATCCCAGAACCGATGTT TTTCAGTTTCAGACAAACCCATT III-1K07
66  F05 III F30H5.3 GCACACAGATTCCTTGCAGA    GTGCAATGCAGCTCTATCCA    III-1K09
66  F06 III T22F7.1 TCCTCTGGTCTCTATGTGCTCTC TGAGAATCCAGAGAAAAGTCTCG III-1K11
66  F07 III T22F7.3 TTGTTGTAATTTCCGAGCCC    ATCTGCTGGTCTTTGCGAGT    III-1K13
66  F08 III T22F7.4 AAGAGGAGAAGGAAAGGAGTGAA TATCTAACCACGGAACCTGAAGA III-1K15
66  F09 III B0353.1 TTCAGATACTCCGGTTTGAAAAA CAGTTGACATAGACACTCACCCA III-1K17
66  F10 III T19C3.1 TTGGATCCGAGAACACATCA    TAAATCACAACCTGGGAGCC    III-1K19
66  F11 III T19C3.2 TGCCTCATTTCAGAAAACCTTAG TGACAACCCTTTTATCCCTTTTT III-1K21
66  F12 III T19C3.3 TTCTTTTTCGGCTTTTTCTCTCT CTTATTTGCCCTTTAGTGAACCC III-1K23
66  G02 III T19C3.5 ATGGACAAACGGAATAAGCG    TTAAGTTGTCCAAAACCGGC    III-1M03
66  G03 III T19C3.6 TCAAAAATACATTCCGCAAAACT TGCCAAATTCTGAGAAAAACAAT III-1M05
66  G04 III T19C3.7 CAAGATAATCCCACTCCACATTC AATTTACAGTACTCACCAGGCCA III-1M07
66  G05 III T19C3.8 TTTCAGGCAAAATTTCCACC    CGGTTTTTGGCGTATCCTAA    III-1M09
66  G06 III W06E11.1    GTGCTTCTGACGACGAACAA    GATCGTCCAAAAGGAGTCCA    III-1M11
66  G07 III W06E11.2    TGTCATTTACTCGTTGTTCCTCA AATTTCAATCAATAAATGCCACG III-1M13
66  G08 III W06E11.4    ATTTTGAGTGCAAAAGAGCAAAA AAAAACACCCATTCTTCTCACCT III-1M15
66  G09 III W06E11.6    ATGAATTTTATTGGAAAATCGGC GATTTCACATTGGAGAAATGAGG III-1M17
66  G10 III C09F5.1 GCCCGAAAAGACAGCTACAG    TGAAATTACTCCACTGGGGC    III-1M19
66  G11 III C09F5.2 CTTCAGATGCCTCGTTCACA    TACAACTCCAACAGGCACCA    III-1M21
66  G12 III C09F5.3 CCATCGTCAAGCTTCTCTCC    CCAGCCATCAATCTCAACCT    III-1M23
66  H01 III W02B3.2 ATGGAGAAGAGCCGAAGTCA    CACAGTTTGTCGGGTGATTG    III-1O01
66  H02 III W02B3.3 CCTGTCCCTTCTAATAGCGTTTT GCACACACACACGTACACTTTTT III-1O03
66  H04 III W02B3.5 TTCCAGGAGTACAAGAAATCCAA GGGGTTTTTGACAATTTTTCATT III-1O07
66  H06 III W02B3.7 TCAAACATTATGCCAGCAATAGA AAACGTGGACGTTGAGTTATGTT III-1O11
66  H07 III C24A1.1 ATTTTGCGTCGATGTTAGATGTT GAGAAAGAGAGGGAGAGAAAACG III-1O13
66  H09 III C24A1.3 AGCCCAGATAACCGGAGTTT    CATTACCGCCGTCAACTTTT    III-1O17
66  H10 III C24A1.4 GCAAATTGACAAGAAATGAGAGG CAGAGAACTCAAACAAAAATGGC III-1O19
66  H11 III T17H7.1 CGACAATCTAACCAATGGAAATC ATATTTTTGAGAAGGAGCGGAAG III-1O21
67  A02 III T17H7.5 TCCACTGACATAGCTCGTCG    GAGACATCCCTGAACCCTCA    III-1A04
67  A03 III T17H7.7 TCGAAATCTGTACGCTCGTG    GCCCAACAAGCAAATTAGGA    III-1A06
67  A04 III F42G9.1 GCCGATTTCAGTTTTTCCAG    CAAATCCACAGCCTTTCCAT    III-1A08
67  A05 III F42G9.2 CCAAAATCTCAACAAGTTTCCAG ACAAGTTCCAAAACGTAGCACAT III-1A10
67  A06 III F42G9.3 CACCTAACCTGTCCACCAAAATA CAATAAGACGGACAGAACCAAAC III-1A12
67  A07 III F42G9.4 TTTTCTGTCTATATTCGGCGGTA TCATTCCAATGAAGTTTCTCGTT III-1A14
67  A08 III F42G9.5 GGGATTCGGAGCAACTTACA    CAATTCAAATTCCCGCTCAT    III-1A16
67  A09 III F42G9.6 TTCACTTTCGGCGACTTTTT    ACTTTGTGGGCGTTGTCTCT    III-1A18
67  A10 III F42G9.7 CTTGCTCATCTTGTCATAATCCC GTTCTGCCAGAGAGAAAACAGAA III-1A20
67  A12 III F42G9.9 TGCTTGGCTTGAATAATCCC    TTACCTGAAATTTCGTGGGG    III-1A24
67  B01 III B0412.1 ATGTCCCGAAAACATTGCTC    AATCGGAATACGCGAAAATG    III-1C02
67  B02 III B0412.2 CAGCTTGTTGCCAAGTTTGA    TGTGACAATCGGAAGTGGAA    III-1C04
67  B03 III B0412.3 GCACTCGAAGCAATCAATCA    TGGGGATTTACCTGCTCTTG    III-1C06
67  B04 III B0412.4 TTTTTCGAAACATTTTGCATTCT CCAGATTTGAACCGTTTGTTTTA III-1C08
67  B05 III K02F3.1 AGCATTACTTGCAAATGGGC    CCTGCTCTTCCACTTTCCTG    III-1C10
67  B06 III K02F3.2 CGTGGACTTTTGCCTCAAAT    ACTTTGGCAAGAACAATCCG    III-1C12
67  B07 III K02F3.3 ACCAAGGTGCTCGTTGAACT    TTCTTCAATCTTTGCCGCTT    III-1C14
67  B08 III K02F3.4 ACATGCTTTTGCCTAAACGG    GTGCACAAGCTGTGGAAAGA    III-1C16
67  B09 III K02F3.5 AAATTTTAAGCGGCATAACACAA ATTCAGTTCAAAGTGCTCCTCTG III-1C18
67  B10 III K02F3.6 CCATATAACAAACCGTACCTCCA ATTTATTCATGGATACCCCGAGT III-1C20
67  B12 III K02F3.8 TTCCGACTCCTTGTGCTTCT    CGATTTGTCAAAAGGACGGT    III-1C24
67  C02 III K02F3.10    CTCTTCTCACCATCCCCTAGATT CAAGTGACAAATGTTTTTGGACA III-1E04
67  C03 III K02F3.11    ATTTGGACAGTTTAGAATGGGGT AAAAAGTAAGCGCTTTAGCCAAC III-1E06
67  C04 III T24C4.1 CAGAACTCTTTCGCTACCCG    CATATGCAGAGATGGCGAGA    III-1E08
67  C06 III T24C4.3 AATGAGTATAGTTTCCGCGATGA AAGAAACCGCTGTTTTGTGTTTA III-1E12
67  C07 III T24C4.4 CGTCTTTTCAAAGTGAGGATTTG TCAATTGATCTTTAATAGCCCGA III-1E14
67  C08 III T24C4.5 CGACCTTGCATTGTCTGAAA    GCCATATGTGCGTGTTTTTG    III-1E16
67  C09 III T24C4.6 CCAAAGGAAACTCCATCCAA    CCTGTTGAGCCACCGTTAAT    III-1E18
67  C10 III T24C4.7 CTTTTTGCTTCGCCAAAGAC    CGACTCCCACGTGAAAGAAT    III-1E20
67  C11 III F23H11.1    ATAACGGAGTGTCGTTGACAAAT CTTGTTGAGGAGCTGGTACACTT III-1E22
67  C12 III F23H11.2    GGGATTTGTCCGAAAAGTGA    ACTCATATTGTGCCCTTGCC    III-1E24
67  D01 III F23H11.3    AGCTGACCCGGAAGAAAAAT    CAGTGCTCAAATGGCTTCAA    III-1G02
67  D02 III F23H11.4    GACTTCTACGAGCTCATCTCCAA TGGTTAGGCATTTAATTTCCCTT III-1G04
67  D03 III F23H11.5    TCGGCTAAACTAAAAATTGGTGA ATTCTTATTTTTCCGTGGTGGTT III-1G06
67  D04 III F23H11.6    CGGTCTTTGTTCAAGTTTATTCG GAACCTATTGCTCTTCCCACTTT III-1G08
67  D05 III F23H11.7    GTAGCCGAGCTATGAGCGAC    GGAGTCTCGTTCTGAGTGCC    III-1G10
67  D06 III F23H11.8    AGATTCCGCGATTTGAGAAA    TGTGGAGTGATCCCAAACAA    III-1G12
67  D07 III F23H11.9    CCTTCCCACTGGCATACTGT    TGTCACTTCCGTCGATTGTC    III-1G14
67  D08 III T12B5.1 TGTTAATGACGGTCGTATCACAG TCAATCGGATTTGTCTCTGATTT III-1G16
67  D09 III T12B5.2 TTCGATTTATGAGCGGGTAAGTA TACTGCTTCTCAAAAGATCCTGC III-1G18
67  D10 III T12B5.3 AAATGCCTGAATTGTTGGATATG TAGAAACGTCAGGCTTGAACAAT III-1G20
67  D11 III T12B5.4 AGTGTGTAGAAGCTTGAGAACCG TGATAGTGAGGAAAAGAGGATCG III-1G22
67  D12 III T12B5.5 AAACTTTGCCAAATTCAAATCAA GGGGATCTGTTGATGACTTGTTA III-1G24
67  E01 III T12B5.6 TTTTCTCCGTCAATCAACTTTGT GCGACTTCAGTCTCGAAGAAATA III-1I02
67  E02 III T12B5.7 TGGTAAGATGGACCAAAAGAGAA TCATCTTCTTAATTCCCCTCTCC III-1I04
67  E03 III T12B5.8 AATTTGTCGTTACCATTCGAAAA GGAGTGAAATTTCGGAGAAAACT III-1I06
67  E04 III T12B5.10    CGATATTAAATACGTTTTCGCCA GCCAAAGACACATCAGAAAAATC III-1I08
67  E05 III T12B5.11    TCATAGTCCGGTTTGAACACTTT GTTTGAACTGATAAACGCTTGCT III-1I10
67  E07 III T12B5.13    ATCATTTCCATTTCTTTTCCGTT AGTCAATAGGCATGTCGTCTAGC III-1I14
67  E08 III R06B10.1    GCGATTGAATCTTGCTCTCC    TCGTTTGGATTAGACCCAGG    III-1I16
67  E09 III R06B10.2    GATGCTGATGCTGATCTTCTTCT ACGAGTTCTCGTCTTCACTCAAC III-1I18
67  E10 III M01G5.1 AAAAGCCACCCTCCTGAACT    ATTTTTGCGATTTTTCACCG    III-1I20
67  E11 III M01G5.3 ATTATGCAAATCGTCGTCTCAGT AGTGTTTGCGTACTTTTGGATGT III-1I22
67  F02 III F58B6.1 TTTTGGCAAACCAAATTAATCAC GAATTCGCCAACAGTTTTCATAG III-1K04
67  F03 III F58B6.2 CAGAAACGTATAATTAGGCCACG TAGACGGTAGAAAAAGCTCGATG III-1K06
67  F04 III F58B6.3 CAAATTTTCAATTTTCCCATCAA CAAAATCGCATTTAGAGCACAAT III-1K08
67  F05 III F58B6.4 ATATCTCTGGGCAGAAAGGGATA CCAATATTTCAAAGTTGTCGGAA III-1K10
67  F07 III Y71D11A.b   AAGCTGAGAGCATAACAAAATCG AATACAGACGAGGTGAAGATGGA III-1K14
67  F08 III Y71D11A.c   TCTAGTTTTCAGATTTGCGAGGA CATCGTTTTTCGAACAAAAAGTC III-1K16
67  F09 III Y71D11A.d   GTCAAATTTCATCGTTTTTCTCG GAGACCTTTCTTCAATGCACCTA III-1K18
67  F10 III ZC47.1  ATTGTTTCAGCAGGTTGATCTGT TACAAGCGAAGCAAAAGTAGAGC III-1K20
67  F11 III ZC47.2  TCTCGATCGTCCATGATATTTCT AAAGTTCGTATGTTTGCCGAATA III-1K22
67  F12 III ZC47.3  ATTTCAAATTTGGATTTTCCGTT AATTCTGGAAAAACTAGAACCCG III-1K24
67  G01 III ZC47.4  TCAAATTTAGATTTCCCGTTTGA TGTTCTCCCCAAAATGACTTCTA III-1M02
67  G02 III ZC47.5  GATACTGACCAAAGCGATGGATA CCGAAAAGTGTGTCGAAGTTTAC III-1M04
67  G03 III ZC47.6  CTCGAACTTTAATCGCACTTTGT CAATGACAGTGAGCACAACATTT III-1M06
67  G04 III ZC47.7  GGCTGAAACAATCTTGAAACATC GTTTGATAATTGCCTGTTTGCTC III-1M08
67  G06 III ZC47.12 ACGTCGATATGATTTTTGACCAC TAAGACGCACCAAAAGAAGAAAG III-1M12
67  G07 III ZC47.13 GGGTTTCATTCATTTTCAAACAA CCTGCTCAAACTTTTATTTGGTG III-1M14
67  G09 III B0524.1 CAGCCAGTTTTCACTCAAATACC TGAGGCATTTTCTTGTGAATTTT III-1M18
67  G10 III B0524.2 CGAATTTCGCAATGAAAATCTAC GTTCGAAGATTTGACATTTTTGC III-1M20
67  G11 III B0524.3 TAAGCTCGATCAAATTCCAAGAG AACCAAGCCAATCTACAGTTTCA III-1M22
67  G12 III B0524.4 CGATAGTTGCATGCCTTAAAAAC AAATGCTCCAATTCACAACAAAC III-1M24
67  H01 III B0524.5 TATTGGCTTTGGGAAAGGTAAAT CGATGATTGGTGAGTTCTTTTTC III-1O02
67  H04 III F53A3.2 ACATCTCCGATTGGCGTAAG    AGTCGAACAACGGGACAATC    III-1O08
67  H05 III F53A3.3 CATACTTTTCTCGAATTTCCGTG CACACGACTCGGTTGTAGTTGTA III-1O10
67  H06 III F53A3.4 AAACTTATGAAACCCGTTGGATT GTGAAAAACTAAGAGGTCAGCGA III-1O12
67  H07 III F53A3.6 CAAAAACGGAAATATACAAAGCG GAAAAACTCCTGCTAGGGGTAAA III-1O14
67  H10 III R155.3  CCAAAGCCTTCAGATTAGCG    CTTCGAGTATCTTCGGTCGC    III-1O20
67  H11 III R155.4  GGCGATCCGTACACAAACTT    TTGCTGAAATCACTGGCTTG    III-1O22
67  H12 III Y39A3B.1    GATTCAACGAAACAGAAAAATCG AAACGGGTGGAGTCTGAAATTAT III-1O24
68  A03 III Y39A3B.4    GAATCGAGTTTCGATAGGGAGTT TGTTCCTGGCTATGTTCATTCTT III-1B05
68  A04 III Y39A3B.5    ATTCGATAGCCACCTGACTCATA AAACTAACCAAAAACCGGAAAAA III-1B07
68  A05 III M01E10.1    CTCGGTCAGTTTTCCAGATTTTA CCGCTCTTTTAATTCCTCATTTT III-1B09
68  A06 III M01E10.2    AAACATAATCACCGGCTTCG    GTTGTTTAGCGGTTGACGGT    III-1B11
68  A07 III M01E10.3    ACCTCCAACTGATAACGCTGATA CTCTCACTGAACAGCTTGGTTCT III-1B13
68  A08 III Y39A3A.1    TCCTCGAAGACTAATTGTGGAAA ACGAAGCTCGTCGTAATATGTGT III-1B15
68  A09 III Y39A3A.2    TGAGCAATGAAGAAACAAACAAA TTTTTCAGGGGCATATTTAGTGA III-1B17
68  A12 III C39B5.a TGGGAACTCCTGTCCTGTAACTA TTAAAAGCTCACCATGCATTTTT III-1B23
68  B01 III C39B5.b TGCGCATTTATAAAAGATTCGAT TGGTGTTTTATGGTTCGCTAGTT III-1D01
68  B02 III C39B5.c TTTAGCAAGAAATGGGTGAAAAA GATTTTTCCGTGACTTGAGAATG III-1D03
68  B05 III C39B5.f TTAAACAAGTTTTTGGTCCGAGA AAATGTTTGCAGAAGTTGGAAAA III-1D09
68  B06 III C39B5.g AAAAACAAAGTCAACAACCGAAA ACAAGTTGGTGACAAGCTACCAT III-1D11
68  B07 III T20H9.1 ATTGGGAAGGTTTGATGTGC    TATCCGTCCGGATCAAATGT    III-1D13
68  B08 III T20H9.2 CTGAACTCGCGAAATTAGAAGAA CGGAGAATTTGCGTAAAACTGTA III-1D15
68  B09 III T20H9.3 AGAATTTGCTCAAACGTGCC    AATGAAGGACGGTTTCATCG    III-1D17
68  B11 III T20H9.5 GATAAGAAAATTTCGCAAGGGTT GTTCGGAAACACGAGGGTATTAT III-1D21
68  B12 III T20H9.6 TATACGCGTCATGCATTGGT    GGAATCAATAGGCTCCGTGA    III-1D23
68  C01 III H04J21.1    AACCATGTTTACATCATTCCCAG AACCGTCGTGCTACTATTGGTTA III-1F01
68  C03 III H04J21.3    AAAAATCCCCCAATTTTCTTACA AGAAATCCAAAAAGTTAGGCCAC III-1F05
68  C05 III H14E04.2a   AAAACAGGCTATCGATGCACTTA AAAAAGACACTTGGGGTGAAAAT III-1F09
68  C08 III H14E04.5    TTCGAGTTTTTCGAGTTTTTCAG TTCGAATTTTCATCGATTTCACT III-1F15
68  C09 III W04B5.1 TTTATAGACGCAGAGAACTTCCG GCTGTAGAACGCTGTAGGACAGT III-1F17
68  C10 III W04B5.2 CAAACTTTGAGGGGCTTATTTTT TACCACCCGTACCTTATTGACAC III-1F19
68  C12 III W04B5.4 AGGAGAAAACTGGAAAATTGGAC CGTAACACTGAGCTCATCAACAC III-1F23
68  D01 III W04B5.5 TGGGTTTATTCACAATTTTCCAG GGGCATTTTATTTGACGACATTA III-1H01
68  D02 III W04B5.6 GTTCATTCCGTCTTCAATGTCTC TGATAACGAACCATACAAAAGGC III-1H03
68  D03 III E02H9.1 GAATTAGGATGAAGCTTGGGAAC CTACATAGGGACAGAAGGACACG III-1H05
68  D04 III E02H9.2 CCAAAAATGCTCTCATCCTAATG AAATTCAAGGTTTCCTGTTCTCC III-1H07
68  D05 III E02H9.3 AAGGGTCACCATAAAAGGGG    CCAACTCTACGGCGTTCAAT    III-1H09
68  D09 III E02H9.7 AATGGCAAAAACAAGCTTTACAA CTGCTTTTTCTGTGGTATCATCC III-1H17
68  D10 III E02H9.8 ACGTGATATCGGTCCCAGAA    TACTTCCAGAACCCCACGAC    III-1H19
68  D12 III H19M22.1    GGAGCCAGTTGATTGCTCTC    GAGCAGCACATCCAGTACGA    III-1H23
68  E01 III H19M22.2    TACGGATCAAGGTTATCGGC    TCCATGTCGTCTCATTTGGA    III-1J01
68  E02 III H19M22.3    AATCCGTGACGCTTAAATGG    AGCGTCCGTTGACTTGAGTT    III-1J03
68  E03 III H19M22.4    TTGGTAGTTTTAAGATTTCCGCA CTTGAATGAAAAAGGTTTGGTTG III-1J05
68  E04 III H34I24.1    TTATATAACAACGTGACCGCCTC CCGAATTTATTCATTTCGTTTCA III-1J07
68  E06 III F56F11.1    TCCGGTCTTTATAAGCTAATCCC ATTCGATATTTCCGGGTTACTGT III-1J11
68  E08 III F56F11.3    AAATGAAAGCTCTTGGCTAGCTT TGAGCTTTTCGTGTAGACTTTCC III-1J15
68  E10 III F56F11.5    GTAGGCAATCGCCATGATTT    GCGCTAGTCACTAAAAGGCG    III-1J19
68  E11 III T20B6.1 TTCCAACAATTTCTGAGCACTTT TGTGATAGTATTGCAGGACGTTG III-1J21
68  E12 III T20B6.2 CTTGTTGGGATTCCGAGTGT    CTGAGCTGGTTTCAGAGCCT    III-1J23
68  F01 III T20B6.3 ATCAATGCAAAACGAGTCCC    GTTGAACCCGCTCAGAAAAA    III-1L01
68  F02 III R10F2.1 ACTAGCCCACAAGGCTCTCA    CAACTCTCAAGTTCTCCGGC    III-1L03
68  F05 III R10F2.5 TTTCAAGCTCTGATTTTTGCTTC GGCGTCGAAATGATGTATGTATT III-1L09
68  F06 III R10F2.6 ACCGGATGATGCAGAGATTC    TTTAAACACACTCCCACGCA    III-1L11
68  F08 III H05C05.2    TGTCTCGACAAATCCTTCAGTTT GTGGAAACACTTCTACAGCAACC III-1L15
68  F09 III H05C05.3    AGAGAGCCGAGAGAGAAAAAGAG GGTGCAGCTAGACCAGAAGTTTA III-1L17
68  F10 III H06I04.a    AGTCAAGCATGGTCTTCGTTAAG GGAGTGTCGTTAATTCTAATGCG III-1L19
68  F11 III H06I04.b    TGCAAAATTACCTTTCAATTGCT TCTCGAATTTTCGATTTGTGTTT III-1L21
68  F12 III H06I04.c    TCGTGGCGAAAAAGTTAAAAATA TTCATTTTGTTGCCTGAAAAACT III-1L23
68  G01 III H06I04.d    TCATCAGTTCAGTCAATGGTTTG CTTCTCTCGGAAATGTTGTCATC III-1N01
68  G02 III H06I04.e    CAAATCCCATTTTTCAGACACTC TCAGTTTGTTATGCCAACTTCCT III-1N03
68  G03 III H06I04.f    CATGGTCTTCGTTAAGACACTCC ACGAATAAACTTTTCTCCCGAAG III-1N05
68  G05 III H06I04.h    CAATTTGCCGACTTAAAATCGTA TTTTTGTTCAAAATTCGTAGGGA III-1N09
68  G06 III H06I04.i    TTAAAGGCGCATACAGTCATTTT TCGATGGTCTTGCATTAAATTCT III-1N11
68  G07 III H06I04.k    TCTCGAAAAAGAGGTCAGAAGTG GAAAGATCGATCAGGGAATTGAT III-1N13
68  G08 III C44B11.1    TTCCAACTTTAAAAACGGGGTAT CGTAATCTGGTCAATATGGGTGT III-1N15
68  G09 III C44B11.3    ATTTTTCGTGGCGAATTTTG    GAAATCCGCACTGGAACCTA    III-1N17
68  G10 III R148.1  ATACCGGAATCCGAGACATTTAT ACTCACTTTTCAGCCTTCAACAG III-1N19
68  G11 III R148.2  TTCAAATTTTCTTGCAGGATGTC ACAAAATTGTGGTGGAAAATGTC III-1N21
68  G12 III R148.3  GTCAGACGTCGGATTACGGT    GCTGCCTTCCATGACTTCTC    III-1N23
68  H01 III R148.4  CGATTAAAATGTCAAAAGAAGCG GGAAAAGTGCCATAAACAGTGAG III-1P01
68  H03 III R148.6  TTCACCAGATTTGAGAAGGAAAA AGTGTAAAGTTGAGAGACCGCAG III-1P05
68  H04 III R148.7  ACCTGTGAGCTCAGTTGGTAGAG TCAGTGAAAGTGAACAGTCGTGT III-1P07
68  H05 III H09G03.1    AGTTTCCAGCCACTGATTATTGA CCGAAAATCCTTTTAACCAACAT III-1P09
68  H06 III H09G03.2    TATCCATTCAGCGGAGTACCTAA TCCGGTACATCCACATAGTATCC III-1P11
68  H08 III F45H7.2 AAGCCTGTCTCGTTCTCCAA    TGAATTTAGCGCGTTTTTCC    III-1P15
68  H09 III F45H7.3 AAGCCTGTCTCGTTCTCCAA    TGAATTTAGCGCGTTTTTCC    III-1P17
68  H10 III F45H7.4 TTGATCGATGCACCTTTTCTTAT AATTACGCGACAACCTACACACT III-1P19
68  H11 III F45H7.6 GCTTCCAAACTGCACACAGA    CAAGCTTTAGCTCCCGACAC    III-1P21
69  A03 III F59A2.1 CGCATAACAACTCTCCACGA    ATTTCAGCTCTCCTTTCGCA    III-1B06
69  A04 III F59A2.2 AAAAATGACCAAAAATTGCTGAA TTCTCCATTTTTCCACCACATAC III-1B08
69  A05 III F59A2.3 CAGGTAAAATGAACACTGCTTCC CGAGCTGAAAGAAAATGTGCTAC III-1B10
69  A06 III F59A2.4 GACGTCGGAAAAACCACAGT    ACCAACCTCCGTGACAAGAC    III-1B12
69  A07 III F59A2.5 AACGCTTTCCCTGCTTAAAATAG TTAGTGGGGAATTTGCAATAAAA III-1B14
69  A08 III F59A2.6 ATCTGAAAACCGCTTTAGAATCC CCACTTTTTCCTCTTTTTCCACT III-1B16
69  A09 III K01A11.1    ACATTGACAAGAGATTGGAGCAT CTTGAACAAAAATTGTGGAGAGG III-1B18
69  A10 III K01A11.2    CGAGAAATCTCCTACTTGAACGA GTTCCATTTTTCCCATTTTTCTC III-1B20
69  A11 III K01A11.3    TCGTGTGGAGCAAAACTGAG    GAAAAATGGGGACATTGTGG    III-1B22
69  A12 III K01A11.4    TGTTGTACCCTTTGTTGGCA    CGCCCTTTTGAATTACAGGA    III-1B24
69  B01 III C34C12.1    TACGAATGGCAGATGTGGAA    TGGTGACTTGTACCCGTTGA    III-1D02
69  B02 III C34C12.2    TCGGAAGTCCTCTAGCGAAA    CTGATTGGCTCAACACGAGA    III-1D04
69  B03 III C34C12.3    CGAGGACATTACAGTCTGGAAAC AAAAGTTCGAAAACGGGAAATTA III-1D06
69  B04 III C34C12.4    ATAAAACCCGGTGATGATTTCTT CCCCATTGAGCAATATTTTTGTA III-1D08
69  B06 III C34C12.6    GGAACCGGTTTCATTTCCTT    GTAATTTTTCGACGGACCGA    III-1D12
69  B08 III C34C12.8    AATATGCTGCGCAAAGGAGT    ATAAAACGGCGGGAAAAAGT    III-1D16
69  B09 III M01F1.1 AATTTGCGAGAAATCAACCG    CCAAACTCCAATAACCCGAA    III-1D18
69  B11 III M01F1.3 CTCGTGGATCTCTGACCCAT    CACGATTTTCGCCTGATTTT    III-1D22
69  B12 III M01F1.4 CGAAATTGCGGTTTCCTAGA    CCGATCACTCGTTTTTCGTT    III-1D24
69  C01 III M01F1.5 GATTGTCCTTAACTCCGGCA    CGATGCACCATGTCTTTTTG    III-1F02
69  C02 III M01F1.7 TCGTGAAACTTTGCGATTTG    TGTAGACTGGGCTCACGATG    III-1F04
69  C03 III M01F1.8 GGCTTCTGAGCTTGAAATGC    TGATGGTTCGCTATGATGGA    III-1F06
69  C04 III C54C6.1 CATTTCAAGCGTCACATCAATTA GGCAACTTCTGAAAACTCAAAAA III-1F08
69  C05 III C54C6.2 CGCCTCCAAATACCTAACGA    TTCGAAAAGAGGCTGAAGGA    III-1F10
69  C07 III C54C6.5 ATCTTCCAACTTGTCCAATCTCA ATACTCTCCATTTGATTCCAGCA III-1F14
69  C08 III C48D5.1 CCTCTCCACACCAACCTCAT    CTTCCTGGCAGACATGGATT    III-1F16
69  C09 III C48D5.2 AAGATTATTTTGGCCTCGTCTTC TCCTCAAGTGTCTGATATTCGGT III-1F18
69  C10 III C32A3.1 CCACTCTTAAAGGCAAGGAATTT CTCCCATATAAGCCCCATATTTC III-1F20
69  C12 III C32A3.3 AGCTAAATTTTGAATAAACCGGC TAAAAAGAAGAACAATGGCCAAA III-1F24
69  D01 III C46F11.1    ACGCGGTCCTGAAGATTCTA    AAAATTCACCGAATCAACGC    III-1H02
69  D02 III C46F11.2    GAGCCGAACACGGTATTGAT    CGACTTTCTCGTCTTTTCCG    III-1H04
69  D03 III C46F11.3    AGCAAAAGAATTGGCGAAGA    TTCCGCTCAATTTTCCAAAC    III-1H06
69  D04 III C46F11.4    CACTCTTCCGAATTGCTTCC    AGAGTTCGGGAACCTCCAGT    III-1H08
69  D05 III C46F11.5    GGTGAGTGCTACATATTAACCCG CAAGATTTTTCAGATCGGTGTTC III-1H10
69  D06 III T27D1.1 GAGATCAAAGGTATCCGTGTCAG CGTTGAGGCTTCTGTGAAATTAT III-1H12
69  D07 III T27D1.3 AATCAGTTGGGATCACCGAG    TCCCATCATTTCTGTGTCCA    III-1H14
69  D08 III C14B1.1 TCAGGGTTGGGAAAGAGTTG    AAAGCCAACGAAATACACCG    III-1H16
69  D09 III C14B1.2 ACAGTGTAGTCCGAGTGGACAAT AAAGATACGTGGACAGCAAGAAA III-1H18
69  D10 III C14B1.3 CGAATGTTTCTCGCCAATTT    ATTTTTCGGAATCAACAGCG    III-1H20
69  D11 III C14B1.4 GCTCCTGCTCCATCTGTAGG    CGGGTTCTGAAATGGAAAAA    III-1H22
69  D12 III C14B1.5 CTGTAATTCTTGAATTTTTGCCG TCGAACAACAATATGAGGTTTCC III-1H24
69  E01 III C14B1.6 CGAAAATGGGAAAACGAAAA    AAGCGCGCTCTAATGACAAT    III-1J02
69  E02 III C14B1.7 CCAATGAATTGCACATGCTC    GAGGAAGCACAAAGCGATTC    III-1J04
69  E03 III C14B1.8 TATAAAGCACCGCTGGTATCATT GAAGTCGAACAGAAGCTACTCCA III-1J06
69  E04 III C14B1.9 TCTTGGGGATTTTGAACTGC    TAACACCCATTTGGCATGTG    III-1J08
69  E05 III C14B1.10    AAATCAGTTGAGAACTCTGCGTC ATGAGAAAAATGGCAAAATTGAA III-1J10
69  E06 III F34D10.2    TGCCAATGATTGAGGTTTCA    GCATCAGTGGAAGGTGTCAA    III-1J12
69  E07 III F34D10.3    ATTGGGGATATTTCGACTCTCTC TCCATTTTCACGTTATTTCTGCT III-1J14
69  E08 III F34D10.4    CACCGAGAACTGCTGTTAGACTT CTTACCTGCAATCTCTTCAGCAT III-1J16
69  E09 III F34D10.5    CCCTACCGTGATTTTGTGCT    CCGTAAGTCAACGGAGGGTA    III-1J18
69  E10 III F34D10.6    TGGCAAATCAATCTTCCCTC    TATCAGCAATGCGACTCGAC    III-1J20
69  E11 III C44F1.1 GGTTTTCCACAGAACCGAAA    TGCAAAGCTCAGACAAATCG    III-1J22
69  E12 III C44F1.2 ATGCTGGTTCCAAGTGATCC    ATTTTCCCTGGTCCTCCATC    III-1J24
69  F01 III C44F1.3 TGGACAGACGAACTGAATTTTTC CAGTCTCAGTGCAGTTCAAACAC III-1L02
69  F02 III C44F1.4 TCGCATTTCACTTATGGAAGATT AAGACCGAAAAGCTCAAAAATTC III-1L04
69  F03 III C44F1.5 TGTGTTTTTGCTATTGCCCA    AGCTTGATAGCCGAATCGAA    III-1L06
69  F04 III T24A11.1    CGACGAAACAAAATCCCATT    TGCCTATTCGGGTCTTTTTG    III-1L08
69  F05 III T24A11.2    TGAAGTGGGAAGAGATTGGG    CTGGAAAACTCCCACGATGT    III-1L10
69  F06 III T24A11.3    CCTTTTGCGCTGTCTAAAAGTAA CCCTCTTCCTCTCTACCTTTCTG III-1L12
69  F07 III T24A11.4    AAAAATCACATAATCGGTGTGGT TCCTTCTTCTTCACTGCTTCATC III-1L14
69  F08 III R13G10.1    AGTTTGGAAATTGGTGCGAC    ATTGGAAGGGGTCGAAAGTT    III-1L16
69  F09 III R13G10.2    CAGTTGGAAAGGGAGCTCAG    CGAAGGGTTGCACAGAATTT    III-1L18
69  F10 III R13G10.3    GACGGAAACACTAAAAACTGTGC TTGAAGTAAAGGAGGATGTCCAA III-1L20
69  F11 III R13G10.4    GCAAATGTGCATTCATCTCAATA TTGCCATAAGAATGCCACTATCT III-1L22
69  F12 III C36A4.1 ACACCTCCCTTGCAGTTACG    TAAAGGAGGAGTAGCGCCAA    III-1L24
69  G01 III C36A4.2 AAAAATGAAGGCAATGCAGG    ATAGCCATCCAAAGTGGTCG    III-1N02
69  G02 III C36A4.3 CAAATTTTGAAACCGCAATGTAT TAAGTTGTGATGGAAACCTGGAC III-1N04
69  G03 III C36A4.4 AAATTTGAAAGCATCACGGG    GGGCAGTTATGACGTCACCT    III-1N06
69  G04 III C36A4.5 CTCCAATGGATATTGTCGTGATT AATGCTGGATCAGTCTTTTCGTA III-1N08
69  G05 III C36A4.6 TTTGAGGGTTGAATCTTCGG    GCTGAACCAATCTCTGCTCC    III-1N10
69  G06 III C36A4.7 ATTGCTTTCGGTGTACGGTC    TTGGTCATTCAGCAATGGAA    III-1N12
69  G07 III C36A4.8 GGACCACCAAAACTACCGAA    CCGCTGGAAAAATTGAAAAA    III-1N14
69  G08 III C36A4.9 GGTATGAAGGTGTGCCGACT    TTCTTCTGGTAACCTTGCCG    III-1N16
69  G09 III C36A4.10    GTTTCTCTCGTGCTGATTGTCTT GACAACTTTATGTCGCAATGTCA III-1N18
69  G10 III F13B10.1    TTGAAAGACATTGGGAGTTTGAT TTCTTGATGGGATTAAGTCCAGA III-1N20
69  G11 III F13B10.2    AAGGCATTTTGTTCGTAATCGTA CAAGCAGCATAGTCCTTCAGATT III-1N22
69  H01 III ZK1058.2    AAAACGCTTCTTCTCGTGGA    CTACCGTCAAGCCGTTGATT    III-1P02
69  H04 III ZK1058.5    TCTCTAATAAACCTGGCTTGCAC TCCAGAAAACATGTCAGATGATG III-1P08
69  H05 III ZK1058.6    GACCATGCCGAGTTCATTTT    CCGACGACGTCTAAATCCAT    III-1P10
69  H06 III ZK1058.9    AAAAGGGGGAAAGCAGAAAA    TGAGGCTTGCTACTGCTTCA    III-1P12
69  H07 III F37A8.1 ATTTTAGTTTCAAAATGGCGGAT GTTGGAAGTAACTGAATTGGCAG III-1P14
69  H08 III F37A8.2 ATCTGATAGCGTCCGACATTAAA TATTAGTTGGGATGTGGAGATGG III-1P16
69  H09 III F37A8.3 TTTATGTTCTCTGTCGGATGCTT CTGAAAACCAGAAACCGACTATG III-1P18
69  H11 III R10E9.1 GAGATGAGTAAAATATGACGCCG GACTTATTTTCTTGCCGCCTATT III-1P22
69  H12 III R10E9.2 CAACCGACCAAGCGAATTAT    CGAAGAAAAATCCATCGGAA    III-1P24
70  A01 III R10E9.3 AAAATACATTGAAAAGCGCAAAA TTTTCAGGTGTCTTTGAACTGGT III-2A01
70  A02 III Y1A5A.1 AATAGGGCAATTAAGGCTCTGTC TTTTTGCGCTCAAATAAAGAGAG III-2A03
70  A03 III Y1A5A.2 AAGCCGTGTACGTGTTTGTCTAT CACAGTTGCCTTAAACATCATCA III-2A05
70  A04 III C36E8.1 TTTTCGATCGATTTGAGCCT    ATTTCGCAATTTCCAGCAAC    III-2A07
70  A05 III C36E8.2 TCAAAGCTTTCAGCAATTTCTTC CTCTCTCTCTCTCTCCCAAAACC III-2A09
70  A06 III C36E8.3 CGTTTACGCTGATGATGGTG    CACACTCACCCACCTGATTG    III-2A11
70  A07 III C36E8.4 AAGCAGCGCTTGATTTTCAT    TCTTCTACCACGGTTGCTCC    III-2A13
70  A08 III C36E8.5 AAGTGAAGACGTGGGAATGG    GGATCCAAATTCTGGGAGGT    III-2A15
70  A09 III T02C12.1    CACCTGATGCTCAACCCTTT    GCGGCTCATGGAGATATTGT    III-2A17
70  A10 III T02C12.2    CCGCTGAGAAGGGAATAGTTTAT AAAACCAATCAGATGAAATCCAA III-2A19
70  A11 III T02C12.3    GTAAATCGACACTTGGCCGT    ATATTCGACCATGCCGAGAC    III-2A21
70  A12 III E03A3.2 TCAGTTGCAACACCTTCTGC    TTTCAGAGATGAGCTCGGGT    III-2A23
70  B01 III E03A3.3 CGCAATCTTTAAGACAGAAAAGC TAAAGTTTACGGAGACACCTCCA III-2C01
70  B02 III E03A3.4 TCAGAAAAATCGGAAAATTGAAA ACGAAATGGGGTTTTATCTAGGA III-2C03
70  B03 III E03A3.5 TTTATTCCAGGACAATGGACATC CACGACATAGACAGAGAGACACG III-2C05
70  B04 III E03A3.6 GCAACTTTCCCGTTTGGATA    GCTCGACGGCTTCATCTAAG    III-2C07
70  B05 III E03A3.7 TTCGAACAACTTCCATCTCAACT TTTCTTCCAATTTCGTTCAAAAA III-2C09
70  B06 III E03A3.8 TACACTTTGCAACATCAACCAAC AATAATGAAACCTCAGCCAGTGA III-2C11
70  B07 III C03C10.1    GAACAGTTGCCGCAAGTACA    GATTTTTGTCGCCAATTCGT    III-2C13
70  B08 III C03C10.2    GTTAAAGTGGCGAAAAACTCAAA AACATTTCAGACATTCCAGCAGT III-2C15
70  B09 III C03C10.3    ATACTCGGAAACCCGCTTCT    GATCAGACCAAGGCTGCTTC    III-2C17
70  B10 III C03C10.4    AGAGCTGTCGGATTCTGCAT    CTGAAAAACTCCCGCCATTA    III-2C19
70  B11 III C03C10.5    TGCTAATTGACAAGTTTCAGGGT AGCACGGTAGTTATTTATGCGAA III-2C21
70  B12 III C03C10.6    AGACCAAGTCCACGAGTGCT    GATTTCAGCACGTGTTGGTG    III-2C23
70  C01 III C03C10.7    TACACTTTGCAACATCAACCAAC AATAATGAAACCTCAGCCAGTGA III-2E01
70  C03 III C30D11.2    TCTCTGTCAAACAAAGCACAAAA GAAGCTCCAGAGATTCAAGAACA III-2E05
70  C04 III C16C10.1    GGCACAGGATGGTGAAACTT    TCGACCATTTCCAAAAGGAG    III-2E07
70  C05 III C16C10.2    TTCGCCTTTTTGACCTTTTG    GCATGGTGACCGAAGTTTTT    III-2E09
70  C06 III C16C10.3    GCGAATAAGGTTACCCTTCAAGT AAAATTGTCTTTTTCAGCACCAA III-2E11
70  C07 III C16C10.4    AACTCGTGTCTCAGGTGACAGTT AAGGAAAACATGATTTACGCAGA III-2E13
70  C08 III C16C10.5    GGCATCCATTAGTGTTGGCT    CGCAAATCTTTCTCCGACAT    III-2E15
70  C09 III C16C10.6    ATTTCCCTTCAGGCGATCTT    GTGTGCAAAAAGCAGCAGAA    III-2E17
70  C10 III C16C10.7    AAATGGAATATTTTCTGGATCGG AAAGTAGGAAAAACGAAAATGGC III-2E19
70  C11 III C16C10.8    AAAATGGATTCATACAACCAACG ATGCACACTTATCCTCATGGAGT III-2E21
70  C12 III C16C10.9    CATCTTCAGAAGTACGCAGGTTT AATTTCCAGAGACTTTCAGGTCC III-2E23
70  D01 III C16C10.10   GAAAAAGGATGCGAAGCAAC    CGCAATACGCATTCTCTGAA    III-2G01
70  D02 III C16C10.11   TTCGAGACTAGTGGAGGCTACAG ATCTATACGGGGGAACTGTGATT III-2G03
70  D03 III C16C10.12   TCAAACATGGTGCATTTCGT    TGAAGCAATTTTGTTCAGCG    III-2G05
70  D04 III R74.1   GTCGGCTGTCTTCTTTCCAG    GGTTTTTACCGGCGATTTTT    III-2G07
70  D05 III R74.2   CGATGGAGATTGACCGATTT    CGTGCATATCGTTTCTGTGG    III-2G09
70  D06 III R74.3   GCAAAAGAGAACGACTGAATCAT AGGAAATGGAGAAATTTGGAGAG III-2G11
70  D07 III R74.4   GAAATGGGAGGAGTTGGTGA    TTGAACCATCCAAGGAGACC    III-2G13
70  D08 III R74.5   CACGTCTCGAATATCCCGTT    GCAGCGACTTGATTTTGTGA    III-2G15
70  D09 III R74.6   TGAATTTTGCCCTTTGTTCC    CCGTAAATCTTGCCCAGTGT    III-2G17
70  D11 III R74.8   GAAGCCGGTAGGTCATTTCA    AAGATACGCAACCGTTTTGG    III-2G21
70  D12 III F43C1.1 CATATCCAAAGCGGGCTAAA    GTCTGCAAAACGATGAACCA    III-2G23
70  E01 III F43C1.2 CAGGATTCTGCCCTCCATTA    GTTCAATTCAGGGGTGAGGA    III-2I01
70  E02 III F43C1.3 TTTCTCAACAACAACAGCGTCTA CAAAAGTTTTTGGATGGAGATTG III-2I03
70  E04 III F43C1.5 CGTACCTTTCTATGTCCTGAACG TAGTCTCGCGACCCTATAAATCA III-2I07
70  E05 III Y44F5A.1    ATGTCTTAAAAATCGCCAAAACA ACAATTGGCTACAGCTGATGAAT III-2I09
70  E06 III T08A11.1    TGCTGAACGAGGTGATTCTG    TCGGTCCTACAAAAAGCCAC    III-2I11
70  E07 III T08A11.2    TCGAACTTTTCTCGCTGGAT    TGATGCTTGATGGTTTTGGA    III-2I13
70  E08 III R10E4.1 GAGTTGCGTGCAAATTCCTT    AGAAGACGTCCATTTGGTGG    III-2I15
70  E09 III R10E4.2 GTGTGTATGTTCGCTTGTTGTGT GCTTCCCAATAACCTTCTGAACT III-2I17
70  E10 III R10E4.3 AGCGTTGTTGCAAGTGACAG    ACGGAAGCGAAGAAGATGAA    III-2I19
70  E11 III R10E4.4 AGATGACGTGGCATTTCTCC    GCATCGTTTTACCGCATTCT    III-2I21
70  E12 III R10E4.5 CTGCTTGACACTTGCTTTGC    TGTAGTTGCCTGGAGACGTG    III-2I23
70  F01 III R10E4.6 GAAGCATTTTCGGATGCAAT    GCAATTTGCATCGCCTACTT    III-2K01
70  F02 III R10E4.7 CGACTGACAAGGTATGTCAACAA TGTCATCTCAATTAGATTCGGGT III-2K03
70  F03 III R10E4.8 AAATGGTAGTCGGTTGGTGC    GCCACGATGACAATCATCAC    III-2K05
70  F04 III R10E4.9 GCAAATGTGATGAGTTACGATGA CGAAAAATCAATGAAAAATCTGC III-2K07
70  F05 III R10E4.11    GTGATGATTGTCATCGTGGC    CGGAGGTTGTTGAGACGAAT    III-2K09
70  F06 III H38K22.1    ACAACCGATTAACATAGCTGGAA TTCAGAATCTGTCATTGCGTATG III-2K11
70  F07 III H38K22.2    CTCTTCAATCAGTATGTCGACCC GAGATAGAGAAATGAGGCAGCAA III-2K13
70  F08 III H38K22.3    TTTCTCTCATTCATCTGCTCCTC CATCGGAATTTTTCAGTAGTTGG III-2K15
70  F09 III H38K22.4    AGTAGGGATGCAATTTGAGATGA GAGAAAATGCCAATTTTTGACTG III-2K17
70  F11 III B0285.1 CAAATTGGCGAGGGAACTTA    TATTCTTCGAGCACGGTGTG    III-2K21
70  F12 III B0285.2 AAAGTTGCAGAATGGATACCTCA TGATTTCGGAGTGATTTCAATTT III-2K23
70  G01 III B0285.3 ATTTTTAAATGTTGCCGGTCTTT TGGAATGAACTACGGGAATAATG III-2M01
70  G02 III B0285.4 TGAAGCTGTAAGCTCCGATAGTC CTGAAACCACACAGTAATGAGCA III-2M03
70  G03 III B0285.5 ATGGTACTTGTTTCACTCAAGCC CGGTTTCCAATCAAATGAAATTA III-2M05
70  G04 III B0285.6 TCAATTCTTGGGTCCTCGAC    CCAATATTTTTGGGCACCAC    III-2M07
70  G05 III B0285.7 GCTCCAAATTGTGAAGAAAACAC ATGGGATGGGAGAAAAAGAAATA III-2M09
70  G06 III B0285.8 CCGTGTACCCCAAATACCAC    CTCTTCTGCCGCTATTCTCG    III-2M11
70  G07 III B0285.9 TGAATGTTTCGCGAGTTCAG    ATAGCATTACGACGGTTGGG    III-2M13
70  G08 III B0285.10    AAAAGATGATCAACGACCGC    CGCATTATGTTCCAGGGTCT    III-2M15
70  G09 III B0284.1 GTGGCAAAGACACTCGTGAA    AAAATCGGACGTGGTAAACG    III-2M17
70  G10 III B0284.2 ATTGAAGATGAAAATCGGCG    ATTCTTCACCGAATGAACCG    III-2M19
70  G11 III B0284.3 GACGGAATAGAGACGACAGAGAA CTCAAATTTTCGTCATCATCCTC III-2M21
70  G12 III B0284.4 GCACGTCGGAAAGAACATTT    AGAAGTTTCCCGGAGGTTGT    III-2M23
70  H01 III R07E5.1 GCGGAAAGATCGATTAGCAG    CACACGGGAGGAGAAGGATA    III-2O01
70  H02 III R07E5.2 ATCTCGTGCTCTTTTGTCACTTC TTCTGTGTGATCACTTGTTGACC III-2O03
70  H03 III R07E5.3 TGTCAAATTTCATTCGGCAA    GACCCCAAGATTCGACTTCA    III-2O05
70  H04 III R07E5.4 CGATCCCTTTCACATTCTATTTG GGAAAACCACAGGCTTAAGAAGT III-2O07
70  H05 III R07E5.5 AATGATGGAAAACGGAATAGGTT ATAGGCACTCTAGTGTTTGGCTG III-2O09
70  H07 III R07E5.7 GCATCTAGCCAGAGGCACTAATA AGTTGAAAGTTCTTCGGTTTTCC III-2O13
70  H08 III R07E5.8 AAAATCAGGTGCCACCAAAG    TGGCAGAAAAGTGGACATGA    III-2O15
70  H09 III R07E5.10    CGAGGAGCTCCACAAAGTTC    CTTCGTTTGCCGTAATCCAT    III-2O17
70  H10 III R07E5.11    GCAAAAATAGGTGTTCGAAGAAA ATTTCAATGGAAAAAGATGCTCA III-2O19
70  H11 III R07E5.12    CTAGTCTTGCTTGTTTTCACGCT TGGTATGAACCTATTCTCCCCTT III-2O21
71  A01 III R07E5.14    GTCTCAATCGCTTGAAGAGAAAA AAACATAAAACGTGGATTGGAGA III-2A02
71  A02 III R07E5.15    CCTAGCAGAATTGGCATATGAAC CAATGATTTTTGGTGGTTTGATT III-2A04
71  A03 III C28A5.1 TTTCTCCCAACTGGAACGAC    CTGGCTTCAACTGTTCGTGA    III-2A06
71  A04 III C28A5.2 GGAACGATTTCGGCAGATTA    CTGGCTTCAACTGTTCGTGA    III-2A08
71  A05 III C28A5.3 TTTGGAAATCTTGGTTTCGG    GGCTCACCTGAGTCAATGGT    III-2A10
71  A06 III C28A5.4 GTATAAAACTGGAGGAATGCACG CACCTTTTTGTCCATTTTCAGAG III-2A12
71  A07 III C28A5.5 CACACAAGATCCAACTTCAACAA AAAGCGTCTCTCAAATATTTCCC III-2A14
71  A08 III C28A5.6 TTCCATCTCTCGTTTCTCAAGTC ATGAATCGGATCACGATAATTTG III-2A16
71  A09 III F56F3.1 ATGGAACCACAGGTTGGTGT    AAACGTGGCTAATCCAATGC    III-2A18
71  A10 III F56F3.2 GAAGCCGTAGCACATCCAAT    GGATTGTTCCACAGGCAGTT    III-2A20
71  A11 III F56F3.3 TTTCCATTTTCCAAGATTTCAGA GAGGGAGAAATGTATACAGCACG III-2A22
71  A12 III F56F3.4 ATTGCCAATTGACCTATCGC    CACTTGGTCTTTCTCTCCGC    III-2A24
71  B01 III F56F3.5 CGGAAAGAACAATAACAAGATGG AAAACGATCTACTTTACCCTCGC III-2C02
71  B02 III F56F3.6 GCGAGGGTAAAGTAGATCGTTTT ATTCGTTCACGTTCACAAGTTTT III-2C04
71  B03 III C07G2.1 GGGATCCGCTGATGAGACTA    ATGGCACTGGGATGAGTAGG    III-2C06
71  B05 III C07G2.3 TTCACGAACAAGTCCAGCAG    AATTTTATGGCTGCAATGCC    III-2C10
71  B06 III F25F2.1 ACGCGTTCCACCAATTCTAC    CGGTAGGTGTCGTCTGAACA    III-2C12
71  B07 III F25F2.2 TCGATGAAATTCGGTTCACA    GTTGGCAGGTTTTCGTCAAT    III-2C14
71  B08 III M88.1   CAGTCAATGGTTTGGCACTG    GTACTCGTGTGGCCGAAGTT    III-2C16
71  B09 III M88.2   CATTAAATCGTGGTTGGAACATT GAAAATTGTGGCATTTTTGTCAT III-2C18
71  B10 III M88.3   AGCAATGGATAAATCAGCCG    GAAACGAGGACGGAAAATCA    III-2C20
71  B11 III M88.4   TAACCGGAAAAGCACCATTC    CAAACGCTGCAACTCGAATA    III-2C22
71  B12 III M88.5   GACCATCGATTGAGGCAGTT    GCTCACGAACATTCTGTCCA    III-2C24
71  C01 III M88.6   TGGGACGTCTCACAATAAGAGAT TCTTCGATGCAAATTTATCGTTT III-2E02
71  C02 III F35G12.1    AAAAAGGTTCGACCGAGTCA    ATTGGAAATTTACCGGGAGG    III-2E04
71  C04 III F35G12.3    TTTCGTGGTGATGAATCTCTTTT AAGACAATGAGAAACAGCTGGAG III-2E08
71  C05 III F35G12.4    GCAGCAAGAAAGGTTTGTCC    TGCTTGACTGTTCGCAAATC    III-2E10
71  C06 III F35G12.5    ATCAGGACTTTGCGCATTCT    TTTCGAGCGATTCTGATGTG    III-2E12
71  C07 III F35G12.6    TAGACACCACCGCCATCATA    TCGTTCTTCTTGTGACACGC    III-2E14
71  C08 III F35G12.7    TGCTCAAATCGTTATTTTGGAAT GACATTTCCCAACAAAAACAAAA III-2E16
71  C09 III F35G12.8    GAAAACATTTGGTTGCCGTT    AAACGGAAGAGTCGAGGGAT    III-2E18
71  C11 III F35G12.10   TTGTTGAATGGCGTTTTGAA    TTCCAGATGTCGTTGAGTCG    III-2E22
71  D01 III F35G12.12   GACGGAACACGTTTCATGTG    TTTTGACGCTGAAGCTTTGA    III-2G02
71  D03 III F10F2.2 AATATGGCAATCATTGGGGA    ACGTAACATCTTTCCGTGGG    III-2G06
71  D04 III F10F2.3 TATACTTGCCTATCATGGATGCC CGTTCATTCCTGAATTTTGAAAC III-2G08
71  D05 III F10F2.4 TTCAAGCAATCAGTTGAGCG    AAACCACCAATGAGTCCTGC    III-2G10
71  D06 III F10F2.5 CAGAAAGGCGAAGCTGTACC    CACTTTGCGGAAACTGTTCA    III-2G12
71  D07 III F10F2.6 GGCAGAGAAGAATCGGAGTG    AAGAGTTGAAATAGCCGCCA    III-2G14
71  D08 III F10F2.7 GCTCAATCAGCTCTTCCCAC    TCCGGTGGATTTTTAGCAAC    III-2G16
71  D09 III F10F2.8 GCTCGATCAGCGTTTCCTAC    GCCGTTCACTTGGTCACTTT    III-2G18
71  D10 III F10F2.9 TCCATTTGTTGCTACTGCCA    TCGTGTAGGTGGAATGACCA    III-2G20
71  D11 III T23F11.1    AATTTTCCGAGGGAAATATGAAA ACCAAAAGCAATGCAAGATAAAA III-2G22
71  D12 III T23F11.2    TCTGTAGGCGCTTCGAAAAT    AATTTAGGCATTGTGCCCTG    III-2G24
71  E01 III T23F11.3    CTTTATTGCGATAGTTCCCCTCT AAACACCAGATTAGCAGGATTGA III-2I02
71  E02 III T23F11.4    CTTTACGTTTTCGAGGTCCG    TTGTCAAGGCTCTGTGATCG    III-2I04
71  E03 III T23F11.5    CAATCAGAAGCAAGTTGCCA    TGTTCAGCAGATTTGATCCG    III-2I06
71  E04 III T04A8.1 CCATTGGCAAGCATTACCTT    GTCACTGTCTGCACTGCCAT    III-2I08
71  E05 III T04A8.2 TCTTTCAAGCTGATCAGAACCTC CGTAGCTTTGAACTCACACAATG III-2I10
71  E06 III T04A8.3 GGCTCCCATGTCGTTACACT    GGCATCGAACAATGAGGTTT    III-2I12
71  E07 III T04A8.4 TACAACTGAGGAGGCTTGAAGAG CAGGAAGTAAGACAGAGGCAAGA III-2I14
71  E08 III T04A8.5 TTGGTTGATGCGAAACAAAA    CGTCAACCGAAAGATACCGT    III-2I16
71  E09 III T04A8.6 AGTGAACTGTTTGGGTTCCG    CACTGCTTTTGTCCCTCACA    III-2I18
71  E10 III T04A8.7 GCATGGAGCAACTCACTTCA    TCCTACGAGAGCTTGGTCGT    III-2I20
71  E11 III T04A8.8 AGGAATGAGTGATTCGGACG    TCGATGCAGTCGTCATCTTC    III-2I22
71  E12 III T04A8.9 TACTTTCAGCTTTGAAATGCTCC CAGCTATCACAGCAGTCACAAAC III-2I24
71  F01 III T04A8.11    AATTATCCCTGATCTCCTTTCCA CACGTTCTTCTTCAGCCTTTTTA III-2K02
71  F02 III T04A8.12    TTTCAATCCCATTCAAGTGAGTT TATTGTAAACTAGGGTGTCGCGT III-2K04
71  F03 III T04A8.13    TTCGAGTATCCTCATTCGCC    GACATTGCTCCACGGATTTT    III-2K06
71  F04 III T04A8.14    CATCCTCTTTGGCTTTGTGATAG GTTACCTGGGGATAAGAAAATCG III-2K08
71  F05 III T04A8.15    GGTCCATACTTCGAAGCCAA    GCACTGTCCCAAAACTCGAT    III-2K10
71  F06 III T04A8.16    GATCCGTGAATTTGCCTTGT    AAACGCAGAGAGCACAGACA    III-2K12
71  F07 III F17C8.1 AATTTTGATCAGCGTTTGGC    AGAAGCAGCTCCCAAATGAA    III-2K14
71  F08 III F17C8.2 TTCAGTTTTCCAGGGTTTGC    TCACTTGCATCATCCCAGAA    III-2K16
71  F09 III F17C8.3 TGGAGCTGTCACTGGTCAAC    TTCTCCGGTTGCTTCTCAGT    III-2K18
71  F11 III F17C8.5 ATGTCGTTGTCTGCCTCTCC    CAGCTTCTCGTCATTGTCCA    III-2K22
71  F12 III F17C8.6 TTGCAACCCGTTTAATCACA    TTCCGATTGTTTTCACACCA    III-2K24
71  G01 III VB0393L.1   TTCTTCCCAAAATGATTGAAAAC ACAAGCCAAATCGACTGTTGTAT III-2M02
71  G02 III B0393.1 GTTGGTTGTTGGTATTCTTGAGC GGTTTTGACAAATTTTACCACGA III-2M04
71  G03 III B0393.2 CCAAATGCATGTTTGTTTCG    AGTTTTTGGTATGGCAAGCG    III-2M06
71  G04 III B0393.3 AGGCTGGACGACTTGAAAGA    TGAATGATGGTCCTTGTGGA    III-2M08
71  G05 III B0393.4 CCACGTCACGACGATATTTG    AAAGCTCAACTGACGCACCT    III-2M10
71  G06 III B0393.5 AAGCCTGCAATTTTTGCACT    TTTCCCAACTGGAGCAAATC    III-2M12
71  G07 III B0393.6 GTGAATGAAGAGCGTGACGA    GTCGAAGCATGATCAACGAA    III-2M14
71  G08 III B0393.7 CACAGTGGTGTTCGTGCTCT    ACTTCTGCCACCTCCTGAAA    III-2M16
71  G09 III C38D4.1 TCATGAGATTTAAGCTAACCGGA AGGGTAAGTGAAATTTTGCCAGT III-2M18
71  G10 III C38D4.2 TGCTCTCTGCTACCACATACTGA TGAAAAATGCAACAATATCATGG III-2M20
71  G11 III C38D4.3 GCCTCAAAACGAATCTCTCG    AGCAAGTGCAGATGACGATG    III-2M22
71  G12 III C38D4.4 CGCGACGTGTACAGTGTTCT    GTAAGCTCGATGATGCGACA    III-2M24
71  H01 III C38D4.5 TCGGACGGACATTTTTCTTC    GGATTTTTGCAAACTTCGGA    III-2O02
71  H02 III C38D4.6 TCCCATTTTAGGCAGTGAGTTTA GTTGCCAGCTCGTTATTTTATTG III-2O04
71  H03 III C38D4.7 GGCGTGGTTGTTTGAAAAGT    GCCACGTTTTTCGTCAGAAT    III-2O06
71  H04 III C38D4.8 AATACACAGCTTTGCCAATTGAT AAAAGATCAATGGGCTTCTTTTC III-2O08
71  H05 III C38D4.9 CACTAAAATTTTGAAAGATGCCG AATATCCACGGCCTTTTGTTTAT III-2O10
71  H06 III F26A1.1 CGATGTGGAGTTTGACGATG    CGAGAATCCCAACCCTGTAA    III-2O12
71  H07 III F26A1.2 CATTATTCGCTCATCGCGTA    TTGCAGCGAGTAATTTGCAG    III-2O14
71  H08 III F26A1.3 AAAGCCCGAACCAAAAGACT    ATGGGAGAACAACGAACCTG    III-2O16
71  H09 III F26A1.4 CAGAGCTTGGGATAAAGTTCGTA CTCGGTCACATTTTCTTTTGTTC III-2O18
71  H10 III F26A1.5 AAAAATTAAATAGCGAACGGAGG TCGAACATCTCTTGTTCTTGTGA III-2O20
71  H11 III F26A1.6 TGAGGGGCAGAAAAAGAAGA    GTTCGAGCATCGTGCAGTTA    III-2O22
71  H12 III F26A1.7 TAAGAGACTTTTTGATCGCTTCG TTTCGTTGGAAACATTTTCAGTT III-2O24
72  A01 III F26A1.8 AGCTTTGGATAGTGCCGAGA    CCATGGCACTTGGATCTTTT    III-2B01
72  A02 III F26A1.9 CAATCACAAACCAGTCCTTCTTC TTATATCCTACGCGATCGTTTGT III-2B03
72  A03 III F26A1.10    AAATGATTCAAATGTGGTGTTCC AAGTTCAAATTCAGCCACTTTCA III-2B05
72  A04 III F26A1.11    ATTTGCTTTCAGGATTGACAAAA CAAGTCTGCAAGAGTTTTCCTGT III-2B07
72  A05 III F26A1.12    GCGAAAATAAATCACGAAAAGTG CATTTCGAATGGAAGAGAACAGT III-2B09
72  A06 III F26A1.13    TTTGGATGGTTTCTTGAGGG    AATCGCACTCCTCTTGCACT    III-2B11
72  A07 III F26A1.14    TTAAAATTACGTGGTGCCAGAGT TGGATTGTGACTTCTACCCAGTT III-2B13
72  A08 III C35D10.1    ATATCAATCGCCATCAAACAATC ATCCTCCAAAGAAGTTAGCCATC III-2B15
72  A09 III C35D10.2    TGGAATCATCGACAAATGGA    AATCGAACTAAGCAGCGGAA    III-2B17
72  A10 III C35D10.3    AAAAATTCATTTCCACAATGACG GCAGTTCTTTTTATCCTGGGTTT III-2B19
72  A11 III C35D10.4    AATTGGGTATGATGGACGGA    TTGGCTTCTGAAAGGAATGG    III-2B21
72  A12 III C35D10.5    GTTTTTCTAGGGCCTGAATGAGT ACGCGTATAAACAATGAGAGGAA III-2B23
72  B01 III C35D10.6    GAACAACATGCCATTGATCG    AGAAACAGACCGCCAGCTTA    III-2D01
72  B02 III C35D10.7    GCTTCAGTGATTGCATCGAA    TGTTCGTTCACAAAACGCTC    III-2D03
72  B03 III C35D10.8    TACTTTTTCGCACGAGTTTTCTC CAGACCGAAACTGTTTAAAATGG III-2D05
72  B04 III C35D10.9    CAATTTTCCCGACAAATGCT    CACAGTTTTCTCTCGTGCCA    III-2D07
72  B05 III C35D10.10   TCTTCTTTCTTCGCTTTCGC    AGCACTGACCGCTTTTCACT    III-2D09
72  B06 III C35D10.11   TTCGACCATGAGCATTAGAATTT ACGTGAGGTCACTGGTACATCTT III-2D11
72  B07 III C35D10.12   ATTTTATGCTTTCCCATTGGTTT TGGTGATCTAGAAGAAAATCCGA III-2D13
72  B08 III C35D10.13   CAGTCGATTTACCAATTGAGAGG ACCTTTCAGAATGACTACTGCCA III-2D15
72  B09 III C35D10.14   ACGGGTTCTTTGATCCACTG    AATCGTGATGTGTGCATCGT    III-2D17
72  B10 III F26F4.1 TCAATTCTACCGGACCAAGG    GACCGAATGGAGAAGGTTGA    III-2D19
72  B11 III F26F4.2 TGCAACGATCTGTTATTTGAATG AAGACAGAAACAACAACGAGAGC III-2D21
72  B12 III F26F4.3 CGATTTTTATGCTTTTGATCACC ACAAATAAAGCTAGAACCCGAGG III-2D23
72  C01 III F26F4.4 AAACGCGAATATGTCGGAAC    GCGAACTCATTCATCCGTTT    III-2F01
72  C02 III F26F4.5 TCCAAGAACTCCTCGCTTGT    CGGTATTCAGAAGTCGAGCC    III-2F03
72  C03 III F26F4.6 ATTTTCCGAAATGAGGGAGTTTA TTTTTCCCCCATTTTTATTGAGT III-2F05
72  C04 III F26F4.7 CCAATTGGATATGGGGTCTG    TTTGGCAGCACTTACGAATG    III-2F07
72  C05 III F26F4.8 TCGTGATATCCAATGTGCGT    CCCGTGACCTTTTGACAACT    III-2F09
72  C06 III F26F4.9 TGGAGAGAGCATTGACATCG    AACGTACTTGGCCACTCGTC    III-2F11
72  C07 III F26F4.10    AGAAACAACAACAAACGGGG    TTGTCAAATCTGACGGTGGA    III-2F13
72  C08 III F26F4.11    AGAAAATTCGGTCTGACAAATCA TTGGTTTTGAAACTGTTCCTTGT III-2F15
72  C09 III C26E6.1 TTTTATTATCGTTTGGGTGAACG TGAGGACATTTCCAGTCAATTTT III-2F17
72  C10 III C26E6.2 CAGCTCATCACCGTCTTCAA    CAGAGCAAGTTTTCCTTCGC    III-2F19
72  C11 III C26E6.3 CTCAAGCTCAACAAACTGCG    AGTGCTAAAGAGGCACGCAT    III-2F21
72  C12 III C26E6.4 GATGGTTAATGACCCGATGG    CGTTTCGCAATGCTCAGATA    III-2F23
72  D01 III C26E6.5 GCCTCAACGCCTATGAAAAG    CATGCGATTTTACCATGACG    III-2H01
72  D02 III C26E6.6 AGAGTGTGCCGAAAAGCAGT    CTGTCTCCGGTTCTTCTTCG    III-2H03
72  D03 III C26E6.7 TTTCATTCTAGACGGGTGCC    AATTTCGGAGTGTTGTTGCC    III-2H05
72  D04 III C26E6.8 AAGAGTTCCACGAAGAGGCA    TTCGACTTTGGGGAGAAGAA    III-2H07
72  D05 III C26E6.9 ATCATCTTTTTGCGGAACTGTAA TCGAAGATTGAAGGTGAAGAGAG III-2H09
72  D06 III C26E6.11    AATTTTACACGAAGTGTATGGCG GTGGCCACTTTCAACTGATAAAC III-2H11
72  D07 III C26E6.12    TGATAGGGAGTTGGCAAAGG    CAGGCCGTATTCACAAGGTT    III-2H13
72  D08 III C27F2.1 ACTCAAACGCGCAGGTATTT    CTATGAGGGGTGTGGCATCT    III-2H15
72  D09 III C27F2.2 CACGTAGGCGTAAGGAATTACAG ATATGTTCCCATTTGCATTTGAC III-2H17
72  D10 III C27F2.3 ATCAAATCGGAATCGTGCTC    ATTGCTCGGCAAACCATAAG    III-2H19
72  D11 III C27F2.4 TTGGATATCCTCCCCACGTA    AAACCAGAGCACACTGGACC    III-2H21
72  D12 III C27F2.5 GCAAGTCAGGGTTTTTGGAG    ACGACGAAGAATTGGAGTGG    III-2H23
72  E01 III C27F2.6 GATGAAATCAGCTTCTCGTCATT AAATTGGAATGTATACGGACACG III-2J01
72  E02 III C27F2.7 TCAGTGACTCCAACAAAGCG    CAAGATCTCATCACGGCTCA    III-2J03
72  E03 III C27F2.8 CTCCAGAAGCTTGTCGAATAAGA TATCTGGAAGGTGATCGTGCTAT III-2J05
72  E04 III R144.1  GCAAAGTCAATTAAAACGAATGC TATTTTGTGGGTGGATTCAAGTC III-2J07
72  E05 III R144.2  GCCAACATCAGTGATAGGATCTC GTCGTAACGAATTTGCAAGAGAC III-2J09
72  E06 III R144.3  GATCGGATTCAAGCAATCGT    TTGGTGCATTTGGAGCAATA    III-2J11
72  E07 III R144.4  TCCACCAGTACCTCCTCCTG    GGGGGATTGACGGACTATTT    III-2J13
72  E08 III R144.5  GAGGATTTTCTCCTCCGACC    CATCTCCCAGGTGTCCAGTT    III-2J15
72  E09 III R144.6  AACTCCCACACAAATCGCTC    TTTCGTGCAATGGATCATGT    III-2J17
72  E10 III R144.7  GATGGTTGGATTTACGGGTG    ATGTTTCTTCAGGGTCGTGG    III-2J19
72  E11 III R144.8  TTATATTGTGCGCCGAGTCTTAT GAATCGGGAGTGGTACACATTTA III-2J21
72  E12 III C45G9.1 TGTAACGAGGCACCACAAAA    AACAAAATCCACTTCGGCTG    III-2J23
72  F01 III C45G9.2 CGAGTTTTACCTTGCTCCCA    CTCATTGAAAACCCGTCGTT    III-2L01
72  F02 III C45G9.4 GTGCAAAGAAGCGAAAGACTAAA AGTTCACAAGCCACTTCATTTGT III-2L03
72  F03 III C45G9.5 AATGACCCAAGAACCGTCAG    TTACATCAAATCCTTCGCCC    III-2L05
72  F05 III C45G9.7 TGAGAGATAATTGAAAAGGGCAA ACAATGAGTCACACCTCATGTTG III-2L09
72  F06 III C45G9.8 TTCTTCGACGACGATCCTTT    TCAAATGTGTTTAGCGAGCG    III-2L11
72  F07 III C45G9.9 ATTGCAACGTGGGAAATTGT    GTTGTTGTGCAAAGAAGCGA    III-2L13
72  F08 III C45G9.10    CTTTCGATTGCGGAATTTGT    CCCCACTAACCCCTTACCAT    III-2L15
72  F09 III C45G9.11    GTTATTGCCCCCAATCAATG    TCCGAAAGTGAAAGAGCCAC    III-2L17
72  F10 III C45G9.12    CCACTGCAGAATTAAGCTTTTTG TGACCAGTTAACACATTGACCTG III-2L19
72  F11 III F54D8.1 ATACGGTAGCGGACCATCTG    ACAAAACATTTTCGTTGGGG    III-2L21
72  F12 III F54D8.2 GCGTTTCTGTGGTTTTACTTCAC TAAACAACTCGAAGCACACACAC III-2L23
72  G01 III F54D8.3 GGGAGTCTGCGGACAGATTA    CAGGGAAAGCGAAAATTCAA    III-2N01
72  G02 III F54D8.4 GAATGGAAGAAGTCGCCAAG    GTTTTTGGAGGTCCCCATTT    III-2N03
72  G03 III F54D8.5 ATTGTACCCATTTCTCCCTTGAT TTGAACCAAACCTTAGCTTTTCA III-2N05
72  G04 III F54D8.6 TCCATTGAGTGGGGAATGTT    TGTCGATCGGCATTATTTGA    III-2N07
72  G05 III F21H11.1    ACTCAATGTTGCACTTTTGGTTT CTGAAGGTTTTACGATTGAGTGG III-2N09
72  G06 III F21H11.2    ATAGTATTCTCCGCCTTCTGGAC AGATCTTATCACAAACCGACGAA III-2N11
72  G07 III F21H11.3    GAAGATCGTTATGGCAGAAACTG TTTCTCGTACAGATTTGTCGGTT III-2N13
72  G08 III F21H11.4    GCTTCAAGTGCTCAAATTCCTAA TGGACACATCTGACGAATATCTG III-2N15
72  G09 III T10F2.1 AACGAGTGCTCGAGAAGAGC    CTGCAGTCAAACAAGACGGA    III-2N17
72  G10 III T10F2.2 CCAGAAGCGAAGCAAGTTCT    ACGTGTATGCTGGACAACCA    III-2N19
72  G11 III T10F2.3 CCAATGCAATCCACTCAATG    GAACGAAGATGCACCTGTGA    III-2N21
72  G12 III T10F2.4 AACACGTCACCAATGAACGA    CGCCTCTCCAAAGAATTGAC    III-2N23
72  H01 III K10D2.1 TAGTTGTGTGGAATGCGGAA    AAGCGAGCAAATTTCTTCCA    III-2P01
72  H02 III K10D2.2 ACAACATCAGATTGCACCGA    ACAACGTCGTGTACGAGCAG    III-2P03
72  H03 III K10D2.3 CGATCGTCTAGAAGCGTTCC    ACTACGTCCCGATGTCGTTC    III-2P05
72  H04 III K10D2.4 CAAATTTCGGGTTGTTTAAGTTG ACCTCGGAAATGAATTCCATAAT III-2P07
72  H05 III K10D2.5 TTTCAATGCGAATTTTGTAGGAT GACACAACTTAAACAACCCGAAA III-2P09
72  H06 III K10D2.6 AAAACTCACCAAGCCCTCCT    AAGGCTGTTGTCGTTGATCC    III-2P11
72  H07 III K10D2.7 ACGATCTCTTCTTTCATTTTCCC GCCCACTAACCCACTTTTCTAGT III-2P13
72  H08 III ZC155.1 ACACGTTTGTTTCCAGAATGACT AATGCAGGTAACATTTTAGGGGT III-2P15
72  H09 III ZC155.2 TTTTCAAACCTTTTTCTCCACAA TTTGTGATACAGTCACGTTTTCG III-2P17
72  H10 III ZC155.3 AAATCATCATTCGAGCCGAC    AACGATCATCATCATTGGCA    III-2P19
72  H11 III ZC155.4 ACGAAGCCATACTTGTTCCG    CTGCTTGGAAAATTGGTGGT    III-2P21
72  H12 III ZC155.5 GCTGACGACGTTTGTGGATA    ATTGCATAAGTCAGGCTGGG    III-2P23
73  A01 III ZC155.6 TCTGAGCAAGCGTACAATATTCA AGGAAAGGTGAAAAATTCAGACC III-2B02
73  A02 III ZC155.7 TCGTTTTACCTATCAATGACGCT ATGAAATTTACGGAACAACGAGA III-2B04
73  A03 III C34E10.1    AATGATGAAGTGGCTCATTTTGT ACCAAATTTTTGGAATGAACTGA III-2B06
73  A04 III C34E10.2    GGGACCAAATGGAGCAATTA    TTCGAGTTCAGCATCCTCCT    III-2B08
73  A05 III C34E10.3    ATCGATAATGTTCCGCAAGC    ACGCAGAAATCGGAGTGAGT    III-2B10
73  A06 III C34E10.4    TGATCCAAACCGAACTCTCC    TTCTGCAATTTCTCGAGCCT    III-2B12
73  A07 III C34E10.5    CGGAGAATCATCCACCTGTT    TCTTCCGTCAGCTCCAAGAT    III-2B14
73  A08 III C34E10.6    GCTGCCACCAAGGTTTGTAT    GATACGGGAGGTGGAGTCAA    III-2B16
73  A09 III C34E10.7    ATAACAGACCCGTAACCAAACAA TGCAAGGTTCCTATTTTAAGCAA III-2B18
73  A10 III C34E10.8    CCGGCTTGTTACATTGCTTT    AACGATGCTCCGAAATAACG    III-2B20
73  A11 III ZC395.1 ACGGAGACATTCAAGTTCACAAT AGACTTCAGTGCTTTCACTACGG III-2B22
73  A12 III ZC395.2 AAAATTCCACTGAAAACGTTGAA AGTGGTCAGTCGGACATTTCTAA III-2B24
73  B01 III ZC395.3 TTTCGTTTTGCTCCCAATTC    AGTTCAACTCTCCACCACGG    III-2D02
73  B02 III ZC395.4 CAGGCACGTGTGTAGTAGTTCAA AAGTAGTTTTCTCGCTGCTTCCT III-2D04
73  B03 III ZC395.5 TCCACCCATTTTTGATTGTTTAG TGCTTCTATCGTTCTCCAAAGTC III-2D06
73  B04 III ZC395.6 CTGAAACCTTACAAAATGCGAAC TGGAACGAATTCTTTAAGACCAA III-2D08
73  B06 III ZC395.8 ACAAGCTGATTTGGAATACTGGA ATTGTTCTTCAACGGAAACGATA III-2D12
73  B07 III ZC395.9 CATACCGCAGTTTTCAGCAA    CGCTTTTTCCGATCAATCAT    III-2D14
73  B08 III ZC395.10    AATTAAGCCGTCAGAATTCACAA GACAATTCTTGCTTGTTATTGCC III-2D16
73  B09 III ZC395.11    CTAACTCTCTCCCTCAAGCCTTC GATTCCTGCAGAATTTAAACACG III-2D18
73  B11 III T15B12.2    TTTACTCCAGCAGCCGATCT    ATGAAGACGGAAGTTCACGG    III-2D22
73  B12 III F52C9.1 CTGATCACATTCGACGATGC    ATCCGGAAAACAGACACCAG    III-2D24
73  C01 III F52C9.3 GATCCCGCTCCACTGAACTA    CGATGGGTACTCTTCGGGTA    III-2F02
73  C02 III F52C9.4 ATTCAAGTTGACCACCTCGG    CCGAATGTAGGGCAGAAAAA    III-2F04
73  C03 III F52C9.5 AGATTCATCGGAGGATGACG    CTTCGCTTCGTTCATTGGTT    III-2F06
73  C04 III F52C9.6 AAGGACACCAAATGTCAGGC    TCCTGGATCGATTTCAAAGG    III-2F08
73  C05 III F52C9.7 GCAACGCGTTTTGAAGTGTA    CTGAGCTCGAATCATGACGA    III-2F10
73  C07 III ZK121.b CACATAAATCGTGGTAGGTGTGA TACTTCAAAAATGGGAGGAGTCA III-2F14
73  C08 III ZK121.c GCATAGAAGAGCATCCAGAAGAA TATCACAATCTACAAGGGGATGG III-2F16
73  C09 III Y32H12A.a   TCGATTGTCGTCTAAAGTGGAAT CCAGCTGAAAATTGTGATCTACC III-2F18
73  C10 III Y32H12A.b   AGTGGAAGTGGTATGTGCCTTTA TCGGTGTCTACGTTTTGAATCTT III-2F20
73  D01 III Y32H12A.e   TGAGAAAGAGAGCAATTCAAAGG CCACGCTGTGTCTCTAGCTATTT III-2H02
73  D02 III Y32H12A.f   CCAAGTTGGTACGAAATTAGCAG TTCAAATATTCTAGGACGCGGTA III-2H04
73  D03 III Y32H12A.g   ATAAATTTGAACGGTTTTCCGAT ACAAGCGTTTGTTAACGGTTTTA III-2H06
73  D04 III Y32H12A.h   AAAATCACTTTAGACGTCGGTCA CATGGGAGTACTCGAACTACTGG III-2H08
73  D05 III W03A5.1 GGAGAAATGCTCCCACAAAA    TCTCCGAAAGAATTGCATCC    III-2H10
73  D06 III W03A5.2 CCTACCCGTCCCTACCGTAT    TTCAGTTGGAGTGTCGCAAG    III-2H12
73  D07 III W03A5.3 GCATTTCAATTTTAAGGCACATC ATTCATACTCCCGTTCTTCCAAT III-2H14
73  D08 III W03A5.4 TTTTTGAACAGGAGAAATTGGAA TAGGCATTTGACGAAATTGATCT III-2H16
73  D09 III W03A5.5 AGAATTTCTCCACTGACCATTCA CGACACCAAAACCTACATCTTTC III-2H18
73  D10 III W03A5.6 GAAAGATGTAGGTTTTGGTGTCG GGAGCGAGAAGCTAGGAGTAAAC III-2H20
73  D11 III W03A5.7 GAAGAAATGCAAGGTTTTTGATG AGAAAATTGCACAAGCTTACGAG III-2H22
73  D12 III T24G10.2    TACCATTCCGAATCCCTTCA    GCAAACACCGTGCACATAAC    III-2H24
73  E02 III F48E8.2 TTGTCGAAAAAGTGCGTCAG    CTCTAGCGATTTTCCGATGC    III-2J04
73  E03 III F48E8.3 TGGGCATTCTGTACCACGTA    TTTGCCGAAAGGATCTTCAG    III-2J06
73  E05 III F48E8.5 TGAACAGCATTCGCAAACTC    GCAAGAGGGATGTGGACAAT    III-2J10
73  E06 III F48E8.6 AAGCTCCAGCTAATGCCAAA    GATCCGCAATGCTCCACTAT    III-2J12
73  E07 III F48E8.7 CATTGGTAGCTGACCGGTTT    TCGTTTTTACGGAATCGGAC    III-2J14
73  E08 III R02F2.1 TGCTGCTGCAAAGAGAGAAA    TTTATGGCCAATTGCAGACA    III-2J16
73  E09 III R02F2.2 CCGATCCAGATTTGAGTGCT    TTCACCCACCTGAAACTTCC    III-2J18
73  E10 III R02F2.3 GAGCAGCACCCTTCAATCTC    CAACCCATCAACTATGGCCT    III-2J20
73  E11 III R02F2.4 CCGGAGGATCTGGTTTATCA    GAATGAGCAATGCGTCTGAA    III-2J22
73  E12 III R02F2.5 ATTAGAAAAAGGAAAGTGTCGGC GTCAATAGAATCCGCATCCATAA III-2J24
73  F01 III R02F2.6 ATTTTGAGCCTACAAGCCTATCC AACATGGATAAGGATCCACAATG III-2L02
73  F02 III R02F2.7 ATTCTTCGCCGATTTCATTG    AATCCACGTGCTCTCAGCTT    III-2L04
73  F03 III R02F2.8 ATTATTTCCTGAGTGCGAATTGA AACTATTTTAGTTGCCGAAAGCC III-2L06
73  F04 III D1044.1 TCTCCCCGATTTTTGTGAAG    TCCAAAATTCCGATAGTCCG    III-2L08
73  F05 III D1044.2 AAATCGACCAAATGGCTCAG    AAGCACTCTTCGCCACAAAT    III-2L10
73  F06 III D1044.3 GTCGATGCACAATGTTTTGG    CTATCCTGCGAAGAACAGGC    III-2L12
73  F07 III D1044.4 CTCCTACTCCTTCCACCAATTCT GAATTTGACAAACATCATGAGCA III-2L14
73  F08 III D1044.5 ATGAGCGTTTGAACAACATACCT AGACCACATCACGTAAAAATGCT III-2L16
73  F09 III D1044.6 GGCACAATTTCCACCAGACT    GCGGAAGTGGTAAAGCAGAG    III-2L18
73  F10 III F09F7.1 AGTTTTGAGCAAAATTGTGGTGT CCACCTGTTCATTTTTATGGGTA III-2L20
73  F11 III F09F7.2 AAATCGTTCTAGACGTGCTCAAG ATGGGTGTAGCACAGATTCAGAT III-2L22
73  F12 III F09F7.3 AACTCGGAGAAAATGGGCTT    TTCGACAATTCCGTCATCAA    III-2L24
73  G01 III F09F7.4 TGATAAGGCGTTCTGTGCTG    AGAATTATTTGGCAATGGCG    III-2N02
73  G02 III F09F7.5 CTCCACCTCCAAAAATCCAA    CCCCCTCTCATTCAGATTCA    III-2N04
73  G03 III F09F7.6 TTCATTTCTTCACAGCACAAAAA GAATACCTTTGTCAGTTTTCCCC III-2N06
73  G04 III F09F7.7 TAGCTCGGCACCGTATTTCT    CGATCACATTCGTCAAATCG    III-2N08
73  G05 III F09F7.8 CCAAAAATGAAACAAACACCATT GTTTCTGGGAGATCGAACTTTTT III-2N10
73  G06 III F56D2.1 TCGCATGGAGAACGTAACAA    GTTCTGGATGTAGCGTGGGT    III-2N12
73  G07 III F56D2.2 GATCATTTTTCCATCCCCCT    ACACGCTTCTCTCCTCCAAA    III-2N14
73  G08 III F56D2.3 ACAATCCCAACACAAGAGCC    TTCGGAAACTCGGATTTGAC    III-2N16
73  G09 III F56D2.4 GAGAGAAAGAGGCCATCTCTAGG TGGTTTTGGAAAGAGAATGAAAA III-2N18
73  G11 III F56D2.6 ACAAAGACAACGCCATCAATAGT TAAGTAAAATTGTTGCTTCCCCA III-2N22
73  G12 III F56D2.7 ACTTTCGATCATACAATTTCGGA TCAAATTCATCATTTTCGGATTC III-2N24
73  H01 III F56D2.8 AATTTTTCAATTTGCCAAACCTT TATAAAAATGCTCAGTTCGCCAT III-2P02
73  H02 III C05D2.1 GCACGACGCTGGTTAGTGTA    ATCCCATAAGATGTCGGTCG    III-2P04
73  H03 III C05D2.3 CCATCAACTTTCCAATGGCT    AGGGACACGGTCTGAAATTG    III-2P06
73  H04 III C05D2.4 GATTACGTCACCAAACCGCT    AAAGGTGGCATTGTGGAAAG    III-2P08
73  H05 III C05D2.5 GGAATCGAGAATACGCGAAA    CGTAGCAGAAGTTGAAGCCC    III-2P10
73  H06 III C05D2.6 TCACCATTCGTTCGTGACAT    TACTGAAGGATCCGGACCAG    III-2P12
73  H07 III C05D2.7 TTGACCCCACATTTGTTAGTAGC ACTGCAATTGCTCATTCTTTAGC III-2P14
73  H08 III C05D2.8 GTGCTGAAGCTAATTTTCCATTG TTCTGGTTATAATATGCGTTGGC III-2P16
73  H09 III C05H8.1 CGTACAATGAGGAGGACAAGAAC TCCCATAGCTTTCACCAGAATTA III-2P18
73  H10 III C05H8.2 TTTTCATATTTTCAGGATGGTGG GAACTTTAAACGGTTGCTCCTTT III-2P20
73  H11 III F54E7.1 CCCCAATGGACAATCTGAAC    AGTGCCTTGCGAAGAGTTGT    III-2P22
73  H12 III F54E7.2 TGAAAAATCTTGCACCTACCAAT TATCCCAACAACTTGTGAATGTG III-2P24
74  A01 III F54E7.3 CTTGTCACTTTCCCACCGAT    CCTCCTTCTTTGAATGCAGC    III-3A01
74  A02 III F54E7.4 TCTTGCAGATAGAAAAGGTCTCG CTTTCATTATTCCCGACTGACTG III-3A03
74  A03 III F54E7.5 GATGAATAAGGGCTCGCTTG    CTCGTGCCTGGGATATCAAT    III-3A05
74  A04 III F54E7.6 TTGCCAAACATTTCCAGTCA    TCAAGATGACTCCCTCGCTT    III-3A07
74  A05 III F54E7.7 GAAGAGACACGTCTACCCGC    AATGGTGGCTGATAACTCGG    III-3A09
74  A06 III B0336.1 GGCAGGACAACAACAAAGGT    AATCCTCGTGGATCACTTCG    III-3A11
74  A07 III B0336.2 TGAGAGAGGAAGAGACACTCCAC GATTCGTAGTCGTTTATTCGTCG III-3A13
74  A08 III B0336.3 AGCTGCACAATATGTTCCCC    ATTCAGAACTTTGCCATCCG    III-3A15
74  A09 III B0336.4 GAAAAGAGACGGAGACGTGC    CTTTTCGATTCGGTCTTCCA    III-3A17
74  A10 III B0336.5 AATTAATGAGGGCGTGGTCA    TGACTCTCTTGGATGGTCCC    III-3A19
74  A11 III B0336.6 ACTGATTCTGGTGGAGGTGG    CGAGTCATGCGAATCTTCAA    III-3A21
74  A12 III B0336.7 TGAGGTCTACATGCAAAATGATG TTCAAGTAGACAATGCTCACGAA III-3A23
74  B01 III B0336.8 CCTCATCGTGATCGATTTTCTTA TTCAAACTTCCGCCATTTTACTA III-3C01
74  B02 III B0336.9 CGAAATATCACCGACTGGCT    GTTGCTTCGTTTGTACGGGT    III-3C03
74  B03 III B0336.10    CCGAACACCATTCTGTTTTATTC GTCTCTTTTCTCTTTTGCGTGAA III-3C05
74  B04 III B0336.11    CATCGATTTACGAGGCCAAT    ACGAGCTCCTTCTTTGTCCA    III-3C07
74  B05 III B0336.12    GCGGATAAATGAATGAGTTTGAG CTAGACAAGAAATACACACGGGC III-3C09
74  B06 III B0244.2 GTTGAGTCATCTGAACGCGA    GATCGTCCGCGATATGACTT    III-3C11
74  B07 III B0244.3 AAACTTCCAGTTCCAACACGTAA CTTATTCGTAATTAAAAGGGGCG III-3C13
74  B08 III B0244.4 CCTTTTGTACCTCGCAACAATAC TGGACTAGTCGGCTAACCATAAA III-3C15
74  B09 III B0244.5 TCATTCGAAATACGAGCCATACT GCAACACCGGCTGATAATAATAC III-3C17
74  B11 III B0244.7 CCAGATTTCGAACCCTTCAA    ACACCATCGAAAAGGCTCAC    III-3C21
74  B12 III B0244.8 TACCGTCCAACCAACACTCA    TTGTCGGTGTATGTGGCATT    III-3C23
74  C01 III B0244.9 CTGTGAATTTCTCCAAGTTGACC GTAGGCAGACAAAGTAGGCAGAA III-3E01
74  C02 III W03A3.1 CGGATATTGTCCTCAGGGAA    GATGTTGGGGAGCTTGTTGT    III-3E03
74  C03 III W03A3.2 CCCATTCCATAGATCAAACCATA CTTGGAATTCCTGAAAACACTTG III-3E05
74  C04 III W03A3.3 CGGTCAGGAAACAACCACTT    CACAGGCCTCAAATCCAAAT    III-3E07
74  C05 III R12B2.1 GACGGAAAGGTGTTCCACAT    AGGCTTTGCTTGTTCGTGTT    III-3E09
74  C06 III R12B2.2 CCAAACAAATGTTTCTTCTCGAC GGACAAAAATATTCACGGAAACA III-3E11
74  C08 III R12B2.4 CAAAAATTGCATATGGGCCT    TCCAATTGCTCCTCCATTTC    III-3E15
74  C09 III R12B2.5 GACATTCCACCCATTGATCC    GACCACCTGGTAGTGGTGCT    III-3E17
74  C10 III R12B2.6 GCGTCTTGATTCACACACAATTA CTCATCTATCGGGTCTTGTAACG III-3E19
74  C11 III W04D12.1    GCGAAACTGTGAAAATTTGATTC GAAAACGGTGAAGAAGAAAAGGT III-3E21
74  C12 III F01F1.1 GAAGTTATGTCAATTCCAGTGCC ATACACCACCCAGTTCCCTATCT III-3E23
74  D01 III F01F1.2 GCTACGCGTGAGAGATAAGAGAC TTGCTCATTTGTCTTCTTCCAAT III-3G01
74  D03 III F01F1.4 GCCAATACCGTCCAAAAAGA    CCCATTGCCATCGTACTTCT    III-3G05
74  D04 III F01F1.5 TTTCAGATTCTCCGACTTCTCAG GCTTTTGCTCCATTCAACATATC III-3G07
74  D05 III F01F1.6 CTCCAGCAAATAACTCCCCTATT AGAACAAAGTTTCCATCCCTCTC III-3G09
74  D06 III F01F1.7 TCCCAATTACGAAGAGGTCG    CGAATGTCCCGCTAAGAGAG    III-3G11
74  D07 III F01F1.8 AAAGTTGGGCTTGTTGAACG    GCACCACGACAGTGATATGG    III-3G13
74  D08 III F01F1.9 GAATGCTGGACGATGGTTCT    GCTCTGAAACCAAGTGCTCC    III-3G15
74  D09 III F01F1.10    TCCAAATTTCCTGGCTTGTC    TTGGAACATTCATCACGGAA    III-3G17
74  D10 III F01F1.11    AAACAATGGCGGATGGTAAG    TGAACACGGCTCATACGAAG    III-3G19
74  D11 III F01F1.12    ACTTCATTTCGGGGTCAGTG    CAATCGGAAAGCGTCTTGAT    III-3G21
74  D12 III F01F1.13    AAGGATAGTCACGTGGATTTGAA CTTTGCCGTCTCTTATCTCTCAC III-3G23
74  E01 III F01F1.14    TGAAACTGAGATTTTCAGGCAGT ACAGTTGTATCTGTGGGTCTCGT III-3I01
74  E02 III C28H8.1 AAACGTTCGATTGTTCGAATTTA GCCTGCTGTATACATTTGGAAAG III-3I03
74  E03 III C28H8.2 TGCTGTTACTGCAGTGAGTTGAT ATGTGCTTTATTTTTGCTTTCCA III-3I05
74  E04 III C28H8.3 CGGAGAAGGCAAGAACTTTG    GAATTTGGGTGCGAAAGAAA    III-3I07
74  E05 III C28H8.4 GCGAAAGGAAAACTCTAAACCAT TCCCAACAATCAAAAAGAAGAAA III-3I09
74  E06 III C28H8.5 ATCCAGGATGCCCTTTCTCT    AAATAACTGCCGTGTGCTCC    III-3I11
74  E07 III C28H8.6 TCTTTTCCAGTTACCACCTTCAA ATGCCAATTCCAACAAAACATAC III-3I13
74  E08 III C28H8.7 AAGTCCTGCCATGAGATGCT    ATTCTCCATGAGCCCACATC    III-3I15
74  E09 III C28H8.8 CATTTCACCTTTGAGTCAAGTCC CTACGAAAATTTGTTCAGAACCG III-3I17
74  E10 III C28H8.9 CAACTCTTGCACTCAAGACACTG AAGAAGAAAACTCGAGCCAAAAG III-3I19
74  E11 III C28H8.11    GTAGATCATCATGGCTCCTTTTG AAACCTGCCAAAATTAGCTTTTC III-3I21
74  F02 III F25B5.1 GGCAAGCAGTATTTTGGCTC    ATCATTCAATCCCTTGTGCC    III-3K03
74  F03 III F25B5.2 ATCACACAATGATTCAGCAGATG TCATTAAGACTTTTCAAGCTCGC III-3K05
74  F04 III F25B5.3 CTGAAGCAGAATGCATCGAA    CCAGCGAGACACGACAGATA    III-3K07
74  F05 III F25B5.4 GGAAAGACTATCACCCTCGAAGT GTTGTAATCGGATAGAGTGCGTC III-3K09
74  F06 III F25B5.5 TGAGTTGCGCTTTCAATGTC    CCAAGACGGCTTTCATGTTT    III-3K11
74  F07 III F25B5.6 CAAGAACATGCAAAACAAGACAG GATTGCACAAATGTTGTTGAGAA III-3K13
74  F09 III T04C9.1 AAGTCGAAGATGAACGAATGAAA CAAAATACCTCATAAATCGAGCG III-3K17
74  F10 III T04C9.2 CATAATCGAGGATGGCTTAGTTG AGGAGAGAAGATGCGAGAAAAGT III-3K19
74  F11 III T04C9.3 TTGGACTAGGTGTAAAGTTCGGA CATTGATCGCTCATTAATTGTCA III-3K21
74  F12 III T04C9.4 AAATGGCTCTGTGATTGAAGAAA TTTTCAAACGAACAATTCCCTTA III-3K23
74  G01 III T04C9.5 GAAAGTTCAGCTATGGGAAGGAT TCAATGAATCCCTCTTTCTCTCA III-3M01
74  G02 III T04C9.6 AACAATACGAGATGGCGGAG    AGAACAATGGCCAAATCCAG    III-3M03
74  G03 III ZK328.1 GTCTTCATCCATCTCCCGAA    CAACGGTCACATTGAATTGC    III-3M05
74  G04 III ZK328.2 GCACTTTTGCCGAAGAAGAC    TCAGCGTACTCGTTTCGATG    III-3M07
74  G05 III ZK328.3 ATTCTGGAGGAAAGCGGAAT    TCATCACCGACTGATCCAAA    III-3M09
74  G06 III ZK328.4 GATGGCTTTGAGGAATTGGA    GAAAATGTTCCTCCGTGTGG    III-3M11
74  G07 III ZK328.5 TGCTGATTGTAGGAGCATGTAGA GTTTGGAATCAACTCTGTCTTGG III-3M13
74  G08 III ZK328.6 TAGGTGGAACACCATCGACA    TATGCCGGACTTGATCCTTC    III-3M15
74  G09 III ZK328.7 TTTCATAAATGCATCGCCAA    CGTGTGTCCTTGCAGCTTTA    III-3M17
74  G10 III F40H6.1 TTCGAATTTGATTGAAAGCAGTT ACACACGGAAGGATTATAGGGTT III-3M19
74  G11 III F40H6.2 CCGTCTCAGTCGACTTCTCC    GTTCATGGAACCCGTTGTCT    III-3M21
74  G12 III F40H6.3 AAAAAGTCTCTCCTTACCCATCG GGAGCCAGAGTGTGTACTTTTTG III-3M23
74  H01 III F40H6.4 AATGGAAACACTGGTGGAGC    GGTTACACTGCCGGATGACT    III-3O01
74  H02 III F40H6.5 ACTTGTGTTTTTCGCTCCGT    ATTTCACCAATCTTCCGCAG    III-3O03
74  H03 III C05D10.1    TCAGCCAACACTTCAACAGC    CGGGTGGTCTGTTTTGAGAT    III-3O05
74  H04 III C05D10.2    TTCACGTGTTCAATGTGGGT    GCACGACTCTTATCTTCGCC    III-3O07
74  H05 III C05D10.3    GCCCAAGTCCGTAGACAAAA    TTCGCAACAATATGCCAAAA    III-3O09
74  H07 III T17E9.1 GTCGCTGGAATTCGTTCAAT    TGGAGCTCTTTGTGATGTGC    III-3O13
74  H08 III T17E9.2 AAGCGGCATAGATGGTCTTG    TCAACTTCGTCTTGCTGGTG    III-3O15
74  H09 III Y42G9A.a    ACAGCCGATTGTGAAGACAGTAT TTGCGTTTATGAATTTTTGTGTG III-3O17
74  H11 III Y42G9A.c    ATGAGACCAGCAGTTTGAAGAAG GTTTGCGTATTTCGCTGTATTTC III-3O21
74  H12 III Y42G9A.d    GGCGACACATCTTCTCATAAAAC CCTTTGTTAATCTTCTTCGGGTT III-3O23
75  A01 III Y42G9A.e    GTGAACGGGAAATTCAAATGTTA TTTTCTTCCTTTTGTCTTCCTCC III-3A02
75  A02 III Y42G9A.f    TCTTCACTGAAAAGCAAAAGGAG GGGCCTACCTACTACGACAATCT III-3A04
75  A03 III F42A10.1    CAACTTCTCTCATGTGCCGA    GTTGGCATGAGTTCCGAGAT    III-3A06
75  A04 III F42A10.2    TTGGTATATCCGCTCAAGGG    TTGATGGCATACCAGGATGA    III-3A08
75  A05 III F42A10.3    CGAAAGAAATTCGTGTTTTGAAC GTCATGTCTACTCTCATCGACCC III-3A10
75  A06 III F42A10.4    TGCTTCGAACACAGTTGGAG    ACTCACCAGGATTGGAGGTG    III-3A12
75  A07 III F42A10.5    GTGGGTCGTTCAAGAATTGG    AGTGACGATTTGAGCGCTTT    III-3A14
75  A08 III F42A10.6    TATGAGTGAGAGCTCTAGCCTGG TTGCGTAAATTATGACGGAAACT III-3A16
75  A09 III F42A10.7    TTTTTGACGTCTATGCGATTTTT ATCACCATTTCACCATTCAAAAC III-3A18
75  A10 III F42A10.8    ACGGGAGTCTGTGATTCCAC    AAACATGTTCTTCCCCGTTG    III-3A20
75  A11 III C23G10.1    CGCAGGTACTGGTGGTTTTT    TGCCGTATTGCGAGTTATCA    III-3A22
75  A12 III C23G10.2    CTCTTTGCAACTTTTAACCCCTT ATTAGAACATCAATGCCACGTTT III-3A24
75  B01 III C23G10.3    AATCAAAACGTGACCAAGAAGAA GTTTATTGAACTGGAGCAACTGG III-3C02
75  B02 III C23G10.4    TTCTTGTGAACACATGGTTTGAG GAAACCCAGTTCAAGTTGTTACG III-3C04
75  B03 III C23G10.5    CTTATCATAATTTTGGCAGTCGC TCGGAATCAACTTTTCTGTGAAT III-3C06
75  B04 III C23G10.6    ACACCACAGCAGCATGGATA    GCTTCCCAAAGTTTGCATGT    III-3C08
75  B05 III C23G10.7    TGACGAACGTCAATTCCGTA    ACAAATCGCCGAATACGAAG    III-3C10
75  B06 III C23G10.8    CCATCCACCAAGTTTGTTCC    TGGAAGTAGCCGGATTATCG    III-3C12
75  B07 III C23G10.9    AGTGTGCTCATTTTTCATCCAGT TTGAAGCGTTGAATACTCAGTCA III-3C14
75  B08 III C23G10.10   ATAGTGGGTCGTGAATCGTCTTA GATTTCAAAATGCCTCACTTCAC III-3C16
75  B09 III C23G10.11   AGGCAACATGAATCTCAACAACT GTCGCTTCTTTTGTCTTTTCTCA III-3C18
75  B10 III T12A2.1 TTTTAACAACCACAACGGCA    GGTTTTGCAAACGTGAAGGT    III-3C20
75  B11 III T12A2.2 GTGCCTGGTATCCACTTGGT    CGAAGTAAACCGCAGACACA    III-3C22
75  B12 III T12A2.3 ACATCGAGCGTTTATGATGAGAT ATAAAGATTCTCACCACTCGCAA III-3C24
75  C01 III T12A2.5 GGCAGATAGGAAGGCAAGTG    GCTCATGCGCATTCAAACTA    III-3E02
75  C02 III T12A2.6 TATTGTCCAGGGGTTCCTGA    AGAATTTTGATGGCTCCGTG    III-3E04
75  C03 III T12A2.7 CAATTTGAGCGCCTTGATTT    TGGTTCCCGTTGAAAACTTC    III-3E06
75  C06 III T12A2.10    GTAGTTGACCGCTGACGAATATC CAAGCTGCATATATGGTACCTCC III-3E12
75  C07 III T12A2.11    TGACTGATACAACTGTCGAATGC ATTATGCTCTTCCAACATCGAAA III-3E14
75  C08 III T12A2.12    TCGAGACACAACTGGAGACG    TTGGATTCCCTGGTGGTAAC    III-3E16
75  C09 III T12A2.13    GATCTTCACTTCCGCCACTC    AAAAATTAGCCACACGGCAG    III-3E18
75  C11 III T12A2.15    ACTCACCCGAATCCTTGTTG    TGTGCCACTAGCTCCTGATG    III-3E22
75  C12 III C18F10.2    CTATTTACCGGACGGAGCAA    CACTCCCTTCGGTCATGTCT    III-3E24
75  D01 III C18F10.4    AACAGTTGACGAAATTGGGC    AATGCCGATAAATGAAACCG    III-3G02
75  D02 III C18F10.5    TTCCATCCTCGACTCGACTATTA ATTCATCAACTGCTCCATTATCG III-3G04
75  D03 III C18F10.6    TTAACACCACTCACCCGACA    TAGGCCCATATTTCAATGCC    III-3G06
75  D04 III C18F10.7    TCTCTCCGCTGCTAAACCAT    GGAGGAAAACGACGATGAAA    III-3G08
75  D05 III C18F10.8    GTTTTGACATTGATCGAAGTTCC GCATAATCCTCATATTGCTCGAC III-3G10
75  D06 III F47D12.1    TGAACCATCTCATGCGTCTC    AGCAAAAGCCGACCTACTGA    III-3G12
75  D07 III F47D12.2    GAATCTGTGAAGGTTTTCCACTG GACTAATTGCGCATTTTTAGGTG III-3G14
75  D08 III F47D12.3    TTCCTACCTACAACTGCTCTTCG AATCCGTGTTGTCTTCTCTGGTA III-3G16
75  D09 III F47D12.4    AACATCTGAAAATCCGTGAAAAA AGGGGTACAAAAATCGAACAAAT III-3G18
75  D10 III F47D12.5    TCATTCCTTGAAATACACAACCC CCTAATCATCTGTGGGAGACATC III-3G20
75  D11 III F47D12.6    GGAAATTGTTGTAGTCTGTTGCC TAATTTCTCCCGCTTAAACTTCC III-3G22
75  D12 III F47D12.7    CCATGACGTCACGATACCAG    TGCAATACGAGAAGTGACCG    III-3G24
75  E01 III F47D12.9    ATGTCCATGCATCTCCATCA    ACGTCATATCCACGAGAGCC    III-3I02
75  E02 III C56G2.1 TCTTCTTTTCCTCCCGGATT    TCCACATACTTTGGCATGGA    III-3I04
75  E03 III C56G2.2 AAACTTTGAAGCCCATTTTTCTC TTCATCTTTTTCACATCTTCGGT III-3I06
75  E04 III C56G2.3 TTGCTATGGTCAAGCACGAG    ACGCTCAGCTTCACCTGTCT    III-3I08
75  E05 III C56G2.4 AGCAACGGTCAGCTCTTTGT    ACTTGGAAAGGGCTTGGTTT    III-3I10
75  E06 III C56G2.5 AGGCTGCTCATTTTTCAGGA    TTCGATGAAACAGCAAATCG    III-3I12
75  E07 III C56G2.6 CCGGTGGTGTCTGAGGTATT    TGCACCTTGCATCTTTTCTG    III-3I14
75  E08 III C56G2.7 ACGAGTCTTGGCAGCATCTT    TAATACTCGCTCGGTCGCTT    III-3I16
75  E10 III C56G2.15    TCTCATGTACTGGTGATCAATCG CAGAAACATAACCAATTATCGGG III-3I20
75  E11 III C16A3.1 AAATTGCTTCAGGAGCGAAA    GATCATTTCCCGCTCAATGT    III-3I22
75  E12 III C16A3.2 TTCTGCGTCTGGATCATAATCTT AGATCAGGGAAAATGGAAGAAAG III-3I24
75  F01 III C16A3.3 GCTTGTACGCAGTGATCCAA    CAATTGGGAAACAAATTGGG    III-3K02
75  F02 III C16A3.4 AGCAACCAAGAAAGAAGCCA    TGGTCAATGATTGTCTCCGA    III-3K04
75  F03 III C16A3.5 CTTTTCTTTTATTCGCCCTCTTC AAATCAATCGCATTACTTCCTCA III-3K06
75  F04 III C16A3.6 ATCCACGTCGTTTATGGGAA    CAATTGGAAGAGGGCGAATA    III-3K08
75  F05 III C16A3.7 ATGTGAAACCATCCGAGAGC    GTTGTTTCAATGGGATTGGG    III-3K10
75  F06 III C16A3.8 TAAAGCTGATGGGGAACCAG    TCCATTGCTTTCACATTCCA    III-3K12
75  F07 III C16A3.9 GGAACAGCCCTTTACTTGAATTT TTTTTCTTCGCTTGCTACATTTC III-3K14
75  F08 III C16A3.10    CAGCATCTGGATCGTGAGAA    GCAGTAAAATTAGCTCGCCG    III-3K16
75  F09 III C05D11.1    TTCCCAGTTCAATCCCTGAC    GAGATTTCACCGCTCTCGAC    III-3K18
75  F10 III C05D11.2    AACTTGCGAGGCTGTTCATT    CATTGTGTGGGATCTTCGTG    III-3K20
75  F11 III C05D11.3    CTCTTATTATGCCGTCTTCCCTT GCGATTACGAAATTGTGAAAAAG III-3K22
75  F12 III C05D11.4    TCCACCTGCTGATGAGTGAG    GATTCGCTGGATTTTGAGGA    III-3K24
75  G01 III C05D11.5    TCTAAAACACCCCCAACTCG    ACGATAAACCACGCCATCTC    III-3M02
75  G02 III C05D11.6    GACAATGGTGAATCACACGC    TGTACCACAAACCGAAACGA    III-3M04
75  G03 III C05D11.7    TGGAGCATCTTCGTCTTCCT    CTGTTCCCCGAATGAAGAAA    III-3M06
75  G04 III C05D11.8    TACGAGACGCTCTCCTCCAT    TCACCATTGAAACCACAGGA    III-3M08
75  G05 III C05D11.9    GAATCGTCACATACGCTGGA    GCAAGCATTGGAGTGCTGTA    III-3M10
75  G06 III C05D11.10   CGACAAACAATAAACAACAACGA ACACACACTTGGCAACAATTTTA III-3M12
75  G07 III C05D11.11   GTGTCAACTCCCTTTGCGTT    GCGTCAGCTTTTGTGTTGAA    III-3M14
75  G08 III C05D11.12   CGCGTAATCAAGAGCAACAA    TCTGTGACTTCAGAATGCGG    III-3M16
75  G09 III C05D11.13   AACTTGCCGTTTTTATTGCG    AAAGTCCACAAAATGCTGGC    III-3M18
75  G10 III T26A5.1 TTTCCAGATGGCACACAAAA    CCCGAAGGTACAAAAGACCA    III-3M20
75  G11 III T26A5.2 TGTAGATTTCGATTTGGCCC    AAGATTGTGGCCGTGTTCTC    III-3M22
75  G12 III T26A5.3 CTCAACTTTGGACCACAGCA    AGGCGGTACTTGGAATCCTT    III-3M24
75  H01 III T26A5.4 AGTGAGTATTGGACACCGGC    TTTGGGAATCCACGAGAAAG    III-3O02
75  H02 III T26A5.5 ACCATGGAAACCGGTGAATA    GGTTTTTGATGATGGGATGG    III-3O04
75  H03 III T26A5.6 GCAATGAAAGCTATGCCCTC    TTCCGTCACCGAGCTCTACT    III-3O06
75  H04 III T26A5.7 GATTTCCACCACCTGGAATG    CTTTACGCATCTCTCTGCCC    III-3O08
75  H05 III T26A5.8 CGGGGTTTTGTACATTCAATAAA TCGAAACTGAACAAGGCAATAAT III-3O10
75  H06 III T26A5.9 AAGGTACACGTAGGATCAGGTCA TGACACATAACTGGGGAACTCTT III-3O12
75  H07 III F23F12.1    TGCCACGTCACTACTTGCTC    GCAAATCCGTGCACCTTTAT    III-3O14
75  H08 III F23F12.2    ATAATTCTTCTCGGTGCTCTTCC CCATATATTGAAAGTTGCGGTTC III-3O16
75  H09 III F23F12.3    TGAGTTAGGCAAATACGGTTTGT GTTTTATCGGTCGTTTGAAGATG III-3O18
75  H10 III F23F12.4    TCTTTTGGACAAATCGGAGG    CGCTGATTGGTTGACGATTA    III-3O20
75  H11 III F23F12.6    TTGGAGGAAATCGGTATTGC    AACCGTCCATTTGATTGAGC    III-3O22
75  H12 III F23F12.7    GAATGTTGCCATCACTCAATTTT CTTTTAAACAACGCACATTTTCC III-3O24
76  A01 III F23F12.8    TACGAAACCTCTCGAACAATCAT TTTCCATTGCAATTTCTTCTTGT III-3B01
76  A02 III F23F12.9    GGAAGTGTTTTCACCTTTTCCTT GAATCAGAAGGTGTTCTCCATTG III-3B03
76  A04 III F23F12.11   TCCTGCAAATGCACCTTTATATT TGTTCGAATACCAAAAAGCAAGT III-3B07
76  A05 III K03F8.1 CGATTAAAGATGTTGGAGGACTG GTTTGCAATCAAATGCCTTCTAC III-3B09
76  A06 III K03F8.2 CAAGAAGTTGGGGCTAACCA    CAGTTCATCAACGACCAACG    III-3B11
76  A07 III F27B3.1 AGTCGTCGTCCATTTTTATCTGA GGAGCTCGAAAGTTTTAAGAAGC III-3B13
76  A08 III F27B3.2 AATTGGCTTTCGATTTGGATATT CGCTTTTGTCTCGCTCTATACAT III-3B15
76  A09 III F27B3.4 TACAGAAGATGTATTGGGTTGGG ACAGTACCTTGACATTATCCCCC III-3B17
76  A10 III F27B3.5 ATTGATTCACCAATTTATGGTCG TGAATCGAACTCCTTTTGTCATT III-3B19
76  A11 III F27B3.6 GTAGAGAGTTGCTGGGGGATAAT CCCAACCCAATACATCTTCTGTA III-3B21
76  B01 III F20H11.2    GTGAAACTTCTGCATTCGCA    TCTTGAGGAAATGGGTGGAG    III-3D01
76  B02 III F20H11.3    CCCTTGGCAATGTTCTTGTT    ATCAGGTCGCTCTTCTTGGA    III-3D03
76  B03 III F20H11.4    CCCAGGAGTGTAGGTTTGGA    TATCGTTTTGTGGGACACCA    III-3D05
76  B04 III F20H11.5    CGCAGGTGGTATGCTGTATG    TTCTTGGATCCGTTGGTCTC    III-3D07
76  B05 III F20H11.6    CAAGTACCTCGATAAATTGGCTG GAATACGGCTGATTCACCTACAC III-3D09
76  B06 III Y40D12A.1   CGACTTCAATACATGCACGG    TTCATGCTTCCTCCAAATCC    III-3D11
76  B07 III Y40D12A.2   TGAATCGTAATCCGTGGACA    TTCATGGTTGGATACTGCGA    III-3D13
76  B08 III Y40D12A.3   CATGCTCGCAGTTCTTGGTA    CGCCCTTAACCGTGTAAAAA    III-3D15
76  B09 III C13B9.1 AAGTGGCTGGAATTGATACTGAA TTTTTGACCAGGGATAGAGTCAA III-3D17
76  B10 III C13B9.2 GAGCTGAATACCATTAGGCAGAA TCGGATACTACGGATATTACGGA III-3D19
76  B11 III C13B9.3 TCAGTGTCGACGAAGATTGC    TCTCGAAGACGGGAAAATTG    III-3D21
76  B12 III C13B9.4 TGCATCTTTCATCAGCTTCG    GTCCTCACACGAACTCAGCA    III-3D23
76  C01 III M01G4.1 TGAGTTTGAAACAAAACAGAGCA GCCGTTTTCACAGTTAGCATTAC III-3F01
76  C02 III F37A4.1 ATGCGATGTTTTTGAGAGGC    ATGTACAAGCGATTGGGGAG    III-3F03
76  C03 III F37A4.3 GCTGCCACATTTTGATTCTTTAC TTAGCGCAGAACGAGAGAATATC III-3F05
76  C04 III F37A4.4 TTGACCAGGGTGAAGAAACC    CCGGATATTCGTCCAGCTAA    III-3F07
76  C05 III F37A4.5 TAAACTTGATCATCCGGACACTT TAGTTCATGTCATTGATTTTGCG III-3F09
76  C06 III F37A4.6 TCCTATAATGATGCTCCGCC    GTTTGACGTGATCGAGCAGA    III-3F11
76  C07 III F37A4.7 GCTCAACTTCAGCAACCACA    GTTGAAGCGCAACATTGCTA    III-3F13
76  C08 III F37A4.8 TTTCTGGGCTTCCGACATAC    AGAATCAAGTTCTGCGCGAT    III-3F15
76  C10 III Y102E9.1    GATCATTCTGCTCGGATGGT    ACGAGGTAGTTGATGGACGG    III-3F19
76  C11 III Y102E9.2    CGTACGTTCAGAATCAGCGA    TCCGAGGACAGCGAAGTAGT    III-3F21
76  C12 III Y102E9.3    TATTCGTAGAGATCTCCCCATCA AGCTGTTTGAAAACAAAATTCCA III-3F23
76  D01 III Y102E9.4    AAATCCTGGAAACAATTTGGAAT TGCGATACCCAAACTTCTACAAT III-3H01
76  D02 III K07E12.1    ATCTATCCAGTCACATCTTCCGA AGTAGGGATCGGTTCTCCATTAG III-3H03
76  D03 III K07E12.2    CAATTACCAAAGTCAGTTGGAGG CCGTTGCATAGAAAGTGAAAATC III-3H05
76  D04 III R05H11.1    CAAACCAACGAGCTGTTTCA    TAAAATAGTGGCCAGGCGTC    III-3H07
76  D05 III F28F5.1 TACCTTCCTTCCCTTCTCAATTC GGTCCGTTCTTTCATTTCTTTCT III-3H09
76  D06 III F28F5.2 ACTATGCATACCAGGAGGCG    CTCTTTTTCCATGCGACGAT    III-3H11
76  D07 III F28F5.3 AAACCCAACTCAACCACTCG    GATCGACTTCGGGAACAAAG    III-3H13
76  D08 III F28F5.4 TCGTTTATTTGCTCTTTTTCCAA CCGTCGTCAATCACACTATACAA III-3H15
76  D09 III R13F6.1 TCGAACGTTCCAACAAATAAAAT AGAAATTGCACATCCTTTTTGAA III-3H17
76  D10 III R13F6.2 AGACCAATCTTGCTCAAAATCAA CTCAGAATGATTTCGCAGTTTTT III-3H19
76  D11 III R13F6.3 TGACGATTGCGTTTCTTGAC    CCACATGGTACGGTAGACCC    III-3H21
76  D12 III R13F6.4 AATTCTGTCCCCACGAAGTG    ACGGAAACGGAACAGTCAAC    III-3H23
76  E01 III R13F6.5 ACTGCAAAATGTTTGGCTGTAAT AAAACCCGAAACGTGAGATAAAT III-3J01
76  E02 III R13F6.6 CTGGAGCAATAACTGGGGAA    CAACGAATGAAAGTCGAGCA    III-3J03
76  E03 III R13F6.7 ATGGGGGTATTGCCAATGTA    TCAACGTGTGCTCTTTCCAG    III-3J05
76  E04 III R13F6.8 GATCGAAGTTGTGGCTGATTTAC TGGAAAATACAGTGAACTTTGGG III-3J07
76  E05 III R13F6.9 TGTGACGTCTTGACGTGGAT    AAACTTCCGGCTTTTCAGGT    III-3J09
76  E06 III R13F6.10    ATCTTTGAAGGCGAGAAGCA    CACTCGAGACTTCAATGCCA    III-3J11
76  E07 III K04C2.2 CAAAAGTTCCATCGTACTCCAAC TTTTGAAAATTCGATTCTCCTCA III-3J13
76  E08 III K04C2.3 GCTAATAAATTCGCCCTTCCTAA ACATTGAAAAACGAAAAGACGAA III-3J15
76  E09 III K04C2.4 CAACGGTGACTACCACATGC    CGCCAAGAAACAACCAAAAT    III-3J17
76  E10 III K04C2.5 CTACACGTGGAAAAGGACAATTC ATTACACCCAGAATCCCGTTACT III-3J19
76  E11 III T07E3.1 CTATTGCCAAACCACCTCGT    TACGGCAGTTTTGTGCTCAG    III-3J21
76  E12 III T07E3.2 GTTCAACAACATGGATCTCCTTC ACACGAGCATCTTTTGTGATTTT III-3J23
76  F01 III T07E3.3 AGAGCAAGCAGAAAGCGAAG    TCGTTGCTAACCTCGGTCTT    III-3L01
76  F02 III T07E3.4 TCTTATTTTCAGCGCATCCC    GACAATTTCGCGTCTGGAAT    III-3L03
76  F03 III T07E3.5 TAAAACGCCGCAAAAATCTC    CGAAGATTTCGAAGCTCCAC    III-3L05
76  F05 III T07E3.7 GGGTGATAATGGCAATACGAATA TCCCTATACATCTTGGAACGAAA III-3L09
76  F06 III F57B9.1 TTCGAGGATGTCAAAACTTCAAT AACCTCGGAAAATGATAGCCTAC III-3L11
76  F07 III F57B9.2 TTGTGAAGACGGCTTGTGAG    GAACACCATGTTCGTGCATC    III-3L13
76  F08 III F57B9.3 TGCACAACTGGTAAAGATGTCAC GATGTTTTGCACTCACACGAATA III-3L15
76  F10 III F57B9.5 CGAAGAGGCACTGGAAAGAC    GAGAGCTCGAAGAAACACGG    III-3L19
76  F11 III F57B9.6 ATCTTTCGACGACATGGAGC    ACGTCCAGAACGTCCGATAC    III-3L21
76  G01 III F57B9.8 CGACTTGTTGACCGAGGTTT    GGTGATGCAGAACGAGACAA    III-3N01
76  G02 III F57B9.9 GCACACCAAAATTCCAAAAATAA AAACATTTATGCGACATTGCTCT III-3N03
76  G03 III F57B9.10    TGGCTCAATAATACGGCACA    TTCCACATCAAAACGACCAA    III-3N05
76  G04 III F31E3.1 TACAATGTCATCCCATGCGT    CACCAGGAAGCATTCCGTAT    III-3N07
76  G05 III F31E3.2 ACCCACACGAAAAGAGTTCG    GGGCGTGAAGAACAGTGAAT    III-3N09
76  G06 III F31E3.3 TTGCTGCCTGCACATCTAAC    ATGGGCAAATTGAAACCGTA    III-3N11
76  G07 III F31E3.4 TCCGTGACAGATTCTTGCTG    TAGTGCCGAATTCCCTATCG    III-3N13
76  G08 III F31E3.5 TTCTTCTTTGGTGCAGCCTT    TGGAGTCAAGCAACTCATCG    III-3N15
76  G10 III C06E8.1 TGCCAAATTTCAACAGTTTTCTT GACCATAATAGCCACGTCATCAT III-3N19
76  G11 III C06E8.2 CCACGAAGAGGCTTAGTACAGAA TGCTGTACAAGTGGAAATGATTG III-3N21
76  G12 III C06E8.3 CTCAACGAGGATATGGGGAA    AACGCGATCTCTCAGCAACT    III-3N23
76  H01 III C06E8.4 TTGGCTATAGTGGACCAGGG    TTCGACAAGGAGATCCCATC    III-3P01
76  H02 III C06E8.5 CATGAATTGATTAGGCCCGT    CCGATTCCTTGATGCTTGAT    III-3P03
76  H03 III F11H8.1 AATCTGACGTTGGAAAATCAAAA AATTGTGGCATGAAACTGCTAAT III-3P05
76  H04 III F11H8.2 ATCCACGATTAGCATGGGAG    TGCTGCGTACTCCAAAAGTG    III-3P07
76  H05 III F11H8.3 GGCCTTGTAGCTACGTCCTG    TTCCGCATGATTTTGAGACA    III-3P09
76  H06 III F11H8.4 CTTGACCAACGACTCCCAAT    TGGTCCCATGAGAAAGTTCC    III-3P11
76  H07 III R01H2.1 TGCAACTTCACTTTAAAAGCACA GCCACGAGGAATTTAGAGGTACT III-3P13
76  H08 III R01H2.2 CACTCACACGCGATTGTACC    TCATTTATCCCCTTTGCCAG    III-3P15
76  H09 III R01H2.3 ACTGCTGGGCAAGTGAAAGT    TTCAAGCTCGTGTCCTTGTG    III-3P17
76  H10 III R01H2.4 CTTTCTTGTCGAAAAACTGGAAA TTGGTAATTGTTACCGGACATTC III-3P19
76  H11 III R01H2.5 AAACAGCATCACGAATTGAAACT GTTGGAAGCGCTATTAAAAAGGT III-3P21
76  H12 III R01H2.6 ATTGAAGTGGATTGAATGATTGG AATTTCATGCTGACAACCTGTTT III-3P23
77  A01 III ZK418.1 CTCGCGGAAACTTGACATTT    ATTGAATCGAGCTGGACCAC    III-3B02
77  A02 III ZK418.2 CCGGAAGTTCCAGAATTGAA    CGAATCAATCAATGTCCACG    III-3B04
77  A03 III ZK418.3 TTAGCAGTCATTGGAGCAATTTT CAACGTTTTTCTTCCACTTTTTG III-3B06
77  A04 III ZK418.4 AATTTTCAATGGCAGAAGAAGTG TTACTTTGGCAAGTATTCGCTGT III-3B08
77  A05 III ZK418.5 GAATAGACAACGACGGTGAGAAT CGTAAATGGTTCTCAATAAAGCG III-3B10
77  A06 III ZK418.6 AGAAGAGCGGTACGCAAAAA    CCGAAGATCAGCTTGACACA    III-3B12
77  A07 III ZK418.7 CTCCCTTCTCCCAATGATGA    AACCGATCCATGCTACTTGC    III-3B14
77  A08 III ZK418.8 AAGCAATTGGAAGAGAGCGA    CATTTGCGAAATGGGAAAGT    III-3B16
77  A09 III ZK418.9 AGTGTTGGACTGGTTACGGC    GCAGCAATTGAAACTGCAAA    III-3B18
77  A11 III B0280.2 CCATTCACGCTAAATACACCTTC TCAATACTTTGTCAAAATCGGCT III-3B22
77  A12 III B0280.3 AGCAGGCGAAGAAACGAGTA    GAACATTGGGAATGAATGGG    III-3B24
77  B01 III B0280.4 CATCTTTGTGCATAAGTCCATCA TAAAAAGGTCATGAATCGGAGAA III-3D02
77  B03 III B0280.6 TTGGATAACAGTATCATTTGGGG TGGATTACTGTAGGTGGCAGTTT III-3D06
77  B05 III B0280.8 ATTGTGGCGAGGACAGTACC    TTGAAGCCAGTGATGAGTGC    III-3D10
77  B06 III B0280.9 CGTCGGTGAATGTATGTTGC    TGAACTCAAGCGAACCACAG    III-3D12
77  B07 III B0280.10    GAAAACAACTTCCGAGAGATGAA ACACTTACCAGCACATTCAGGAT III-3D14
77  B08 III B0280.11    TTTGGAGACGACACATTGGA    AAGACCCTGCGAGAAAGACA    III-3D16
77  B09 III B0280.12    GGTCGAGAGCTTCTCATTCG    TCCGTGGGAGCAAAAATAAG    III-3D18
77  B10 III K04G7.1 CTTCGGAAACTCTACTGGCG    TCCTGCATTATCACCACGAA    III-3D20
77  B11 III K04G7.2 TCTGATGGTGCCTGAGATTTTAT CTCGTCTCATTTTGCCAATTTAC III-3D22
77  B12 III K04G7.3 ACCTGTCCGAGACCATTCTG    TCGACAGCTCTCAAGCTGAA    III-3D24
77  C01 III K04G7.4 TTTTGGCCAGTTTCAATTCC    ACTTGCTGATCAACTCGGCT    III-3F02
77  C03 III K04G7.12    CCTTGATCTGGGTTCTTCTTTCT CTCGATTCTCAGCATTTTCAACT III-3F06
77  C04 III F37C12.1    TACAGGTGATCAACAATGACAGG GGCCTTGAAAAAGATCAGAAAGT III-3F08
77  C05 III F37C12.2    CTCCTGAACCACCGAAGAAG    ATGGCACGAGAATTTGAACC    III-3F10
77  C06 III F37C12.3    GGTTAAAATGTTTGGTCGTCAAG GACAAATGGGACAAAAATGGATA III-3F12
77  C07 III F37C12.4    ACCACGATTTTCCATTTTCTCTT ACGCATTCTTTCAAAGTCAGAAC III-3F14
77  C08 III F37C12.7    ACCCTTGACACTTCACGACC    CTTCTGGTAGGCCATTTGGA    III-3F16
77  C09 III F37C12.8    CCGACAAATTGCGTACCTTT    TGCATAAAAGTGCTTGCCTG    III-3F18
77  C10 III F37C12.9    TCGACTAAACGTTTTTCGGTCTA AAGAGAAAATGGAAAATCGTGGT III-3F20
77  C11 III F37C12.10   TGATCGTGTTCACTAACCAAATG TGAGAAAATATGCAATCCCATTC III-3F22
77  C12 III F37C12.11   GCAATAATTTGCTCGTTCGTATC CCAAAAGACTACTCATGAAACCG III-3F24
77  D01 III F37C12.12   TCCTGGGTGTCCTTAATTCG    ACGCTCGGACATTTGACTTT    III-3H02
77  D02 III F37C12.13   TGTGTGAACGACTCAGGCTC    TCTGGAAGAATTTCGGGATG    III-3H04
77  D03 III F37C12.14   TGTGATTATCAGAATGAGCATGG TTTCTAATGATTTCTCGTGGCAT III-3H06
77  D04 III F37C12.15   ATTTTTGGTTGCCTGTTTCG    TCCATTTCCAGCCCATACAT    III-3H08
77  D05 III F37C12.16   TCCATTTCCAGCCCATACAT    ATTTTTGGTTGCCTGTTTCG    III-3H10
77  D06 III F37C12.17   GCGTATGAGCTGTCGTTTCA    ATACCGTCATGAAAGCTCCG    III-3H12
77  D07 III R151.1  ATTCCATCAGCCTTCAATGG    AAAGTGATCGACGATGGAGG    III-3H14
77  D09 III R151.3  CATGATTCCCATTAAAATTCTGG GACAATCTTTCACCTGAACAACC III-3H18
77  D10 III R151.4  AGGAGCGTTTGGTCAAGTGT    ATTGCCAAGAAAGATGGACG    III-3H20
77  D11 III R151.5  GGGCAATACTGCGAACAAGT    AATACCACCGCTGTCTGTCC    III-3H22
77  D12 III R151.6  ATCTTTGGAACATAGAATTGCGA CAAATTATTGACTTCCTTGGCTG III-3H24
77  E01 III R151.7  AGAACACAACTTCGTCGGCT    TGGACATGGAATGGAGACAA    III-3J02
77  E02 III R151.8  CATCCGTCGCCACTTTTATT    AGTTCTTCTCGACGACGCAT    III-3J04
77  E03 III R151.9  TTCAGAAGTAGATTTCTCGGCAG GTCTGGTGTTGGAGCTAAATGTC III-3J06
77  E04 III T20H4.1 TAGCGGTGTTAAGAATGGGG    CAGGAGCAACACCGTAGTCA    III-3J08
77  E05 III T20H4.2 TCCAGATATTTTCAGCGGTCTTA GCAGACAACATTTTCACTGTTTG III-3J10
77  E06 III T20H4.3 TTTTCCTTTACAGCGATGGG    CTTCCAAACAGAGCGAAAGC    III-3J12
77  E07 III T20H4.4 AGCCCCGCTCATATCCTTAT    TAGCGAATACGTTGTGCCTG    III-3J14
77  E08 III T20H4.5 ATGTTCTCTTCTCATTTCCCACA CCTCCTTTTCTCGTACCTCATTT III-3J16
77  E09 III T21D11.1    TGTAATAAATTGCAAGCCTGGTT ATCTCAGCTGCTTTCATTCAGTC III-3J18
77  E10 III B0361.1 AATCAAAACGAGGTTTCTGTTCA TCTCCAAAGTGTCTCTCCAAAAG III-3J20
77  E11 III B0361.2 TGACGATGATGACGACGATT    CGAAAATTCGGGAACAAAGA    III-3J22
77  E12 III B0361.3 CTTATCACAAAACAAAGGATCGC TTACTCCGTGGTTAGGCATCTTA III-3J24
77  F02 III B0361.5 AACCCCATCAGCAACAAGAC    CGGAGCTTCATATGTTGGGT    III-3L04
77  F03 III B0361.6 ATTCTCCTCAACACGTTCGC    TGGTCAAATTGCAAGAGCAG    III-3L06
77  F04 III B0361.7 TGGATCATCACAACCAGGAA    ATGGCTCAAAAGGCGATATG    III-3L08
77  F05 III B0361.8 TTGCTGGAACTCTTGTGGTG    GACACAAAAACCGTCCGTCT    III-3L10
77  F06 III B0361.9 AAAAACAACTGGAAGCATTTTGA TAGTCTGCGTCTCCTTCTGGTAG III-3L12
77  F07 III B0361.10    ATTTCCAAGAAATACCGAGAAGC ATGTGAAGCTGTTTAAATCGGAA III-3L14
77  F09 III F56C9.2 TGCTCATCGAAAAGTGCAAC    TCTCGAAGCGACCAATCTTT    III-3L18
77  F10 III F56C9.3 ATTCATTCAAAGGATTCCCTCAT AAGTGAAAGGATTCTTAAACGGC III-3L20
77  F11 III F56C9.5 CCATTGATCTCAACAGTCTCTCC TTGACTTTTTGTGCGTATTGATG III-3L22
77  F12 III F56C9.6 GCTCCGTAAAGCTCGATTTG    TCTCTTCGCTACTTCACGCA    III-3L24
77  G01 III F56C9.7 CAGATCAATCGGTTCGATTAAAA TGAAAGGTTGTTAGCCATCAAGT III-3N02
77  G02 III F56C9.8 ATAGGGGGTATGGGGAGAATAAT ATGTTCCTGCGTACACTTTTGAT III-3N04
77  G03 III F56C9.9 TCTCACAATGAAATAGCATGCAC TGTTGGTTTTTAGAGCAGTTGGT III-3N06
77  G04 III F56C9.10    GTTGCATCAGCGGGAATAGT    GTTTGTCCGTTTGGAGGAAA    III-3N08
77  G05 III F08F8.1 TTCTGATTCATCGGATTCTTCAT CAATGTATCGAGTGACAAGGACA III-3N10
77  G06 III F08F8.2 TGAAAATCAAGATCGGGCTC    CTTTTTCCGGAGAGAAGGCT    III-3N12
77  G07 III F08F8.3 AGCCGTGGCACTTTATGAAC    TTGATTGACCCAACTCACCA    III-3N14
77  G08 III F08F8.4 CGGAACTGGAGAAACTGGAG    ATGCTTCCAGCTACCGAAGA    III-3N16
77  G09 III F08F8.5 GATGCTTATCGCATTATGGAGAG TTCAAAAAGCGATCGAAAAATAG III-3N18
77  G10 III T20B12.1    AAAGCTTGAAATGTGGGACG    AGCGGATGCCTGTAAAAATG    III-3N20
77  G11 III T20B12.2    GCGACAAGGAAAAGTTAGCG    GATTGGATAAATCTGCCCGA    III-3N22
77  G12 III T20B12.3    AAACCTTTTCAGGCTGATTTTTC ACGATGAACCAATTCAGAACAGT III-3N24
77  H01 III T20B12.4    TTCCGGCTATCGATTTGAAG    TCGTTTCTTCGCACCTTTTT    III-3P02
77  H02 III T20B12.5    CGTGTCTTGTTTGTTGTGAACAT ATTTCCTAGATTTATGCGAAGGC III-3P04
77  H03 III T20B12.6    ATTGACGGCTTCGTGGTAAC    TCAAATGCAAGTTGCTCAGG    III-3P06
77  H04 III T20B12.7    AAAACCACGTGTCAAGAGGG    TGGTTCAAACCCATACGTGA    III-3P08
77  H05 III T20B12.8    CTCCTCATCGTCCGAATCAT    ACGTGACATGACTGGTCCAA    III-3P10
77  H06 III T20B12.9    CTGCTTGCGAAAAATTGTGA    CGGCAAGGATAACACTTGGT    III-3P12
77  H07 III Y69F12A.a   CTTGGCATTCAAACTACCGTATC GAAAAACATTGACGAAGTTCCTG III-3P14
77  H08 III Y69F12A.b   TTTGGTTTAAGAGGCAATTTGAA TTTTCCTCCTAGTTCCAATGTCA III-3P16
77  H09 III Y69F12A.c   AGTAAGCAACTTTTCCGCTTTTT ATACAATTTTCACGTCCATGTCC III-3P18
77  H10 III H14A12.1    GTTCTGTTATACATGCTCCTGGC TTTTCACCGACTTTTTGACCTTA III-3P20
77  H11 III H14A12.2    CAATCCCAGTTATCCACGCT    GGCTTCACATTGAGTTGGGT    III-3P22
77  H12 III H14A12.3    CCGTGACACAATTCGCTCTA    TGAACATCCGGGGAAATAAA    III-3P24
78  A01 III H14A12.4    CGATCGATGCTATTTTGGCT    AGGAGGCGAAAAACAGGAAT    III-4A01
78  A02 III H14A12.5    TTTCCATAGATAAAACCGGAACA TTCCCTGAGAAACGAAATATTCA III-4A03
78  A03 III H14A12.6    CGGAAACCATCTGGACAAGT    GCGGTAACGGACTTTGTCAT    III-4A05
78  A04 III K07D8.1 CGGAAACCATCTGGACAAGT    GCGGTAACGGACTTTGTCAT    III-4A07
78  A05 III C07H6.1 TGCGAACTCATGTTATGGGA    CACGTTTCAGACGAACAGGA    III-4A09
78  A06 III C07H6.2 AATGAATTTGGATTCTAGGCCAT TATGCTCAATTAGAGCTCTTCGG III-4A11
78  A07 III C07H6.3 TAGGGCCAAAACTCCAAGTG    TCCAAACATCTCGGATCCTC    III-4A13
78  A08 III C07H6.4 AAAAATCGGAAGAACGGGAT    ACCAGCCAACACATGTGAAA    III-4A15
78  A09 III C07H6.5 TGAAGGTAAGTCTCGGCGTT    CGAAGGGAGTCGAGTTTGAG    III-4A17
78  A10 III C07H6.6 ATTCGTTTTGCCCATTTACG    CCCATGTGGTGAACTCCTCT    III-4A19
78  A11 III C07H6.7 ACTGATGCCTTTCTTGTCATCAT CCCCTCATCTTTTCATCTCTTTT III-4A21
78  A12 III R13A5.1 TGGAATGACGACAGAGATGC    TAGATGGGCTTTGATGAGGG    III-4A23
78  B01 III R13A5.3 ATTGGTCAATTGTAACATTTCGG ATAAATTTGGGATAAATTGCGCT III-4C01
78  B02 III R13A5.4 CAAGAAGAGAACACCAGCAACTT TGGGATTTGATTTTTATGTTTCG III-4C03
78  B03 III R13A5.5 AATCAATCTTGAGATGTGCCAGT AATAGATTGGAGACGGATGGATT III-4C05
78  B04 III R13A5.6 GTTCCGAAATCGAAAATCTTCTT TCGAAATGAAAGTCAAGGTTGTT III-4C07
78  B05 III R13A5.7 GATCACAGTTCACATGTCCTTCA GAAACCTCATGTCCAACATCATT III-4C09
78  B06 III R13A5.8 CATTAGCACCTTTGACCAGATTC TGAACCGAACTCTGTTGATTTTT III-4C11
78  B07 III R13A5.9 GGTGATCCTCCAATGTCCTG    TCATTCGAGGTGGAGCTCTT    III-4C13
78  B08 III R13A5.10    CTTCTTTGACCAAAGTTGGAATG TTCTTCATCTCTGGCGTACTCTC III-4C15
78  B09 III R13A5.11    GTCCACTCAATACCCAATAACCA AATCAAAGCAGCAGTTGAGATTC III-4C17
78  B10 III R13A5.12    TTCATCTCGATCAAGGGAATTTA AAACGAGAGAACACAACTTGCAT III-4C19
78  B11 III R13A5.13    TTGCTTCACATTCGCTATGC    CTCCTGTCCCTTCTCGACAG    III-4C21
78  B12 III T04A6.1 TTGTAATCCAGGGAAGAAACTGA GTTCAATTGTTGAAACCTTCGAG III-4C23
78  C01 III T04A6.2 TTCTGGCCAATGTGAGAAACTAT CATCAGTGAGTAAACTGGTGCAG III-4E01
78  C02 III T04A6.3 CGGGGAAACATACGTAAGGA    GTGCTCGTTCCCATACAGGT    III-4E03
78  C03 III ZK783.1 GGAGAGGATGGTGAACCAGA    CCAATCCGAGTTGTGGAGTT    III-4E05
78  C04 III ZK783.2 CCCTTGTTTTTGCGTGTTTT    TTTCAGTTCGTCTGCACTGG    III-4E07
78  C05 III ZK783.3 TTGATGTAGTTGACATCCTCGTG ATCTCCGACTTGTTTTTCTCCTC III-4E09
78  C06 III ZK783.4 TGAACTTTCGTTGTTGCTGC    CACAAAATTGGTTATCGGGG    III-4E11
78  C07 III C18H2.1 TTGTTTCAGCTCCTGCATTG    CCGCGTTTTTGATGAAGTTT    III-4E13
78  C08 III C18H2.2 TTGTGTTTGGACGAATGGAA    CCGCCACAATTCGATAGTTT    III-4E15
78  C09 III C18H2.3 AGTGAGAGCCAAACTGCCAT    CTTTATGCGCACATCGAGAA    III-4E17
78  C10 III C18H2.4 AGGCATTTCGGATTTTCTGA    CCAACGTGTTTCGATTGATG    III-4E19
78  C11 III C03B8.1 GACACGCTTTACCTGTGGTTATC ACAAAATGCCAAGAAATCAAGAA III-4E21
78  C12 III C03B8.2 CCTCTTTAGCGTAAATCCTCCTC TTTAGATTCCGTATTAGGCCCAT III-4E23
78  D03 III ZK112.1 ATGATGTTCGATTTGGCTCC    GTCGGAAAATGCCTCAAAAA    III-4G05
78  D04 III ZK112.2 TCTGATGACCCCATGTGAGA    GAGAGTTGATTCCAACCCCA    III-4G07
78  D05 III ZK112.3 GTCACGGTTGTTGTTATGTCAGA ACGAAAAATCGAAATTTAGAGCC III-4G09
78  D06 III ZK112.4 AGAGAAGCCTCTCATTCTCGATT GTTGAGTGAGCGTTTTCTATGCT III-4G11
78  D07 III ZK112.5 AATCGATTCAAAATTGGGAAGAT AAAATGGAAATGAATCCGAAAAT III-4G13
78  D08 III ZK112.6 GAGATTCGTCCATTCCACAAATA TCCACAAGAAGAATCAAAACGAT III-4G15
78  D09 III ZK112.7 GGCCGTCTGTAGTGGTGATT    TATCGACAAAGCTGCATTCG    III-4G17
78  D10 III ZC97.1  GTCAAAAGAACAATTATGCCAGC TGATAACCCAATTGGTCACTGAT III-4G19
78  D11 III ZK686.1 GATTCTCAAATCGACAATTACGC ATTCGATTCAATTTGCTTTCGTA III-4G21
78  D12 III ZK686.2 TCAAATCCGGATCGTTTAGC    AGAAGCTCGTCAATTGGCAT    III-4G23
78  E01 III ZK686.3 CAGGAAGAAACGTTTAGGCG    ATGTTCACTGCACTTTCCCC    III-4I01
78  E02 III ZK686.4 ATCGGAACTGCTTTGAAGACATA ACATTGCTGATTATTCATTCGCT III-4I03
78  E03 III C08C3.1 AGAGTGAGGGATTACGGTACACA AAAAATCCGAAGGAAGTTTTCAG III-4I05
78  E04 III C08C3.2 GTTGATTTTCGAGATACAAACGG CACACTTTCAAGGATGTTTCACA III-4I07
78  E05 III C08C3.3 TCGCTCCAAAAATTTTATTTCAA TTTTAGTTACGGGACTCATTGGA III-4I09
78  E06 III C08C3.4 GGGGAAACAATAAAACGGTAAAG AGGCATTTGTGTTTCGTCTTAAA III-4I11
78  E07 III C27D11.1    TTCTTGCCAGAGCTCCATCT    CGGAACCGTTTTTGTGATCT    III-4I13
78  E08 III ZK652.1 AAAACCAAAACCCACATCTTTTT CAATTGTTGAGAAGGGTTTGAAG III-4I15
78  E09 III ZK652.2 TGCTCTTCCGCATTTTATCTTAC TGGAAACCAAGAAAATCACAGTT III-4I17
78  E11 III ZK652.4 TCATACACCTAGGAGCGTGTTTT TGTCCATGAATGGATAACAATGA III-4I21
78  E12 III ZK652.5 GCTGCTTTACAAGCCTGTCC    CTTTGAAGCACCGAACCATT    III-4I23
78  F01 III ZK652.6 CGTATACCAAGGCGACCCTA    GTTCCAATGGGGATTGTGTC    III-4K01
78  F02 III ZK652.8 AAATTTGCTGTGAGGATTTTTGA TAAATTTTCAGGTAAACCAGCCA III-4K03
78  F03 III ZK652.9 GTGTCCGCCTTTCGTATGTT    CCGCTGGGAAAGTCTTACTG    III-4K05
78  F04 III C02C2.1 CTTCAGGTCTCTCGAATGCC    GGGAAGGAAAACGACACGTA    III-4K07
78  F05 III C02C2.3 GGTATGGCAGCCGAAGATAA    TTGAGTTGCTGTGGAACTGG    III-4K09
78  F06 III C02C2.4 AGCGAATCCTCTTTCACCAA    TCAGAAAACCCGTTCGATTC    III-4K11
78  F07 III C02C2.5 TGAGATCTGGAACAAGCACG    CGATGGGCAGGAGTAGAAGA    III-4K13
78  F08 III C02C2.6 CGATCAACTGATACACGATCAAA GTGTTCATTCAACAGAAATGCAA III-4K15
78  F09 III ZK688.1 TGCTGCACTTATATTTTGGTGTG ATCATCATCCAACTTCCTGAAAA III-4K17
78  F10 III ZK688.2 ATGGATGAAAGTTGCCGAAG    AGCCTGTCCTGTTTGCAGTT    III-4K19
78  F11 III ZK688.3 ATTATTTCACTCCCTCGCATACA AGATGTAAGTTCATCGTTCAGGG III-4K21
78  F12 III ZK688.4 ATTCGAACGTTGTCAATCAGTTT ACCCATTTGTTTCTTTTCCAAAT III-4K23
78  G01 III ZK688.5 GAGGTCGAAGGGATTCTTCC    CGTTAACGATTCCGGTCACT    III-4M01
78  G02 III ZK688.6 CTCCTTGATCCATTTCTTGATTG GGAATGTTGTCAGCTTGGTTTAG III-4M03
78  G03 III ZK688.7 CTTCCAGTCACTTTCATTCCATC ATGCCTACAGGAAAAAGAAAAGG III-4M05
78  G04 III ZK688.8 TTTCTCCACCCCATACTTGC    CTACCACCAGCAGCTCAACA    III-4M07
78  G05 III C29E4.1 TTCCATCCAACTGACGAACA    CCCTTTGGTCCTTCTTCTCC    III-4M09
78  G06 III C29E4.2 AATCGACGTGTTGAAAGTAAGGA CTCGGGCGATTCTTATTAACTCT III-4M11
78  G07 III C29E4.3 ATTCATCTCCACGGCCATAC    TCCAGTGCCAATCACGAATA    III-4M13
78  G08 III C29E4.4 ATGCAGCAGTCTTCCGAGAT    GTTGAGCAGCAACAACAGGA    III-4M15
78  G09 III C29E4.5 GGACTTGGAATTGGTGCATT    GGCTCGAGAAGTTCGTATGG    III-4M17
78  G10 III C29E4.7 TTAAATCTCCCGAAAACCATCTT CGGAGTAACATCAAAAGCAATTC III-4M19
78  G11 III C29E4.8 TGGGTAAATTTGGCGAAGAC    TGGTATTGCATTGTTCGCAT    III-4M21
78  H01 III F54H12.1    TGCTATGCAAGATGCTACCG    CATTTGCGAGAACCATTCCT    III-4O01
78  H02 III F54H12.2    CATCAACTCCCAACTGGCTT    ACCTCCTGGTGGAGTTTCCT    III-4O03
78  H04 III F54H12.4    TGTTGCGTTTCAAGTTTTGC    AGCAATTGGCTACGCTTGTT    III-4O07
78  H05 III F54H12.5    TTAATTTCACGACCAATGTGATG CTGCAAAAAGATTCATTGGATTC III-4O09
78  H06 III F54H12.6    TGATGCTCAGAGTGTTTCTTTCA TTTAGCATCATTCCTTCGTGTTT III-4O11
78  H08 III C06G4.2 TGAAAAATTTTAGGCGGTGG    TTCTTGGTGGGTTTTTGAGG    III-4O15
78  H12 III F44B9.1 TGGTGATCGTCCTTATGCAA    AATTGATGGAGCCACTGGAC    III-4O23
79  A01 III F44B9.2 CATCTCCAACAACTCCAGCA    TTTGGGCAAAAACTGAAACC    III-4A02
79  A02 III F44B9.3 GATATATTCCAGCGGTCTGAGTG GATCGAGAATCTTCGTTGTATGG III-4A04
79  A04 III F44B9.5 ATTGTCGAATACTCCACGCC    TGCGCCAATCATGTATCAAT    III-4A08
79  A05 III F44B9.6 AGCGTCTTCCATTGCTCTGT    CGTGAACGTCTTCGTTTGAA    III-4A10
79  A06 III F44B9.7 GTTCAGCCGCCAAGTTTTTA    TCAGGGATTCTGGAATCTGG    III-4A12
79  A08 III F44B9.9 ATGAGAAGCTTCACTCTTGATGG ATTGGAAGAAACACGAAATGAGA III-4A16
79  A09 III K12H4.1 GAAGCCGAAGAGACTACAGATGA GGTGATTATGTTTCAAGACGCTC III-4A18
79  A10 III K12H4.2 CTCGAGATGCTTTTGTCAAGAAT AAGGAAAACATTATCGTCTCGGT III-4A20
79  A11 III K12H4.3 GTTGCTTTCACCCTTTGCAT    TCACAGCCAACTGTTTCTCG    III-4A22
79  A12 III K12H4.4 TCTACTGAAGTGTTTCAGCCACA AACAACTTGATCGGAAGATTGAA III-4A24
79  B01 III K12H4.5 CTTTCCATGAGGTCTCTCTCTCA CTTCTCGTTGATTATTTTGGACG III-4C02
79  B02 III K12H4.6 TTCCTAGAGCCAAATGACCATAA AGCCAGACTTCGCAGTTATACAG III-4C04
79  B03 III K12H4.7 CATGGTCCAGCAGTAGCTGA    AAGGAGCCTGGGTCTTTGAT    III-4C06
79  B04 III K12H4.8 GCAACTGGCAAAACTTCACA    GTTATAGCAGCCCTGCCAAG    III-4C08
79  B05 III K06H7.1 AATCGACTTCCCAACATTGC    AACGAAGGGCAATCAAACTG    III-4C10
79  B06 III K06H7.2 ACTCGGTTCCCATGAACATC    CGACCAGAATTTTGCACTGA    III-4C12
79  B07 III K06H7.3 CCAAACAAGGAGGAGTCCAA    CAGTCTCATTTTTGACGCGA    III-4C14
79  B08 III K06H7.4 GGAAGGCACAACTTGTCGAT    CTCTGCTTGAAAAGCCATCC    III-4C16
79  B10 III K06H7.6 ATGACGACAGTTCTGCAACG    TTGTACAGTGTCAGGTCGCC    III-4C20
79  B11 III K06H7.7 TGAGATTCAAGAGGATCCAAAGA TTGGTGAAATTAACAGTCCATCC III-4C22
79  B12 III K06H7.8 CGCTGTGATACCAACATTCG    GGGAGACGTTGGTGAAGAGA    III-4C24
79  C01 III C14B9.1 TCCGATTCACATTTTATTCATCC TTGCATCTTGCCATTTTTCTAAT III-4E02
79  C02 III C14B9.2 CCAGCTGCTAAGAAATTGCC    TCCACACCATGGAGCATAAA    III-4E04
79  C03 III C14B9.3 TAAAGATGGCAGTTGTTGCG    GGGTCCTGTAACGAGTGGAA    III-4E06
79  C04 III C14B9.4 TCAACAACAAGCTGCAGAGG    TGGGACTAAAAGGGTCGATG    III-4E08
79  C05 III C14B9.5 AGAAAACGTTGTTGGGATCG    CTGCGTAAATCGACACATGG    III-4E10
79  C06 III C14B9.6 TGGAATTCGTCTCAAAAGGG    TTGTATTTCATCGGGACGGT    III-4E12
79  C07 III C14B9.7 TGAAGTTAGCAAATCACCCTGTT ACACTTGAAACGAGTGTTACCGT III-4E14
79  C08 III C14B9.8 TCCAAGAAGTGCAGCATCAG    GAGCAAACCATTTGCAGTCA    III-4E16
79  C09 III D2007.1 GAGCGAAACATTTCAGCTACAGT AATTATCGGGAACACTTTCCATT III-4E18
79  C10 III D2007.2 CCATGGATACATCATTGACCTCT TGATTCTGATTGTCATTTGTTGC III-4E20
79  C11 III D2007.3 TGTTATTTTTCCGGGAATACCTT GTCAAAGTACAGCAATGGGGTAG III-4E22
79  C12 III D2007.4 ATCCACGGAACAATGAACTTATG ATCATTCGTCATTTCACCAAAAC III-4E24
79  D01 III D2007.5 ACCGGATTCTGTCATATCGG    ACCACTTGAAGCGTGGATTC    III-4G02
79  D02 III C50C3.1 GGAAAACCAATTGCCGAGTA    TGGAACGATGTCGTCGATAA    III-4G04
79  D03 III C50C3.2 CGTTGTTGAGCAGATCGAGA    AGGTTCGATTGTATCGGCAC    III-4G06
79  D04 III C50C3.5 TTTGCAAGTTGCCAGATTTTATT GTTTTACGATTTAGGAGCCCTGT III-4G08
79  D05 III C50C3.6 AACGACCAAGCCAATTAACG    TTGGTTGAGTGTGCATCCAT    III-4G10
79  D06 III C50C3.7 CTTGCTCAAAACAAGTGGCA    TTACATGGGCAACGACCATA    III-4G12
79  D07 III C50C3.8 TGTATCGGAAAACATGGCAA    TCGCACAATCAGTTCCAGAG    III-4G14
79  D08 III C50C3.9 TTCAAATAATAACCCGTGACAGC TCTTCGGAAAAATGATATGAACG III-4G16
79  D09 III C50C3.10    CATCTGTTCCCTCATGAAAAGAC GAAGCTTTTGAAATCTACGCTCA III-4G18
79  D10 III C50C3.11    AGGTTTGGTGATTTTGCAGG    TTTCCTGGCGCTACTACGTT    III-4G20
79  D11 III C30A5.2 TGCTTTCACACAGGGAACAC    GTACCCGTCATTCCACTGCT    III-4G22
79  D12 III C30A5.3 TTTTTCTTGCGCTCGTTTTT    CCGTTGTTTGTTGTTGTTGC    III-4G24
79  E01 III C30A5.4 CAAAGGAGGAATTTGAGAATGTG AGTTTCCAATCATTCTCTAGCCC III-4I02
79  E02 III C30A5.5 TTACTGCATGAATCATCAACCAC CACAAAGCGTAATGCCAATAAAT III-4I04
79  E03 III C30A5.6 CCGAGATCATGAGATGCTGA    TGCCACGTGGATAATGAAGA    III-4I06
79  E04 III C30A5.7 AATGTGTTCACGAAAACGAAACT TGACCATCTTTCAGGACTTCATT III-4I08
79  E05 III C30A5.9 GAAGAAGCTCTCTGGAAATGACA TGAAATATATATGCAATTGGGGG III-4I10
79  E06 III C02F5.1 GAAGCAGTGAACACGTCCAA    ATTGTAGGCCTGATGCAAGG    III-4I12
79  E07 III C02F5.2 CAAGATGGACAACAAAAAGAAGG GCAGCATAAACTTCGTTAAATGG III-4I14
79  E08 III C02F5.3 AGGTGCCAAAGGAGAAGGAT    GTTGAGCAGCAATTGAACGA    III-4I16
79  E09 III C02F5.4 CCCTTCCTCAATTCAGACGA    CAAAGCTTCAAGTGTTGGCA    III-4I18
79  E10 III C02F5.5 ACTTGACCTTTTCCTTTTTCACC ATGCTCCTTCATGTGATATTGCT III-4I20
79  E12 III C02F5.7 ACGCTTTCACCAGCTCAAGT    AATTGACGACATCCTCTGGC    III-4I24
79  F01 III C02F5.8 CCAGCATTGCAAGACTCAAA    GGCAATAATCTCGGCAGAAG    III-4K02
79  F02 III C02F5.9 GGACGCCGAAATGTAGTCAT    ATTTGAACGCGCAGAAAACT    III-4K04
79  F03 III F09G8.1 GATTGTTCCCTGTTCCTCTTTCT CTTTTCAACGAAAATGGCATAAG III-4K06
79  F04 III F09G8.2 TCGATGATGATGGGAATGAA    TTGGCGGGATATCAAATCAT    III-4K08
79  F05 III F09G8.3 AACCAGAAGGATCCCGATTT    CGACGTTTCCAGATCCATTT    III-4K10
79  F06 III F09G8.4 TTGGTGTCCATGCAACAGAT    CATGCCCCAACTCTCTTTTC    III-4K12
79  F07 III F09G8.5 TGTGTTGGAGAAGGTGGTCA    TCAAAGGGAAAGGATTGTGC    III-4K14
79  F10 III F09G8.8 TCCACAAATGCCACTGTGAT    CGTCCGATTTCTAGACGAGC    III-4K20
79  F11 III F09G8.9 TGCGGGTGAATTATAACACTTCT TCAGAAGCATGGGTCTTGTATTT III-4K22
79  F12 III F10E9.1 GTTCAAAATGCTCATCACCTTTC AACAGGAATGAATAGACAGGCAA III-4K24
79  G01 III F10E9.2 TTCCTCATCCAAGCAAGTCC    ACATCCAGGAGCAGCATCTT    III-4M02
79  G02 III F10E9.3 AAAACCTTCGCCCTGTACCT    TAAAAACGGGGTCAATTTGG    III-4M04
79  G03 III F10E9.4 CGAATATTCACAAAATCCTCAGC AGAAAAGAGAGCCGTAGACGAAT III-4M06
79  G04 III F10E9.5 GAGATCCTGCATTCAATCATTTC CTCGAAAACCAGTGCATAAAAAC III-4M08
79  G05 III F10E9.6 TTTCACGGCTAGAGAGGCAT    CGGTGGAGGTGCTTTCTTAG    III-4M10
79  G06 III F10E9.7 GAGATTCAATACGATGAGCAACC TATTTCCCGAGAGGATTACACAA III-4M12
79  G07 III F10E9.8 AAACTGGTGGCACTGGATTC    ATGAACGATTTAGGCGTTGG    III-4M14
79  G08 III F10E9.9 TTTCAGGGAAATGCTCAATTTTA TCACAGTTGTAGATGGTGTCGTC III-4M16
79  G09 III ZC262.1 ACTCGTTCCCTCTGTAAAAATCC CAGAACTTCAGCCTCCATAAAAA III-4M18
79  G10 III ZC262.2 CAAATGTACGCAAACACCACTTA TTTTATCTTGGCGATTCTTTTCA III-4M20
79  G11 III ZC262.3 AAAATTTTCGCGACCAGATG    CAATTGGCAACATGATCAGC    III-4M22
79  G12 III ZC262.4 AGAGGCAGTGAGATTCTGAAAGA CCACAACTATTTCCACGTCATTT III-4M24
79  H01 III ZC262.5 TTCTCACTTTTTCAAACGCTTTC TGCTAAATCCCCCTATCATTCTT III-4O02
79  H02 III R05D3.1 TGTTCCAGGTTATGCCCAAT    AACTGCCTCTGCCAACTTGT    III-4O04
79  H03 III R05D3.2 CTGTTGCCGTTCTCCGTTAT    ATGCCTCAGACGAAGATGCT    III-4O06
79  H04 III R05D3.3 TTCTCTGAACCCAATCGGTC    TGGCTCACAGACTCGATCAC    III-4O08
79  H05 III R05D3.4 CAAGTAGCCCGAGTGACGAT    CTCGAGATCTTGAAGGCGTC    III-4O10
79  H06 III R05D3.5 ACTCGTTCCCTCTGTAAAAATCC CAGAACTTCAGCCTCCATAAAAA III-4O12
79  H07 III R05D3.6 TTCTCACTTTTTCAAACGCTTTC TGCTAAATCCCCCTATCATTCTT III-4O14
79  H08 III R05D3.7 CTGCTTGTGAACCTTCGTCA    GAAGAATGGAAACGGCGATA    III-4O16
79  H09 III R05D3.8 TCCCTGTGTTCTCTTCATTTTGT GCCTACATCACTTTCGTTGATTC III-4O18
79  H10 III R05D3.9 GCTCCACCTCCTTGCATAAA    CGGAGCGATTCAAAGACTTC    III-4O20
79  H11 III R05D3.10    TTCCCCAATCTCTTCTTGTATCA CGTTGTGGACGTTTATTTAGAGC III-4O22
79  H12 III R05D3.11    CAGAATGTCGCTTCGACAAA    TTTTCCAGCTCCACGGTATC    III-4O24
80  A01 III ZK353.1 AAAGGGCTTTAATAAGCTTCACG TGTATCTCGAAGAATTTGGCAAT III-4B01
80  A02 III ZK353.2 GCAAATGAACGAATAAAGTCCTG TGGAATTATTCACGATTACGAGC III-4B03
80  A03 III ZK353.3 TGAATTTGCAATATGCTGTTCAC TGAAGGTTGAAGATAAGCTACGC III-4B05
80  A04 III ZK353.4 ATGGTGGAATTGACACGGAT    TACTCGGTGCATGGAATTGA    III-4B07
80  A05 III ZK353.5 AACAACAACGTGTGGAGAGAAAT TGGCAGTAGAAGATGATAACGGT III-4B09
80  A06 III ZK353.6 TTTGTCATAGCAGCTCCGTG    TCGGACCTTCTGCAAGTTCT    III-4B11
80  A07 III ZK353.7 TCGGTACAGAAAAATTCTAGCCA ATGACAGAAACAGAATCCCAGAA III-4B13
80  A08 III ZK353.8 TTCATTCGGATTTTCAAGCC    GCTCAATTCGTCAATGGGAT    III-4B15
80  A09 III ZK1236.1    CTACTCGTGGCTGCAAATCA    AGTGGAAGCCTCCAAAGGAT    III-4B17
80  A10 III ZK1236.2    TCAATTTTGGAACATCGCAA    AGGATGTGCGGCAAATAAAC    III-4B19
80  A11 III ZK1236.3    GCGCCTTCATCTTCAGAAAC    GGTACGCCTTGTTGACGATT    III-4B21
80  A12 III ZK1236.4    TGGTGTTGTTATTCCAGCCA    TTTCCAGTCATCATGTGGGA    III-4B23
80  B01 III ZK1236.5    AATTAAAAGATTCGCTCAGTCCC AACAGGCAAAAGAAAACATTTCA III-4D01
80  B02 III ZK1236.6    TCCATAGTGTTGTTGTTGGTGAG ATTCCTCGTTGCTTATCTTGATG III-4D03
80  B03 III ZK1236.7    CCTTCTCGCGCTTCTTCTTA    CATTGACTTTGGGTGTGACG    III-4D05
80  B04 III C30C11.1    GATCATAATAAACTGCGGCTGTC GTTTCAGAATTCCATTTTGCTTG III-4D07
80  B05 III C30C11.2    ACAATGATCTTGCCCGCTAC    GGACAGGGATCTCGATTTGA    III-4D09
80  B07 III C30C11.4    CTAGGGATCACGAAAACGGA    CGAAGTGGTCCCTTCAATGT    III-4D13
80  B08 III F42H10.2    ATAATCTCGAAATGGCTTCAACA ACACTAAGGGGAAAAGCCTACAC III-4D15
80  B09 III F42H10.3    CCACTAACCATTTATTGCAGCTC ATTGAAGCATTTAGGGGAAATGT III-4D17
80  B10 III F42H10.4    ACATTCTTCTTTCCCGCTATTTC TTCTTTCAGCTTTGAGCAAGAAC III-4D19
80  B11 III F42H10.5    ATGTTGGCTCAATCTTTGCC    TTCATGATTGGTGCGACAGT    III-4D21
80  C01 III F42H10.7    CAGGCAACGAATGCTCTGTA    AAATTGAGCGCCAAGTTGTT    III-4F01
80  C02 III F42H10.8    ATTGCTGATTTTGTTGCTGATTT GGAGAAGAAAGTGTTGAATGTGG III-4F03
80  C03 III C04D8.1 GCTCCAGCAGCTGTAAATCC    GATCACGGGAACCGAGTTTA    III-4F05
80  C04 III ZC21.1  CCAAAAATTGACGTGTAGGTCTC TATTGGAACCTCAAAACGAGAAA III-4F07
80  C05 III ZC21.2  CCTCGATTCAATGGGAAGAA    GACCGTACTAACCGACCCAA    III-4F09
80  C06 III ZC21.3  AGGCTATCTTCCCGATTATCAAG TCTACATTGTCGAAAATCTCCGT III-4F11
80  C07 III ZC21.6  TTAGCCGTGTTAGTGGGACC    GGGATGGATTGCACTTTTGT    III-4F13
80  C08 III ZC21.8  GTCAGACGATGAAAAGAACCATC AAGTCAAGAAACACCTGTCCAAA III-4F15
80  C09 III C02D5.1 ATCGCTTTCTTCGTCCTTCA    TCAGATATCCAGCACCTCCC    III-4F17
80  C10 III C02D5.2 TCCTTGCACATTTTGACAGC    CGAGTTGTGAAAGGCACTCA    III-4F19
80  C11 III C02D5.3 ATTACAAAGGACAAGTTCCGACA TCTGCTTCAATCTCTCCAAAAAG III-4F21
80  C12 III C06E1.1 AGTTTCCATTAAAGCTTATCGGC TGTCAAAGTGTCAGTTCCGTAAA III-4F23
80  D01 III C06E1.2 ACTTGATTTTGCCTACGATTTCA AATAAATACTTTTGCGCATCGAA III-4H01
80  D03 III C06E1.4 CTTGCGATTTCCAAAACGAT    GTTCACAAAGGATGGGGAGA    III-4H05
80  D04 III C06E1.5 TATTTTCATAGTTGCGGGAGAAG TGAAATCGTAGGCAAAATCAAGT III-4H07
80  D05 III C06E1.6 AAACCCATTCCCTTGTGTTAGAT GATTAATTCAACATTGCGGTTGT III-4H09
80  D06 III C06E1.7 CGCTTCAAAATCTGGGTCAT    TGTGTTGGTTGTAGGTGCGT    III-4H11
80  D07 III C06E1.8 CCCGCAAACAGGAAGAAATA    CGTTGCTGTAATTGGGCTTT    III-4H13
80  D09 III C06E1.10    GAATTGTGGAATTTGGGTGG    TTATAACCACGCTTCGAGCC    III-4H17
80  D10 III C06E1.11    CCATATCCACCACCAACTCC    TGCTCCAATTTTGACGACTG    III-4H19
80  D11 III C13G5.1 TCATAAACTGGAGTGATGCCTTT GTCCGTGAATATTTCTTTTGTCG III-4H21
80  D12 III C13G5.2 AAAATCGTTCCTAATCCGGG    TAATGCCACCACATCTGCAT    III-4H23
80  E01 III F22B7.1 AAGGAACCTCCCGAAAAAGA    CCTCAATGTCACTTCGCTCA    III-4J01
80  E02 III F22B7.2 TAGTCGTACGATTGAGAGGAAGC ATAACGATTCCCCACACATTACA III-4J03
80  E03 III F22B7.3 GTTCTTGTGAGCTCTTTCATCGT TGTTCGGTAAGTTGTTTCGTTTT III-4J05
80  E04 III F22B7.4 AGGCACACACCTTTTTGAAATTA CAAACGTAGGAAACGACCTACAC III-4J07
80  E05 III F22B7.5 TACGAGGATGGAAAAGGACG    CATGTCATTCGAGGATGTCG    III-4J09
80  E06 III F22B7.6 TTGAGCTTCGCATACACGAC    AGCTGGAATGAATGGACTGG    III-4J11
80  E07 III F22B7.7 CAGACGATGACGTGGAAATG    CAGTGACAAACATTGGACGG    III-4J13
80  E08 III F22B7.8 GAGTCATGGCAAAGAAATCAAAC AAACGTGGCTATACAAAACCAGA III-4J15
80  E10 III F22B7.10    GAGAAATGAGGGCAAGTGGA    AGAACTTCGGCCTGTTGAAA    III-4J19
80  E11 III B0523.1 TCGTGATTGAGAAGAAACTAGGC TAGAACATTTTCAAAGCAACGGT III-4J21
80  E12 III B0523.3 CAAACATTTTTGATAGCCTTTGC AACGAAGAATTAATCGCTCATCA III-4J23
80  F01 III B0523.4 TTCATCGATTTTCTCGGGTC    CGTTTTCGTTTAACAGGGGA    III-4L01
80  F02 III B0523.5 ATTTTCCGCCGAGATTCTTT    GATCCGCTCAGTGGTCAAAT    III-4L03
80  F06 III B0303.5 CTCCTGTAAGACGGCAAGAGATA CACCATAAACATTTTTACGCCAT III-4L11
80  F08 III B0303.8 AGCGTTTCCAATTAACGTTTGTA CGAAGTTAGTCCTCGTGCTAAAA III-4L15
80  F09 III B0303.9 AGTCTGAAAACGAGGGCAGA    CAGCATTCAATGGAGAAGCA    III-4L17
80  F10 III B0303.11    AATCAATCGTCGTCCGACTC    GTGCCACTCCAAAACTAGCC    III-4L19
80  F11 III B0303.12    GCAAAAATGGAGGCGATAAA    TTTTGAAATGTGTCCAGCCA    III-4L21
80  F12 III B0303.14    TCCAAAAGACGACCCTTCAC    ATTTGGCCAACAGGTTCAAG    III-4L23
80  G01 III B0303.15    CTCTGCTTGCCAAGACTATTTGT AAATGCAAACATAAATGAAACGG III-4N01
80  G02 III ZK370.2 TTTTACAGGAGACGAGGATGAGA TTTCTCGGAATAACGAGGTACAA III-4N03
80  G03 III ZK370.3 GGACGGATTCAGTTGGAGAA    ATCAGCTTCTCGTTTTGCGT    III-4N05
80  G04 III ZK370.4 GATCACACAATGGTGGCAAG    GATGTGCCTCTTGTTCCGTT    III-4N07
80  G05 III ZK370.5 AACCCCTCCATACACATTTTTCT TTCTCTTGATTGTCCCACTTTGT III-4N09
80  G06 III ZK370.6 AAATCTGCCAAACTGATCAAAAA CTTCCAAAAATCTAAAATGCCCT III-4N11
80  G07 III ZK370.7 GAACAACACAAATGGTTCCAAGT TGTGCCGAAATTTTGAAATTAGT III-4N13
80  G08 III ZK370.8 TGCGTTCCTCATCCTCTTCT    ACTGGAATCAGCGACCAAAC    III-4N15
80  G09 III ZK370.9 ATTTGAAGACAAAACTTGGACGA AGATCAAGGAACACCAGAAAACA III-4N17
80  G11 III PAR2.1  TTTTGAGCCCGTTTTTATTTGTA AGTTTGAGCGATGATGTAGGTGT III-4N21
80  H01 III PAR2.3  ATTGGAGTCGGTTTGCTACG    AGGTGGCCGATACACAGTTC    III-4P01
80  H02 III PAR2.4  CGTGCACTCTTCTTTCCACA    CGGAGTTGCATTTCCTGATT    III-4P03
80  H03 III K02D10.1    TGCCGCTTCTCTTGATTTTT    ATGAACTCCAGTTGGCATCC    III-4P05
80  H04 III K02D10.2    CTTCCGTCAATCACTATAAACCG GTGTTCCAAAGAAACGATCAAAG III-4P07
80  H05 III K02D10.3    ATAAGTTTCGATTTGGGTTTGGT CGGCATTATAAGCTTTGCTCTTA III-4P09
80  H06 III K02D10.4    CATTTTTCTGCGCCTCAATATAC TGAAAACCGTGAGAAAATGAACT III-4P11
80  H07 III K02D10.5    ATGACTACAGGCCGAGTGCT    GATGCACCAGTTCCCAGAAT    III-4P13
80  H08 III F54F2.1 TTGCCAAGACACCAAATGAA    AAACCGCTTCACAAAATTGG    III-4P15
80  H09 III F54F2.2 CACAATCTCAACCATCCACG    CCTACAAGTGGCATGCGATA    III-4P17
80  H10 III F54F2.3 TTTACATTCCAGAAGTGCGATTT TATCCACCTGGTCTATCAAGCAT III-4P19
80  H11 III F54F2.4 CGGCATTATAAGCTTTGCTCTTA TGCCGGAATACTGTCATCTCTAT III-4P21
80  H12 III F54F2.5 GAAGAGAATCGTTGTGGTGAAAC TTTCAGAAAAGAAATGAGCGAAG III-4P23
81  A01 III F54F2.6 CGAAGAACTCGGAGAGACATAGA TGAAAAGAGACGGAACAAAACAT III-4B02
81  A02 III F54F2.7 TCCGTAAAATTGTGCCTCTCTTA AACTGTTTCCCATCAACTCTTCA III-4B04
81  A03 III F54F2.8 GAAGACCAGACTCATCAATTTGC CTTATTTCCCCCTTTTCTTCTCA III-4B06
81  A04 III F54F2.9 ATTGCTTGAATCTGACCATCACT AAAACTTGCATGGTATGAAGGAA III-4B08
81  A05 III F44E2.2 TTGAAGCAACGCTACAATCG    TCGCATTCACTATGCTCGTC    III-4B10
81  A07 III F44E2.4 ATGGAATAAGTGCTGCCAGAATA TGAGGGCAAAGATAACTTCAAAA III-4B14
81  A08 III F44E2.5 CAGCAGAAGCAAACACCTAAGAT CCACCTGCAGATAGTTTTTGAAC III-4B16
81  A10 III F44E2.7 CATGAAGAATCACGTTTCACGTA GCGTAAAGCAGAAGATTTGAGAA III-4B20
81  A11 III F44E2.8 CATTGGAGAGAGCTTAGGCG    ATGAACAAGAAATCGGTCGG    III-4B22
81  B01 III ZK637.2 ATGTAAACGTTGTATTTGCCACC TTTCAACCCAAACTAGCTTTTCA III-4D02
81  B04 III ZK637.7 ATAAGAATTGCATTCCAGCATGT TTGACCCGAAACTCAAGTCTAAC III-4D08
81  B05 III ZK637.8 GAATCGAATGGAGACAAATGAAG CAAATCCAGCATTACGACTTTTC III-4D10
81  B08 III ZK637.11    GTTCCTTCTCTAATCCCCGC    CCGTTTCTTCCCAGAATCAA    III-4D16
81  B09 III ZK637.12    ACAGTCAAAACGATGGACAATTT GATGGGAAGAAAGATAAAAACGC III-4D18
81  B11 III ZK637.14    TGAAAAGCTAGTTTGGGTTGAAA AAAACTCGTGATGAAAGAATGGA III-4D22
81  B12 III ZK637.15    TTACCTTTCAAAATTCGAAGCAA TAGAACAGATAGAGCAAAACGCC III-4D24
81  C02 III ZK643.2 CACATTGTCGACCGTAGTCAGTA CCAATTCATCACGATTTTCTAGG III-4F04
81  C03 III ZK643.3 CGAGGCTCTTTCAAGAATGC    CCGATCCATTTCAATTTGCT    III-4F06
81  C05 III ZK643.6 GTGGTCAAATTTCGAACAGAATC AGATGTGGCAGTATTTTTGAGGA III-4F10
81  C06 III ZK643.7 TTTTGTCTCATTTTGTGACGTTG GTGGAACACCTGGTTTCTTAGTG III-4F12
81  C07 III R08D7.1 TCAAATCTCGTGCTGATTGC    GCTTCCGGTGATATCGAAAA    III-4F14
81  C08 III R08D7.2 CATTTGTAAGCCCGATTGCT    CTGGAGAAGCGTTGTCCTTC    III-4F16
81  C09 III R08D7.3 AGTAGACCGAACGAGGAGCA    CGTTTGGCCTAAAATTGCAT    III-4F18
81  C10 III R08D7.4 TTCGACAGGCTTGGTTCTCT    AACCACAGAATTTCGCGTTC    III-4F20
81  C11 III R08D7.5 ACTCCAGTGACTCGTGATGAAAT TGAGATTCAGATTCGGGAAAATA III-4F22
81  C12 III R08D7.6 TGGTTTCACACCCAGCTGTA    GTTTCCGGTTTCCCAAAAAT    III-4F24
81  D01 III R08D7.7 CTCGGGGATAATCCTTGTGA    CCACGTTGGCAGAAATAGGT    III-4H02
81  D02 III F59B2.2 CTGACAGCCACTTTGGAACA    GTTCAATGCCGGATGTTTCT    III-4H04
81  D03 III F59B2.3 TCTTGGGCCAAAAATACTCG    TGCATCATCAGAAGGAGCAG    III-4H06
81  D04 III F59B2.5 GGTGGAACTGTCATTCCGAT    AAAGCGATGCGAGGATCTTA    III-4H08
81  D05 III F59B2.6 CTTGAAAACCACTCAGTTTCGAC AAATTTTCGGCAGTTTCTTTTTC III-4H10
81  D06 III F59B2.7 AGGATTCATGATAACGATGTTGG AAATTTTACGCAGAAATGCAGAA III-4H12
81  D07 III F59B2.8 ACCTCTGAATCCATTCCACG    AGGCAGGCAGAAATAAGCAA    III-4H14
81  D08 III F59B2.9 GCTCCTCAACACGTAAAGCC    CCACCAAACGGCTGTCTATT    III-4H16
81  D09 III F59B2.10    TACAATAATCAAAAATCGCCCAC TAAGACTTCGGAACAACAGGAAA III-4H18
81  D10 III F59B2.11    TAACTCGGAAAGAACCCGTG    GTGCCCGCCTAATAATTTGA    III-4H20
81  D11 III F59B2.12    CCCAGGTCAACGTGAAGAAT    TCCAGCATCAACATCAGCTC    III-4H22
81  D12 III F59B2.13    GTGTAACCCAATCCCTGTGG    TTTAAGAACGCGGTGAGCTT    III-4H24
81  E01 III R107.1  AAATAGCATACCCAGCACCG    TTTCTGACACAGCATGCACA    III-4J02
81  E02 III R107.2  GGCTTGGACCAGAAATCAAA    CTGGAATGACGGCAAATTCT    III-4J04
81  E03 III R107.4  ACGTGACTTGTCTGGGGAAC    TGGCACCTGGATCAGTTACA    III-4J06
81  E05 III R107.6  AAATCGTCCTCGAACATTGG    TGATGGGTTTTGACAAACGA    III-4J10
81  E06 III R107.7  GTCCACTTCTCACATTCGATTTC TGTATGGGAAGCAGAGATTCATT III-4J12
81  E07 III R107.8  ACTCACGATGTTGATGGCAA    CCAGAGAGAACCGGACCATA    III-4J14
81  E08 III F02A9.1a    TACAAAAAGCTGCAAGTGAAACA TTAGTGGCGGTCTATAATCCTGA III-4J16
81  E09 III F02A9.2 GCATCAAGTTTTTATTGCGATTC CTGATTCTTCGCAACTGCTCTAT III-4J18
81  E10 III F02A9.3 ACTCTCATGGTTCAACGCACTAT TGTACCCAATTCTTTCAACTGCT III-4J20
81  E11 III F02A9.4 AATTTTGCGCCAAAAATACG    GAATTGGAGCACCGGAAATA    III-4J22
81  E12 III F02A9.5 ACAAGTGGTGGTCCTCCAAG    CCCATTGAACGCTGATTTTT    III-4J24
81  F01 III F02A9.6 ATTGGACCGGAATGGTATGA    TGGGAGGACAAGAAACATCC    III-4L02
81  F02 III ZK507.1 ATCTTGAGGGCTTTTTGTTTTTC TGAGGGCTCAATGTAGACAAAAT III-4L04
81  F04 III ZK507.3 GTTCCTTCATCGAGACATCAAAC TCCTAACTGCTCGGTTCATTTTA III-4L08
81  F06 III ZK507.5 GACAATTTAAAAATGACGGGGAT GCTGTTTTACAGCTTTTTCTCCA III-4L12
81  F07 III ZK507.6 TCAAAGCATTCGTGTGAAGC    CGCCTAGGGACCAATTATCA    III-4L14
81  F08 III ZK512.1 AAGCAAAATATCGTTTGGTCTCA TGCTAAAAATGGGGGTTTAAAAT III-4L16
81  F11 III ZK512.5 AACATGTTCCACAGCCACAA    ACCCATCAAATGAGGAGCTG    III-4L22
81  F12 III ZK512.6 TTTGCTCGAAGCTGGACTTT    CTGGTTTTTCGCAACTAGGC    III-4L24
81  G01 III ZK512.7 ACTACCTTGTGGCTTTCATTCAA CCTTTTGTTCGTTTCTCATCATC III-4N02
81  G02 III ZK512.8 AATAATGTCTCACCGGAACGATA ATTACCCATTACGACTTTCGGTT III-4N04
81  G03 III F54G8.1 GTCTCGAGTCAACAATGCCA    CACAGCATGAGGATGAGGAA    III-4N06
81  G04 III F54G8.2 CACAGTGCCAGTCTCCTTCA    CCACGTACACCCGCTTTAAT    III-4N08
81  G05 III F54G8.3 CACGGGATAGGTCGAGAGTC    TCCAATGAATGGAGCATCAA    III-4N10
81  G06 III F54G8.4 TTAAAAAGTTCGTCGGCGTC    TGCTGGACGTGATCTCTTTG    III-4N12
81  G07 III F54G8.5 GAATTCCGAGCCCAACTACA    ACTTTTTGCGGACTACGGTG    III-4N14
81  G08 III ZC84.1  ATCCACCAACTGCCTTCAAC    TGCTGTGGAGCAACTGATTC    III-4N16
81  G10 III ZC84.3  CACATTAACTTTCTCCATGAGCC AATGTTGCTCTTCTTCAGTTTCG III-4N20
81  G11 III ZC84.4  CCAGATGCGATTAGCAAACA    TTGTGATCAATGCCTGGGTA    III-4N22
81  G12 III ZC84.5  GTAGATTGGAAGATGAAATCCCC AAAATCAACTGGGCTACATACGA III-4N24
81  H01 III ZC84.6  GCTGTTCCTTGCTTTTCGAC    GAGACAAACGGCAAACTGGT    III-4P02
81  H02 III T23G5.1 GCCATGGCTCCAGGTAAATA    AATTCTCTCCGCTCCTCCAT    III-4P04
81  H03 III T23G5.2 CTGGCACCTTCTTGCTCTTC    ATATCTTACGCGCATGGGTC    III-4P06
81  H04 III T23G5.3 ACCCCGAAAATAAAAGCTGTAAA CGACCGTGATTCTTCAGTATTTC III-4P08
81  H05 III T23G5.5 AAGCAAATGCACCGAACTCT    AGCTCCAGCAAAACTTCCAA    III-4P10
81  H06 III T23G5.6 AAAATGTTCGAACGGCAAAC    TAGGTGAGGGAAGTGCTGCT    III-4P12
81  H07 III T02C1.1 CCCTGGCTAAAACTTGGTAACTT AATCATTCAACGCAAGTCTGATT III-4P14
81  H08 III M01A8.1 CAAAAAGGCTTCATATTCGTTTG CCTGTATGTCTGTACAACGACGA III-4P16
81  H10 III K01B6.1 TACGCAGAGAACATTGCCAG    GTAGCTCGAAATAGCAGCCG    III-4P20
81  H11 III K01B6.2 TGTTGTGAATCGACTTCTTCTGA TTGGTTTTTCTTGGTTTCTCGTA III-4P22
81  H12 III K01B6.3 AGATAACCTTTCTCCGCCTAATG TTGAAACTTTAACCTTCTTCCCC III-4P24
82  A01 III C40H1.1 GCGCTGTAACGGGATATGTT    GAGGGAGTGGCAGAAAACTG    III-5A01
82  A02 III C40H1.2 GCGCTGATTTGAAACATTAAAAC ATTACGGCAATCATGGTAAATTG III-5A03
82  A03 III C40H1.3 ACTTTTGATGGTTCCGTTGG    TTAGCTCCAAGCATCGTCCT    III-5A05
82  A04 III C40H1.4 GCAAATGTGACATAGATGACGAA TTCTGGAATGATCTCAACACCTT III-5A07
82  A05 III C40H1.5 CCACACTTTTCTGTCAAGCTTTT GTGTTTTCGAGGATTGCAGTATC III-5A09
82  A07 III K04H4.1 TTTTCCATTGGTCCAACGAT    AGGGAGATTTGGGAGATGCT    III-5A13
82  A08 III K04H4.2 CAGCAGTTAACTTGGTTGGAATC TCACTGATCCTAAGAACCCAAAA III-5A15
82  A09 III K04H4.5 GAATTCACAAACGGCTGGAT    GGCACGATGTGCCTAAAGTT    III-5A17
82  A10 III K04H4.6 ATGCCACAAGGAATGGATGT    ATGGAATTGGTGGCTTTGAG    III-5A19
82  A11 III C38C10.1    CTGAATCGAAAACTCTGGGG    CCTTTCGTTGGCAAAACAAT    III-5A21
82  A12 III C38C10.2    TGTGTCAGCAAGGACTCCAC    TGACACCTGTGGAGAGCAAC    III-5A23
82  B01 III C38C10.3    TGCTGAAAATCTTACTCTCCCTG CACTGGAATCTCCGACATCTTAC III-5C01
82  B02 III C38C10.4    GAGCCTTGTCGTAATAGGCG    GATCCGCGTGAAATTTTTGT    III-5C03
82  B04 III T26G10.1    ACAATTGCACTATTTCCGGC    TTGCGTGCATCTCGTAAATC    III-5C07
82  B05 III T26G10.3    AACATACGATGTTTCAATGACCC GTCTCGGCGATACAGAAAATATG III-5C09
82  B06 III T26G10.4    CAAAAACTCGACTGCGTGAA    TACCAACTCCTTTCCATCGC    III-5C11
82  B07 III T26G10.5    ATGATCTTTGTGAGAAAGCTTCG GTCATCTCCCAAATCAGTGCTAC III-5C13
82  B08 III F54C8.1 TGCCAATTCGATAGCTCCTT    CCACTGGAATTGTGTTCGTG    III-5C15
82  B09 III F54C8.2 TTTCAAAGTGCGAAAATTTGATT TTTAATCAGAGATTTGGAAGGCA III-5C17
82  B10 III F54C8.3 GCAACAGTGCTCCACTTTCA    GATTCCACGAAAAGTTCCGA    III-5C19
82  B11 III F54C8.4 AACGAAGCACTGCCTCCTAA    CGGAACGTGGTCAGTACCTT    III-5C21
82  B12 III F54C8.5 CAACTGATACTACACGGCTTTCC CGTCTCTTATTTTCACACGCTCT III-5C23
82  C01 III F54C8.6 CATGCCAAATTGCAGTGAAC    CCATGGTTCTCGTTCCAACT    III-5E01
82  C02 III F54C8.7 AGCGAGTGCTGATTGGAGTT    AGCTTGCCCCTCCTCTCTAC    III-5E03
82  C03 III B0464.1 AGCCATGATCTCCACGAATC    GACGCGCATACACACTTCAT    III-5E05
82  C05 III B0464.3 TTTTGCCACGTTTAGGCTTATTA AACCGTGAGAAGGTGATACAAGA III-5E09
82  C06 III B0464.4 CAGCAATTTTCGACGAGTGA    GATCCGTTCCAGAAAGTCCA    III-5E11
82  C08 III B0464.6 CGTCTTCATCCTCTTCCTCG    AAACCGGTCAGCATTTGAAG    III-5E15
82  C09 III B0464.7 TCACCATGTCCGACGATAAA    ATCTGCAAGATTTTGTGGGC    III-5E17
82  C10 III B0464.8 GATGACTCAAATGAGCTTGAACC ATCGCAGTTTACGTGTTATCGTT III-5E19
82  C11 III F55H2.1 CGCAGACAGTGAGACAATATCAG TATTACTCCTCCCTCATGCAAAA III-5E21
82  C12 III F55H2.2 ACCGATTTCGCTCATTTTTG    AAGAACATCGGAGGGTGTTG    III-5E23
82  D01 III F55H2.3 GTATTGAAGAGGCTGGATTGATG GACACAAGAATTAGGTGAGTGGG III-5G01
82  D02 III F55H2.4 AGAGGATTGGCTACTGCGAA    GCAGCGAAGCTATCGACTTT    III-5G03
82  D03 III F55H2.5 GATCCGGGGTTTGTTATCCT    CAAGGGTGTCGTCGAAAAAT    III-5G05
82  D04 III F55H2.6 GATCGAACCGTCCATCTTGT    GGTTCCGAAACGAAAACTGA    III-5G07
82  D05 III F55H2.7 GCACAAAGTACTGGAAAAGGATG AAATCAAATGAATACATGGCTGG III-5G09
82  D06 III ZK1098.1    GAGCCACTTTGGATTGCTGT    GGATTTCTCCTTCCGACTCC    III-5G11
82  D07 III ZK1098.2    CCTGCATGTTATAGATTTCCTCG CACGTAAACTGAAATATCCGCTC III-5G13
82  D08 III ZK1098.3    TCACTAACAATGCTCCTCCATTT AAATCAAGATGATACGGCACCTA III-5G15
82  D09 III ZK1098.4    CTGCTCGAGGTTTTAGACCG    CTTCTCCAACAGCTTCAGGC    III-5G17
82  D10 III ZK1098.5    CCTTAAAATCGGTCTCTTTCGTT AATGAGAAAATTTGAACAAGCCA III-5G19
82  D11 III ZK1098.6    GCGCAAAAATCGAGGAATTA    GGAACATGGGAAAATGTTGG    III-5G21
82  D12 III ZK1098.7    GACGGAAAGATAACAACGAATTG GAGGCTTTCTTTCATTTTTGGAT III-5G23
82  E01 III ZK1098.8    TTCAATGCCTTCAGATTCCC    TCCACAACGCTTTTCTGTTG    III-5I01
82  E02 III ZK1098.9    TGAAAAGCACTTTATTTTGCCAT TTGCGCTTCAGAATTTATTTTTC III-5I03
82  E03 III ZK1098.10   ACATTTGGGCGACCTACAAG    AAGAGAGGAGACGGAGGGAG    III-5I05
82  E04 III C48B4.1 ATACAACGCCCACGAGTTTC    TTTGGGTCAAACTTGGGAAC    III-5I07
82  E05 III C48B4.2 CAAAGAATCGTTGATAAACTGCC AAATGCAAAAGACAATTCGTGAT III-5I09
82  E06 III C48B4.3 CAAGACCTTTTGCGTCAATTATC CACCTATTTTTCAACGAGTTTCG III-5I11
82  E08 III C48B4.6 CAACAAAACAAGCAGTTGAGCTA TGTTCACATTTTCCACTTTCCAT III-5I15
82  E09 III C48B4.7 AGTTTGATCTGATAGTGAAGCGG TTTCGTTTTGGGAAAAACATTTA III-5I17
82  E10 III C48B4.8 CAGAAAAGAAACAGGATGGAATG CCCATCTCTATTTTGCAGTTGTC III-5I19
82  E11 III C48B4.9 ATTGGGTAAAGGATAACCTGGAA TTCAAACGCTTTTCACAATCATA III-5I21
82  E12 III C48B4.10    CCATCATAAGCATCACGATTGTA TGTTTCAATATCACCCTCGAGTT III-5I23
82  F01 III C48B4.11    TCAGTTGCCACTTCCACAAG    TCACAGCGATGACTACGCTC    III-5K01
82  F02 III C48B4.12a   TCGTTGCAAACATAAAAGAAGGT TGCAGAATTCACTTGTAGGAGGT III-5K03
82  F03 III F58A4.1 CAGTCCGGGTGTTGGTACTT    CACTCAAGCGTCTGGATTGA    III-5K05
82  F05 III F58A4.3 TTTCGACCAAAAATGCTTCC    ATGTCGTCTGCGTATTTCCC    III-5K09
82  F06 III F58A4.4 TCAAGACGTGGATAGCATCG    TCCCAGTCAAACCATTCACA    III-5K11
82  F07 III F58A4.5 AGAGCCACATTCGCTGATTT    GGCATACTGTTCCAGTCGGT    III-5K13
82  F08 III F58A4.6 AATAGGCACATATGTAGTGCGGT TCCGAAAATATGAATAGCTCGAA III-5K15
82  F09 III F58A4.7 TCTTGAGAAGGCATTAATTGGAA ATGGAGTTGACAGAGATGGTGAT III-5K17
82  F10 III F58A4.8 AACCCGAGAAGCAGTTGAAA    GTACGGGTGCCTTGATGACT    III-5K19
82  F11 III F58A4.9 AGATTGAAATGGGTGAAGTCAAA AAACCTGTGAATTTGCTTCGTAA III-5K21
82  F12 III F58A4.10    TACGAAGCAAATTCACAGGTTTT TTTCGTAACCATCGATTTATTGG III-5K23
82  G01 III F58A4.11    CGGATTCGAACATGTGACAG    GGTACTGATGCCAACGGAGT    III-5M01
82  G02 III C15H7.3 TGGAGCATTGCTGTGAAGAG    CCTACGCTCCTGCCTACTTG    III-5M03
82  G03 III C15H7.4 CTGCATTCTCTACGGCCTTC    TTGCATTCTAAGGGGGTACG    III-5M05
82  G04 III C15H7.5 TTTTTAATTTCAGATGCGACGTT TACATGCTCAACACGTTTACGAC III-5M07
82  G05 III C07A9.1 GTACGTGGCCAAATGTCCTT    TTTTCCGGACTCCACTGAAC    III-5M09
82  G06 III C07A9.2 GGGATTCACAAAACCTTGATATG CATATTGGCTAGCATTTACCTCG III-5M11
82  G07 III C07A9.3 GGGAGTTGCTACACCGTCAT    GCTTGACGTAGTTCGCCTTC    III-5M13
82  G08 III C07A9.4 GCCATGGCTTCAAATGTTCT    TTCGGGTTGCCGAATAATAC    III-5M15
82  G09 III C07A9.5 GAATTCAGCTTCTTTTCGAGACA ATGAATATCAAAGCCAATCAGGA III-5M17
82  G11 III C07A9.7 AATCAACATAGCAATTCCGAAGA CCACTCAGGATATTGAAGCAATC III-5M21
82  G12 III C07A9.8 GCTTCAACTTGTTCGGCTTC    CCCAATGCCTTGTATTTCGT    III-5M23
82  H01 III C07A9.9 TGTAGGAAATGTAGCCAAGGAAA CAAGAAGCGAGAGAAAGAGTGAG III-5O01
82  H02 III C07A9.10    AGGTAGATGATGATGCTTCTGGA CTGCATGATCTTCTGCTCTTTTT III-5O03
82  H03 III C07A9.11    TTTCTGAGCCAATCGAATTTTTA CTTGCACTTGGAGAATTATTTGG III-5O05
82  H05 III T05G5.1 CAGGGAAACTGGGAGTTTGA    CAGACAACACGAGGCTGAAA    III-5O09
82  H06 III T05G5.2 TGGAAAATAGCGAAAGTTTACGA CCGTCTTGTATGACTGACTACCC III-5O11
82  H07 III T05G5.3 CTCAAAGAGCTCCAGCATCC    CACGGAAGACGATAGGTGGT    III-5O13
82  H08 III T05G5.4 GATTATTTGGCCCTTCGATATTC CAGCAATTCTTTCTTCTCGGTTA III-5O15
82  H10 III T05G5.6 AAAAGCGGTCATTCCTTCCT    GCATTTTCAAGCAAAGCTCC    III-5O19
82  H11 III T05G5.7 AAAACATCCTCCAGTGACCG    TCAAAGCAATCAACACCAGC    III-5O21
83  A01 III T05G5.9 GAAGAAACCAATTTTGCCGA    AAGGAAGTGTTCGTCCATGC    III-5A02
83  A02 III T05G5.10    AGAGTTTACGAAATCTTCCTGGG AGTGAGGACTTCGATTCTGTCTG III-5A04
83  A03 III R10E11.1    CAACGATCGAAACAACATGG    GGCTGGCTCATTCTGAAGAC    III-5A06
83  A04 III R10E11.2    GTTATAGAGCATCTTCGGTCCCT TGACTGGAAGGGCTAATTTGATA III-5A08
83  A05 III R10E11.3    TGCAACTCAGTGATTCAGGC    TGTGTCGATTCAGAGGTTCG    III-5A10
83  A06 III R10E11.4    TTCTGAAATCGGGAAAACTTACA CGAAGCAATCGAAAATAACATTC III-5A12
83  A07 III R10E11.5    TTGCTAATATTGCACAGCCG    TTCCAGATTCCAAAACCACC    III-5A14
83  A08 III R10E11.6    TACATCCGGACTCCCAAAAG    GACTCCATTCACCCACAGGT    III-5A16
83  A10 III R10E11.8    ACCAGTGACACACAGTCGTATTG CGAATTGGTAATAGGTGGCATAA III-5A20
83  A11 III R10E11.9    TGCATCACTTGCGTTTAAGTCTA GATCTCAAATGGTGAGTTTCGAC III-5A22
83  A12 III ZK632.1 TGAAAGCTCTTGGAGTCCGT    CGTCATCATCCAAAGCAATG    III-5A24
83  B01 III ZK632.2 AATCAGACGGAGCCTTCAAA    TCTCCATAATCCATTCCCCA    III-5C02
83  B02 III ZK632.3 AGCTAGGTACAAAACGCGGA    GGATCTTCGAGTTCGGTTCA    III-5C04
83  B04 III ZK632.5 CTATTTTGTGCTGGTCGCAA    TGTTTGAAGCAAATCCCACA    III-5C08
83  B05 III ZK632.6 CATCATCGGCTGAGTAAGCA    AAAGCCTGTTGACTGGGATG    III-5C10
83  B06 III ZK632.7 CTGGAACCCTCATGGAGAAA    TTTCCATTCTCCGCGATTAC    III-5C12
83  B07 III ZK632.8 TTCGTCTATTTTCGTGTGTTGTG TGGCAAATCACATAATCTCACAG III-5C14
83  B08 III ZK632.9 GATGTGAAGAAAATTACTCGGGA ATGCTATTCAATCGGTTCTTTCA III-5C16
83  B09 III ZK632.10    ATGAGAAAATTCGGCAAGTGATA TTCAAATGAATGATTCTGACACG III-5C18
83  B10 III ZK632.11    TCAATCAAATCCACCGATCA    GCGGCAAGAGTGAAAGAAAC    III-5C20
83  B11 III ZK632.12    AAGTGAATTCCCGTCGAATG    TTCCTTCTGTCATGTGGTCG    III-5C22
83  B12 III ZK632.13    CTGTGAGATTATGTGATTTGCCA AATTTTCTTCACATCCCGTTTTT III-5C24
83  C01 III K11H3.1 CGCGAACAAAGAATATTTAGGAA AATTCGTCAAAGGAATCTGTGAA III-5E02
83  C02 III K11H3.2 GATTTAAGCTCGACTGCTCAAAA TCGATTTTCATTCGTCTCAATCT III-5E04
83  C03 III K11H3.3 CCTTCAGAGAAGACGGTTCG    AGGCAGACTCGAGAAAGACG    III-5E06
83  C05 III K11H3.5 AAAAGTCACGTTTCTAGACGCAG AATGTGAATGTTGTGCAATTGAG III-5E10
83  C06 III ZK757.1 GTCACCACACACGTTACTTGAAA ACGATGTCTCCTGAAGTTTGGTA III-5E12
83  C07 III ZK757.2 GACCATAGGCAGGCTCTTATTTT ATTGGAATTCACAGCTTATCGAA III-5E14
83  C08 III ZK757.3 ACGAGCAGTTGTTTGAATCATTT TCTCTTCCAAAGGATAATCGTGA III-5E16
83  C10 III F40F12.2    GAAGTGGGAGGATCCAGTGA    TTTCCCATCTACTTTCCCCC    III-5E20
83  C11 III F40F12.3    GGGTGGCACATTTCTTCAGT    TTGTGGGGATTCGAAATGTT    III-5E22
83  C12 III F40F12.4    TCCGATCAAATTGGTTGTCA    CTGAAGCAGCAGACATCTCG    III-5E24
83  D01 III F40F12.5    TCAGATAGTCCTTCTCGATCAGC TTCAACCTATCCAACTAGCCAAA III-5G02
83  D02 III F40F12.6    TACAAGGAGACGCCCATTTC    GTTTCCGGAGCAATCAGGTA    III-5G04
83  D04 III K03H1.1 GACCTTTGGTTTGGGATCAA    GATGCCCGAAGAAAAATTCA    III-5G08
83  D05 III K03H1.2 CTCCTGCCATTGCTTTTCTC    AGACCTCCGGGAAACCTTTA    III-5G10
83  D07 III K03H1.4 GAAAAATGAAAATCCCCTTTCAC TAGTTGAGGCAACTTCTGGTCTC III-5G14
83  D08 III K03H1.5 ATGAGTCGTGATGGTGGACA    GAAAAACGACGCCAACAAAT    III-5G16
83  D09 III K03H1.6 TAGAATCGTTTCAGTTTTCGCTC AACTTCAACGTCTGCGTCTCTAC III-5G18
83  D10 III K03H1.7 TGGAAGTTTCATCGACTTTTCAT ATGCATGATTTTGAAGCAGATTT III-5G20
83  D11 III K03H1.8 AAAGAAGAATGGATCAAAGGAGC ATCTATTGAACACCTGGAGCAAA III-5G22
83  D12 III K03H1.9 AAAAAGTGGCACAGAACGTAAAA ACAAGTCGGATCTACGAGATGAA III-5G24
83  E02 III K03H1.11    GTGCACATCAAGTTTGTCGG    TCAATTTTTCCCACTTTCGG    III-5I04
83  E04 III R10E12.1    ATGTTCGCTGTTCTTGTCCC    TCAAAATACGCTCACGTTCG    III-5I08
83  E05 III R10E12.2    ATAATGTTTCACCGGTTGTCATC CTGAGGATATCTCAATGTCTGCC III-5I10
83  E06 III C05B5.1 CCCAGAAGGTTCTAAGTGTGATG TGGATAATCAGCTTGTTTCCACT III-5I12
83  E07 III C05B5.2 TTGGGGAACACGAACTCTTC    CAAATGATGTTTGCCACGTC    III-5I14
83  E09 III C05B5.4 GTGCATCTATAAGTTGGCCAGTC ATCTTCAGAGAATGTGCAAGAGG III-5I18
83  E10 III C05B5.5 ATTTTCTTGGAGAATGGGGC    GCCAAAAATTTATCCGACGA    III-5I20
83  E11 III C05B5.6 AAAATGGTTGTCGATGCTCC    AGGCAGGCATAAAACACCTG    III-5I22
83  E12 III C05B5.7 GCTGGATTTTAATTCGCCAG    AGTCCCCTCCACTCACACAC    III-5I24
83  F01 III M04D8.1 TTAGCAGCACACTCTTGTTTTCA AACCAGGCTATCCTTTTCAGTTC III-5K02
83  F02 III M04D8.2 CAAATGTCGAGCTCATTTAAACC CCAAATCTGACTGAAATTTTTGC III-5K04
83  F03 III M04D8.3 TGTAGGGGTTCGGATTTATTTTT AGATCACTGAGAAGTTGGACAGC III-5K06
83  F04 III M04D8.4 TTTGTTTTTCGAGATCTGATGGT CGTAGATCGCAATTTTGATAAGG III-5K08
83  F05 III M04D8.5 ACGTCACTGTGAGTACATTGGTG CTAGCAACCAGAACACAACACAG III-5K10
83  F06 III M04D8.6 CTGCTCGGGCACTATTCTTATTA GAGGAGAAACGAGAATGAAAGGT III-5K12
83  F07 III M04D8.7 TTGTCTTCTTCAATCGCCATTAT AATGATTTATGGAGCCTGGAAAC III-5K14
83  F08 III T16G12.1    TTGAGAAGTGGCCAACACAG    TGCTTATTTGGATGCCATGA    III-5K16
83  F11 III T16G12.4    TTATCTGAAAGGCTCCACATGAT TGTCAAAATTGGAAAAGGTTTGT III-5K22
83  F12 III T16G12.5    AAATGTTCAGACACCCATTGAAC TCAAATTCTTTCTTCTCTGTCGG III-5K24
83  G01 III T16G12.6    CAAAACAAGCAGCTGTGGAA    AAGTGCCTGCTCCAATGTTT    III-5M02
83  G02 III T16G12.7    CCTGGAAGGAGCAAGTCAAG    ACTCACGCGAGACAGCCTAT    III-5M04
83  G03 III T16H12.1    GAACGAAATCTCACTTTTTCCCT ATCATCGTTGCTGAAGTTGAAAT III-5M06
83  G04 III T16H12.2    ATTTCCCTCTACCTCGTTGATTC GAGAAGAAGGAAACACTTTGGGT III-5M08
83  G05 III T16H12.3    CATTTAGCCCATTCGCTGTT    TTGGCGAAGAAATAAATCCG    III-5M10
83  G06 III T16H12.4    GTGGAGCTGCGACAAGTGTA    GATTCGCCTCGGAATTGTAA    III-5M12
83  G07 III T16H12.5    CAGCAAGAATTGCCTTGTGA    TTAGTCTCGATGGAGGTCGG    III-5M14
83  G08 III T16H12.6    AGCAGGTATCCATTTGGCAC    GTCAGATCGTATGGCCCAGT    III-5M16
83  G09 III T16H12.8    TCGGGTGATCTCCTCAGTTT    TCGCCATTTTCTCATTTTCC    III-5M18
83  G10 III T16H12.9    TTAGGTGAATTTTCAAAGGGGTT AATAGGATCCTGCGGTAAGAGTC III-5M20
83  G11 III T16H12.10   TCCCGCAATTGACACAATAA    TCCCCCTTATGGATGTTTGA    III-5M22
83  H01 III ZK1128.2    TCATGAAAACGTGGCAAAAA    GGCAAAGGAAAGTACGCTTG    III-5O02
83  H02 III ZK1128.3    ATCCCACAACCAATGGAGAA    ACGATCGTGAGAGGGTTCAC    III-5O04
83  H03 III ZK1128.4    CGTTTCCTGTTCGGTTTGAT    ATGGGGAATGCTAGCAAGTG    III-5O06
83  H04 III ZK1128.5    CTTTTTGATTTACAGGCAACACC AAATTTGCCATTTGTTGTTTGAC III-5O08
83  H05 III ZK1128.6    TCATTTCCCTGGAGCATTTC    AACATCAAGTGGAGTTCCCG    III-5O10
83  H06 III ZK1128.7    TTTGCGATTCCAATTTCTAGTGT CAAATTGTTTGTCTTTCAGGAGG III-5O12
83  H07 III ZK1128.8    AGTGGAAGTGATTTTGGAACGTA AATCGTACAATATGTTGATGGGC III-5O14
83  H08 III K08E5.2 ATGCTTCTGTGCCTTTTCGT    AACATTTGCAATGCTCACCA    III-5O16
83  H09 III K08E5.3 GTTCCGTGGAAAACGGAGTA    GCTTACAGACACATCGCCAA    III-5O18
83  H10 III T20G5.1 GTGAAGCAAATCCCACTGGT    TTATTGATGCGGGGAGAAAG    III-5O20
83  H11 III T20G5.2 CGGACCAATCTTTCTTTGGA    CCAGGTTTAATCCGACCAGA    III-5O22
83  H12 III T20G5.3 TTGCCAGTTCATGGATTCAA    ACCTCCTCCGTGTACAATCG    III-5O24
84  A01 III T20G5.4 CCTGTTCAACGGCAACCTAT    TTGTGATACAGATCGCCCAA    III-5B01
84  A02 III T20G5.5 GATTGGGAGGAATGGAGGAT    GCAAACCGGCAAATTAAAAA    III-5B03
84  A03 III T20G5.6 GAATAGTGCCGGCCAGATAA    AACGCTTGATCCAAGGAATG    III-5B05
84  A04 III T20G5.7 TCTGAATTATCCATTAGCCGAAA ACAAGACAAACACACAAACGATG III-5B07
84  A05 III T20G5.8 AAAAACAATAGCGTTCGATTCAA ATGCATCATATCTGCCTTGCTAT III-5B09
84  A08 III T20G5.11    CACTGTTTAGCCTCTTCCGC    CTGTCGAACTTCCTGAAGGC    III-5B15
84  A09 III T20G5.12    CATGATCCGAATCTTCTTTGTTC TTGATCTGCGGATAAACTTTGTT III-5B17
84  A10 III Y70G10A.2   GATCTTTGTGAGGGACTGTGTTC AGCAATGATACAATGGGTAATGG III-5B19
84  A11 III Y70G10A.3   AAGACGAAGATGATGCAGAGAAG GAGGAAAATGGAATGAGGAGACT III-5B21
84  A12 III R01H10.1    CAAAAACGATATGAGGAGTCGAG ATAGAGAAACCCCGGAACTTATG III-5B23
84  B01 III R01H10.3    ACCAGCCGATCTATGTTTGG    TTCAAAAACTCACGCAGTCG    III-5D01
84  B03 III R01H10.5    CTTCGTTTCCATCAAACAATAGC TTTGTGAAATTCTAGGCCACACT III-5D05
84  B04 III R01H10.6    AGCATTGTGGTTTTTGAGGC    GGGTCGCCCATACTTTACAA    III-5D07
84  B05 III R01H10.7    TGAGCCGTATTGAATCCACA    AAGATCGCCGTAATCGACAC    III-5D09
84  B06 III R01H10.8    CAATTTTCCAGACAATAAAAGCG CATACTCAAATTGCAGTCCTTCC III-5D11
84  B07 III K10G9.1 CCGTTCACCGATATCTTCGT    CGAGCAAGCAATGATCAAGA    III-5D13
84  B08 III K10G9.2 TTTAGCGAAATTGGAAAAACGTA ATCACAAAGAAAAGCAAACGAAA III-5D15
84  B09 III T07A5.1 TTCCGAACCTGATTTTCCAC    TGGGTTTTCTTCCTCCTCCT    III-5D17
84  B10 III T07A5.2 AGTTGTGAGAAAATCGCTACGAG AAATTTCCCGACTTTTCACTGAT III-5D19
84  B11 III T07A5.3 TTTCTATGGCTACGCTGCCT    TGGTTGACGTTGAATCCAGA    III-5D21
84  B12 III T07C4.1 CAGACACTCTCGTCTGAGTGATG GTGGAGATTAGCGAGGTTCAGTA III-5D23
84  C01 III T07C4.2 TCCAGAGAAAAACCATGACAGAT TGCTCAATATCCTCTTGCTCTTC III-5F01
84  C02 III T07C4.3 CAACTTTGCAGAGCACAAGC    ATGACACGTGGATGTGAGGA    III-5F03
84  C03 III T07C4.4 ACTTCACCTCCACATCTCACAAT AAGGCGAAAAGCTACTCCTCTAA III-5F05
84  C04 III T07C4.5 ATTCCCTTGAATTTTGTCGGTAT TAGAAAGTCCTTCCCTTCCAAAC III-5F07
84  C05 III T07C4.6 GGGTCTTCAAAAAGTCGTTTCTT TTAGAATAGTTTTCCCGCTCCTC III-5F09
84  C06 III T07C4.7 AGAAAATCAGCATTGTTTCAGGA ACGGAAAAGAGAGAAAATCGAAG III-5F11
84  C08 III T07C4.9 ATCAGTTGAAAAGTCTGCGTCTC ACCGAACACTAATTCCCAAAAAT III-5F15
84  C09 III T07C4.10    AAATCCCTAAACTTCCGCGT    CTTCTCGGAGGAGCTGAAAA    III-5F17
84  C10 III C38H2.1 TTTTCAGTTTCCAAATCGGC    GCTCACCTCGTTTGAAGTCC    III-5F19
84  C11 III C38H2.2 CGGTTTGACCCATTTCAATAATA CAAATGTCAAGTGAAAAATGCAA III-5F21
84  C12 III M03C11.1    CAGAAAAAGTTGGCAGCTAAAAA AAGTTTCACCCCCTTGACATTAT III-5F23
84  D01 III M03C11.2    TAATCTCGCCAAATCCCAAC    ACTGAAAGTTCGGCCAGCTA    III-5H01
84  D02 III M03C11.3    AAACTACCGGCCTCTGTGAA    TTCTCTCCTCGTCCACGACT    III-5H03
84  D03 III M03C11.4    CTTTTCCCGAAACCAGAACA    CCGCCGAACTATGGAAATTA    III-5H05
84  D04 III M03C11.5    GGTGAAGCACAGGTTCCATT    AACCTTAACCATCTGCACCG    III-5H07
84  D05 III M03C11.6    TCATCCTCTCTTTCTCCTCTGTG AGAAAACGACGGCAATATATCAA III-5H09
84  D06 III M03C11.7    CATTCTGAAGCCTTTCGAGC    GAAAGCTCGAGGACATTTGC    III-5H11
84  D07 III M03C11.8    CCTGGAAAAATTGGCTGAAA    CTGTGTGAACGATTCCGATG    III-5H13
84  D08 III H04D03.1    TTCTTCGAGAAAAATAGCGTTTG AATGGGGCTCCATAGAAAAATAA III-5H15
84  D09 III H04D03.2    TCTGCACCTCTTCAATGTCG    GAAGTGCTCATGTGGAAGCA    III-5H17
84  D10 III H04D03.3    CTGAATTTGGCGATCGATTT    TTTCACTTCCAGCGACTCCT    III-5H19
84  D11 III D2045.1 ATCATCCACAACAACAGCCA    GAAAGAGGGAAACATGCGAA    III-5H21
84  D12 III D2045.2 CAGCTGTCATCATAGGCGAA    TCGATGGAGACACAAAGCTG    III-5H23
84  E01 III D2045.5 CCCCCAGATGTAATAAACATCAA CAAGGATCTGATGGCTCATAAAC III-5J01
84  E02 III D2045.6 GAAGACGGTCGAGCAGAATC    GCATGAATCCTGGCTCATTT    III-5J03
84  E03 III D2045.7 TTTACTTCACAGTAGGGCTCCAA TTTCGGTCAAAAATGGTGATAAT III-5J05
84  E04 III D2045.8 AATTATCACCATTTTTGACCGAA TTAGTGCCACGTCTTCTTTTCTC III-5J07
84  E05 III D2045.9 TGAACCTTCTGAAACCCTCATAA TTCATCAACTGGAACCATCTTCT III-5J09
84  E06 III F43D9.1 ACACCCATCACTCGGAGAAC    TTGGATGCAGCTGTAAGTCG    III-5J11
84  E08 III F43D9.3 CTCGATCAAAAACTGCGTGA    TGCGGATTCTTCAATTCCTC    III-5J15
84  E09 III F43D9.4 AAGGGGACTCATCTTAATCGAAG TTCATCGTTTTTCACCTCATTCT III-5J17
84  E10 III F43D9.5 AAGTCAATACTTCGCTCCATACG GAGAGGAGTACACGGTGAAATTG III-5J19
84  E11 III T21C12.1    AACATCGTCATCCCATCCAT    AACAACGAGAAAGGCGAGAA    III-5J21
84  E12 III T21C12.2    TGCACTGAAGATTGACCAGG    AAAACAGGAAACCGTTGTGG    III-5J23
84  F01 III T21C12.3    TTAGAAGCGATTTAAGGCATTTG ATGTCCCAAATTCTTTTCCTGAT III-5L01
84  F03 III Y45F3A.1    GTCGATTTACGGAGTTTTCCTCT CAGAGATTTTACATTTTCCGTCG III-5L05
84  F05 III Y45F3A.3    CTAAACCTCTACGGAAAGCACAA ACATTGGTAGTTCCTTCCCAAAT III-5L09
84  F06 III Y45F3A.4    AAACCCAACCTATGGAAAAGAAA ATAGGGGTCACATTGGAAAAGTT III-5L11
84  F08 III Y45F3A.8    ATTCAAAAGCCAAACCTTCTTTC AAAATCGGGATTTCCGACTAATA III-5L15
84  F09 III Y45F3A.9    ACAGTAATCCTACAGTGTCCCGA AAAGCAAAAATGGCTAGGAAATC III-5L17
84  F12 III Y39A1A.3    CAACAAGCAATAATTGAACCACA TTTTCCCTCCACTTTCAATTTTT III-5L23
84  G02 III Y39A1A.5    AACAATTCACCGATTTTCTCGTA TAGGCTGGAAAATGAATTGAAAA III-5N03
84  G04 III Y39A1A.7    GGGGAGAACAATGAGATACAACA AAAAATGAATGAATACTGCCGAA III-5N07
84  G06 III Y39A1A.9    TCAAGCTCAAACTGGACGTG    GAGGTAGGCTCGCAGTTTTG    III-5N11
84  G07 III Y39A1A.10   TTGTTGTAAATTATGGGGGACAG GCGTTATCAGTCGGTCTATGTTC III-5N13
84  G10 III Y39A1A.13   AGTCATTTCAATCACCAAGCAGT CGTCTCGACAATTTTACGAATCT III-5N19
84  G11 III Y39A1A.14   TTTCCAAAAGTCGAAAAACTCAA AAACTGAAAAGTTAGGCTCCTGG III-5N21
84  G12 III Y39A1A.15   ATACGTGTGCCTGTACAGTGATG AATCTCCGAATAACCTACCCAAA III-5N23
84  H03 III Y39A1A.18   CTTTATGATCGAATCACTGTCCC GAAGAAAAACGAAAGCATCTTGA III-5P05
84  H04 III Y39A1A.20   AAAGCAAAAATTATTGAGGAGCC TTCCAGGAAAATTTTGTTTCAGA III-5P07
84  H05 III Y39A1A.21   GTCACAAATGGCTTATCAGATCC TTCTCCGAGTTGTTTTTCAATGT III-5P09
84  H06 III Y39A1A.22   ACTTCGAATGGTGCGGTTAC    TTCTAACATGGATCGCCTCC    III-5P11
84  H07 III W09D10.1    CTGCTAAGAAGGCCGTCAAC    ACGCTCAAAAGTGCCAAAAT    III-5P13
84  H08 III W09D10.2    ATGGCTGTTCCCAACTCAAC    AGAAACGGCACGATATACGG    III-5P15
84  H09 III W09D10.3    ATCACCAAAACCCAGGTTAAAAT ACACAACAAATGAAAAGAGGGAA III-5P17
84  H10 III W09D10.4    CATCTTTATCAGCCATATCAGCC GCATGTATTAACTCTCCCACGAC III-5P19
84  H11 III W09D10.5    TTGAAAATTGCGTGAAACCA    CAAGGTGTAGGGTTCCCAGA    III-5P21
84  H12 III K01G5.1 AAACTTGCGAAAATCACGAATTA ATTTCGATCTAATTTCTCCCTCG III-5P23
85  A01 III K01G5.2 GGGGTTAGCACAAAAATTGGTAT TCCAATTTTGCTAGAAACAAAGC III-5B02
85  A02 III K01G5.3 AGCATTGAAAGAGCATTGAAAAA GTGAAATTGTGTGGGGAAATAAA III-5B04
85  A03 III K01G5.4 AAATTTAGGTGGGATGGTTTTGT GAGTTCTCTCTGATTTTGCTCCA III-5B06
85  A04 III K01G5.5 GTCGACACTGCCTGGAAACT    AAGCTCCACGAGGAAGTTGA    III-5B08
85  A05 III K01G5.6 TTGGAAGTTCTGCTGCATTG    GTTGGCCTTGAAAATCGAAA    III-5B10
85  A06 III K01G5.7 ACAATGCCACCCTCTCTGTC    GAAACGGGGCAGGATAATTT    III-5B12
85  A07 III K01G5.8a    GGAAACGTGATGTTGAAAATGAT TGCAAAAGCTCGATAGAAGGTAG III-5B14
85  A08 III K01G5.9 GAAACATCGATTCAGTGGAGTTC ATCAAAATTGTGGATTTTCATGC III-5B16
85  A09 III Y39A1B.1    AAACAGTTAACAGGTGGCGG    ACCCGGGACTCCAATTATTC    III-5B18
85  A10 III Y39A1B.2    TTGCGAAATATAATCGAGACGTT TACATCAATATGCTCCTTTGCCT III-5B20
85  A11 III Y39A1B.3    AAAGAAAATTGGTCGTTGCG    TCCACAACGAATCATCCTGA    III-5B22
85  A12 III K11D9.1 GCTCCTGCACCGAAGTCTAC    TGTCACGATCGCATTCTCTC    III-5B24
85  B01 III K11D9.2 GGAACCTTTTGTCCGTTAACTCT CCGGAGAATCTGTGTCTGTTATC III-5D02
85  B02 III K11D9.3 ATTGATTGTTCCAAGGAGTACGA AATCCAACTTTTCAGGGAGTAGC III-5D04
85  B03 III R17.1   TTCCAAACCGCTACGCTTAT    TCCCATTTGACACCCTCTTC    III-5D06
85  B04 III R17.2   GCGTACTCCTCTCGGACAAG    ATCCTTCTCATCAGGCTGGA    III-5D08
85  B06 III Y39A1C.1    CTCACATTTTCTTCATTTTTCGG AACCACGTTGCAAAATTGTCTAT III-5D12
85  B07 III Y39A1C.2    TAAAGCATGGTGGCACAAAA    CCAACAGCTCCACTCCAAAT    III-5D14
85  B08 III Y39A1C.3    GGTGTCAACAGCTAGAAGCCTAA ACTTATCGATCGTTCTGTCGTGT III-5D16
85  B10 III C44B9.1 TTGTGCCCAGTACCATTTCA    TAAGCTCAAATCGCCCACTT    III-5D20
85  B11 III C44B9.2 AAAGCAAAATTCCGCTCAGA    TGAACCCAAAACTGCACAAA    III-5D22
85  B12 III C44B9.3 CGTCCTCCCGATGTGTAACT    CTCTCTGTGGAACGGAAACC    III-5D24
85  C01 III C44B9.4 GGCCGAGTTTTTAGGGTTTC    GGTTCAACAATTCCGCAGAT    III-5F02
85  C02 III C44B9.5 CCAAACATGCTGTTGAATCG    TTTGCAGCGGGAAATTTAAG    III-5F04
85  C03 III M142.1  GCACAGTTTTAAGTGTTTCCGTC GCTGACTTTCCAATTTGATTTTG III-5F06
85  C04 III M142.2  GCAATAGTGATCACAGATGGACA TTCACGAAAATCAACGCTTAAAT III-5F08
85  C05 III M142.4  AACCTTTGACATAACCCAGGAAT TAATTTTGTCCATTTTTCCCCTT III-5F10
85  C07 III M142.6  CCCATGTCAGCAGTCAGCTA    CACCACACGTTGAGGTGTTC    III-5F14
85  C08 III Y52D3.1 TGCAATTACACGACAACTACTCG AAATTGGCGAGTAATCAAAGACA III-5F16
85  C09 III Y48A6A.1    GTAGATGACTGAAGCGTCCTGAT TTCGTGAAAGTTCCTACCAAAAA III-5F18
85  C10 III W05B2.1 TTGTCCGTCTTTATGTGGCTACT ATCTGAAAATGGACGAGAAACAA III-5F20
85  C11 III W05B2.2 AATTTTTGTTGGTTCAAACCCTT AAAAGGCGACAAAGTCCTAAAAC III-5F22
85  C12 III W05B2.4 TCACATTTTGGAGTCAAGAACCT AGCATACCACTCTGCTCAAAAAC III-5F24
85  D01 III W05B2.5 ACTTTGGACAGATTCCCTTCTCT AAGGAACAAACGATTTCTGAACA III-5H02
85  D02 III W05B2.6 GTTTCGCCTCTTTGTCTATGAAA AACGTCAGTTGGATCATCTCATT III-5H04
85  D03 III W05B2.7 ACAAATTGAAAAACTCGCAGAAA AGAACGAAATACTAGCGGGTAGG III-5H06
85  D04 III Y48A6B.1    AGGTAACCCGGATTGTTACCTTA ATTTTTGCTTCTGGTCAAATTCA III-5H08
85  D05 III Y48A6B.2    ATAGGTAAAGTCCTGCGTAAGGC TTTTTGGAAACATTCAAACTTGC III-5H10
85  D06 III Y48A6B.3    AATTCAACAAAACGAATTTCCCT TTGGAAATTACCGAGAAAGGATT III-5H12
85  D07 III Y48A6B.4    TCGATGCTTAAAAACCTTGTGAT ATTTTCAGGGAAATTCGTTTTGT III-5H14
85  D08 III Y48A6B.5    CAATCTAAATCACAGCAAATCCC AGTGGGGGAACAATTATGACTTT III-5H16
85  D09 III Y48A6B.6    CAACGGCCTATGTATATCTCTGC GGAGTCAAAAAGCCATTTTTCTT III-5H18
85  D10 III Y48A6B.7    TATTCTGTCTTGTCCGGTTTGTT AAATTTCCTTTCTTCGTCAGACC III-5H20
85  D11 III Y48A6B.8    ACACGTAGGAAACCCGTCAG    GGGAAGATCCAAGAGGGAAG    III-5H22
85  E01 III Y48A6B.10   CGATTTTTCGAAGTTTTTGAATG AGTCAAAACTGGCAATATCTGGA III-5J02
85  E02 III Y48A6B.11   AAAATAGGCGGATGAAACCC    GTATCTGTCACTGCTGCCGA    III-5J04
85  E03 III Y48A6B.13   TTTTTCAGCAAACAAATTCCTGT CATATCCAAACGAAATATCCGAA III-5J06
85  E04 III W09D6.1 AATTTTCAGCAACACCCTCG    TACGTAGGAGATTCCGGGTG    III-5J08
85  E05 III W09D6.2 TTTTTCCAGGATCTTTTCACAAA TTTCCGGTAATTCTTCACGATAA III-5J10
85  E06 III W09D6.3 CGATTTTTCCGGATTCTCTACTT AGCGATTTTCTTCTGGAGTTTTT III-5J12
85  E07 III W09D6.4 AAGCGAAGAAACACAACAAAAAG CAACATGCAAAATCACTTGAAAA III-5J14
85  E08 III W09D6.5 GGCCTATTATGTGCCTAGGAAGT CCGAATGAACAGGTGTCAGTAGT III-5J16
85  E10 III Y48A6C.1    AGATCGAAAGCGGATCTGAA    GGTTTTTGTTTCAGGGACGA    III-5J20
85  E12 III Y48A6C.3    ACGGAAAAATGAGACACAGAAAA GGCTCGTAATTTATATGGCATGA III-5J24
85  F01 III Y48A6C.4    CCATTTTCGCATTTTTCTTGTTA AATCACTTTTTCCCTCGATTTTC III-5L02
85  F02 III Y48A6C.5    CTATTTTTAGGTGTCATTGGGCA ATGGTTACTAAATCCATGCGAGA III-5L04
85  F03 III Y47D3A.a    TTTCATCGAGTAAAACCTCCAAA TTATTCCATGCACTTTTTGTGAC III-5L06
85  F04 III Y47D3A.aa   TGACTTGTGTGAGTTAAAAGCGA GCACTTCTAGAGCCAAAATTTCA III-5L08
85  F07 III Y47D3A.c    TCAGTCAAAAGAAGTCGAAGGAG ATGTAGAGTGGCAGAGCGTTAAG III-5L14
85  F09 III Y47D3A.d    ATTGGCGCACACTTAATATTCTT TCAGAGATGGAAAAACTCCAAAA III-5L18
85  F11 III Y47D3A.e    GTCGTAAATCGACACATGCATAA AAAAATTGCCAGATTGCGTATAA III-5L22
85  F12 III Y47D3A.ee   GATGGATCCCCTAGATGACCTAC TTCTCACCTTACAAGTCCCAAAA III-5L24
85  G01 III Y47D3A.f    CGCCAGAACTTAGCTTTTCATAA ATTTCAAAATTCCAACAGCAAAA III-5N02
85  G04 III Y47D3A.gg   CTGTATTTTTCCAATTTTGGCTG CTCACTAATCCTGATGGTTCTGG III-5N08
85  G06 III Y47D3A.hh   CTCTCTGCATATTGATTTTTGGG ATTTTTCCAAATTCCACCAAGTT III-5N12
85  G10 III Y47D3A.l    AAAATTGAAATTTCGGACGTTTT TTTTTATCAGTTACGCCACCAAT III-5N20
85  G12 III Y47D3A.n    TTTCATAGTTCTCGCCATTCCTA CTTGGTGCTTATTTTTAGGGCTT III-5N24
85  H02 III Y47D3A.p    AGGAAAATCGTTCTCAAACATGA GACATTCTTCCGTGCAAAGTATC III-5P04
85  H03 III Y47D3A.q    TATTGCGAAAATTCCAGAAGAAA ACAGAAAGAAAATTAATGGGGGA III-5P06
85  H05 III Y47D3A.s    AGGAAAGTCACAAAAACCATTGA CACGACGACCGTACACAATATAA III-5P10
85  H07 III Y47D3A.v    TTCACGTCATTTTCCGTATCTCT TTTGGAATTTGAACCTTTTCGTA III-5P14
85  H08 III Y47D3A.w    AATTTGGAGAAATCGTGATGAGA GTCGAAAAATGCAAAGTCAAATC III-5P16
85  H12 III T28D6.1 TCTTTAATAGCGGCGGAGAA    CTAGCAGCTGACACTTTGCG    III-5P24
86  A01 III T28D6.2 GTTTAAATCCACGTTGAGAGCAC AAGTTGCAACCGTGTAAAGTTGT III-6A01
86  A02 III T28D6.3 AAATGTTCAAGATCCTCCTAGCC TGTCTGAAATTCCGAAGCTTAAA III-6A03
86  A03 III T28D6.4 TCAATGAGAGTCCCGTAAGATGT AGAGTCTTCACAGCATTCAAAGG III-6A05
86  A05 III T28D6.6 TATGATGCTGAACAATCTTGGTG CACAATAATCCAGAAAATCGAGC III-6A09
86  A06 III T28D6.7 AATTAAGTTTTTCCGCGTTTTTC TATTTCCTCCAAAAAGCAACGTA III-6A11
86  A08 III Y47D3B.2    TGACACCAGCTCTCATAACTCAA ACATTATATTTCCAGCGCTTGTC III-6A15
86  A09 III Y47D3B.3    GCCACTTTTTGAGTCACCATAAC CTGAATACACTTCAATTCCAGCC III-6A17
86  A11 III Y47D3B.5    CTGGCTCTTCTAATCTGTGTCGT TCGGAAATATGTTTTCTTTTCCA III-6A21
86  A12 III Y47D3B.6    CTTCCATTGAAGACTTAGACCGA TAACTTCTTAGAGACGTCTGCGG III-6A23
86  B01 III Y47D3B.7    CGGATTTTCCAAAATAGATAGGC CAGCTCCATCTAATGGGTATCAC III-6C01
86  B02 III Y47D3B.9    TTTCCTGTCAATTTCTGCCC    TCCTCTTTTCATTTTCCCCC    III-6C03
86  B03 III Y47D3B.10   CATAATGTCCTCCGATTCCATAA GATGACTTGAGTGGAGCAGCTAT III-6C05
86  B04 III Y66A7A.1    TGTCGCTTGTGTCCATTGAT    AGCACAAAGACTCGGCAGAT    III-6C07
86  B05 III Y66A7A.2    ACATGCCTACACGCCTACATTAT TTTGATTTTCGACTTTTGAGGAA III-6C09
86  B06 III Y66A7A.3    AAAAAGATGGGTGGGAATTTAGA TTTTGGGTCGTTAGTTTTCTTGA III-6C11
86  B07 III Y66A7A.4    ATTCAATAAGGAAGACCAGAGCC TCGAACAAGTTTTAGGTATCCCA III-6C13
86  B08 III Y66A7A.5    GTATCAATCGAATCGTCATCCAT CGATTTTTAGGAAAATTTTTGGG III-6C15
86  B09 III Y66A7A.6    TCAACGGAATCATCGAATTTACT TGGCTCAAGTTCTGGATAAACAT III-6C17
86  B11 III Y66A7A.8    TTGTATGAAGAAACTGTCGCAAA TCAGAACTTATCCCCAAAGATGA III-6C21
86  B12 III Y41C4A.1    CCAAGCAGCGGACAATTTAT    AACTCCGGTCATCTTCATGC    III-6C23
86  C01 III Y41C4A.2    TTTTAATGCCACGGAGTTTAGAA CGAAATCTAGGTAGTTTGCATGG III-6E01
86  C05 III Y41C4A.6    ATTAGCGCCATAAACATTTCAGA GAACTTCATCTACCTCAAGCGAA III-6E09
86  C06 III Y41C4A.7    CAAGTCGAGAAGAACGTCAGTTT GTCCCACTCACCACACTATCAAT III-6E11
86  C08 III Y41C4A.9    CCATCATCTCCATTCAAAATCAT ATGCCGAAAAGAAAGCTAAAAAC III-6E15
86  C09 III Y41C4A.10   GGCTTACAATAACCATTTGTCCA TTCGACAAAACGCAAAAATAACT III-6E17
86  C10 III Y41C4A.11   ATGGGAAAAATGGTAAAGCAGAT CTGCGAATTCCAAATTTTTACAG III-6E19
86  C11 III Y41C4A.12   CAATATCGAACTCGAAAATCTGG GACTAGCAGAAATGGATGAGCAC III-6E21
86  C12 III Y41C4A.13   GAGCTTAGACCGAAAACTGACAA AAAATGATGTCCTACATCGCACT III-6E23
86  D01 III Y41C4A.14   AAATGATGGAATTAGAAACGGGT TTGTAGCCAGTATAAAGGCGGTA III-6G01
86  D02 III C24H11.1    GCAACAGATGCTCCAAAGGT    ATCAAGTCGGGCATTTTGAC    III-6G03
86  D03 III C24H11.2    GGCATGAGCCTTTAACCGTA    GGATCGTGGAGGTCACTCAT    III-6G05
86  D04 III C24H11.3    GTGCAGTACAATATTCAAAGGGG TAGGACGATTCCAATTTCAAAAA III-6G07
86  D05 III C24H11.4    TCTCATCGTTTTCTCGTTTTTGT TGGTGCAACGTAGTAGATCGTTA III-6G09
86  D06 III C24H11.5    CAAATTTTTCCCTTGAAAATTCC AATTTCCGTCAAATGTGATTTTG III-6G11
86  D07 III C24H11.6    ATTTTCAGAGGATTTCGACCAAT TCACAGCAAATTAGGCAATTTTT III-6G13
86  D08 III C24H11.7    GTAGACACCTCCATCCAGACTTG TCATCAGAAAAAGCCAACAAAAT III-6G15
86  D11 III C18D11.2    TGTTTCCTTTTACCATTGTTGCT AAGCTAAACTTCTACGCGCTTTT III-6G21
86  D12 III C18D11.3    TTATTTTTGGGATTTTGGGATTT TTGAACGGAGGAACAGATAAAAA III-6G23
86  E01 III C18D11.4    TCTTTCCGTATAACCTCCATCAA GATGGGATGAGGTAAGAAGTGTG III-6I01
86  E03 III Y56A3A.2    AAACTCGTCACAGCACAGAATTT TTTTTAAACCTAGTTATGCCGCC III-6I05
86  E04 III Y56A3A.3    GCTCTTTCTCCGATTTTTCTCTC CAATTTTGCACTGTTGAAATGAA III-6I07
86  E05 III Y56A3A.4    CGTGATTCAATTTTCTTCACCTC TAATTCGTAATTTTAGTCCGCCA III-6I09
86  E07 III Y56A3A.6    CAATTAGGCCATCAAATCTGAAA GTATGGAAGATCACTTCTGACGG III-6I13
86  E08 III Y56A3A.9    GAAAGAGGGGGAAAAGATACAGA CCCATCAACACCTAAATTCAAAA III-6I15
86  E09 III Y56A3A.10   GGGCAAGGTTTTAAAAATGTCTT TTGGATTGAACATGTTGCTTATG III-6I17
86  E11 III Y56A3A.12A  ATGGTGGAAACTCTTCAGAAACA TGGAAATCTTAATCAGGAGCAAA III-6I21
86  E12 III Y56A3A.12B  ATGGTGGAAACTCTTCAGAAACA TGGAAATCTTAATCAGGAGCAAA III-6I23
86  F02 III Y56A3A.14   CATCTTTTCCCCCTCTTTCTCTA AATATGGGTCTCGTACCCTTAGC III-6K03
86  F03 III Y56A3A.15   CATAACAGTCTGCATCTTTTCCC AAACACGCTAGTTAGTCTTCCCC III-6K05
86  F04 III Y56A3A.16   GCGTCCTCATAATATCAATGCTC TCGATCAAAAACCAACTTTCTTC III-6K07
86  F05 III Y56A3A.17A  AAACAGATTTTCGTTCAGATTCG CCAACTCCAAGCTTTGTGTATTC III-6K09
86  F06 III Y56A3A.17B  AAACAGATTTTCGTTCAGATTCG CCAACTCCAAGCTTTGTGTATTC III-6K11
86  F07 III Y56A3A.18   AGTATTGCTCAAGTCTCTGCCAC TTATTTTCATTTTCCCTCCCCTA III-6K13
86  F08 III Y56A3A.19   AAAAGCGGCTACCATAAACTTTC ATTTGTTCAGAAATGTTGCGAGT III-6K15
86  F09 III Y56A3A.20   ATAGACACATGAAAAATGACGGG AAGCTATTTTCGATTTCTGTCCC III-6K17
86  F10 III Y56A3A.21   ACGTGAAACTGTCGAGAAAACAT AAAAAGGGGCAAAAATCAATAAA III-6K19
86  F11 III Y56A3A.23   CTACATGACGACACTTTTGCTCA ATTTATACACACTCGGAAGCACC III-6K21
86  F12 III Y56A3A.28   AAATTGGGTCAATCAGCTTGTAA GGATGATCAACCATCAGAAGAAG III-6K23
86  G01 III Y56A3A.29   AAAATCGTTGAAACGAATGAAAA CCGTTTATTTCAGAATGTCGAAG III-6M01
86  G02 III Y56A3A.30   TCTGCAAATGTTTTATTCCTCCA ATTTCCTTTCGAAATCACAACAA III-6M03
86  G03 III Y56A3A.31   CCAGCACGAATACCTAATACCAC TTTTTGAGGTATTTTCAAGCCAA III-6M05
86  G04 III Y56A3A.32   CCGAAATTCCTAAACTTTTCCAG AGTCGTCCACTAATCTGTGCATT III-6M07
86  G05 III Y56A3A.33   GACCCCATGACAATAAAAACTGT AAATATTTTAGTTCCCCGTTCCA III-6M09
86  G08 III Y79H2A.3    ATACATTGTGAAATCAACGGAGC TCGAAAAATGGAAGAAGACGATA III-6M15
86  G09 III Y79H2A.4    TGCATTTTTCTTGTTTCTTCCAT AGACGGTCTCATTCCTTTTCTTC III-6M17
86  G10 III Y79H2A.6    TTGAAATCGTTTAAAAGCGTCAT TGTCGACAAAATAAGCCGTAAAT III-6M19
86  G12 III Y75B8A.1    ATTCTAGTTGACCACCGTCTGAA TGAACAATTCTAATATGCCACCC III-6M23
86  H01 III Y75B8A.2    CATATACAACTTGAAAGGGTCGC GATCTCCAAACCCAAATAACTCC III-6O01
86  H02 III Y75B8A.3    TTATTTGTCTGTTGGCCTTGAGT GAGTCCGATGAGTCAGAGTGAGT III-6O03
86  H03 III Y75B8A.4    CTACCATGAGGGGCTACCTAACT ATTTCGCAAGAACTGGTGATTTA III-6O05
86  H04 III Y75B8A.5    TGTGTTCTATCAGAAGCTGCAAA GGAACGACGTGTTAATGCTATTC III-6O07
86  H05 III Y75B8A.6    ACCCAAAAATTAAAACTTTCCCA TCTGAGAAATGAAAAATCCGAAA III-6O09
86  H06 III Y75B8A.7    GCGAAAAATTCAATTCAAAAATG AAGCTGTAATTCCGACTTCTTCC III-6O11
86  H07 III Y75B8A.8    AATATTTCTCACACACCCACCAC GGTTCTAGATGGGTATTTTTGGG III-6O13
86  H09 III Y75B8A.10   ATTCTGCTTGCAGACTTCATAGG AGCTAGCTGTTTCGTTTTGTTTG III-6O17
86  H12 III Y75B8A.13   TCATCAGATCTTTCTCCAGCTTC AACGGTTTATTTTCTGTCATGGA III-6O23
87  A02 III Y75B8A.17   TTGCGTTGAAATTTGGTAAAACT AAAATTTCAGATGAGCAGAATCG III-6A04
87  A03 III Y75B8A.18   CCTTTAAATTTACCGTACCCCAA CAAATGCTCCGTTAAACGTATTC III-6A06
87  A04 III Y75B8A.19   AGCTTGTTTGTCACCTTCAAGAG GACGTGTGGTGTGAACAGTAAAA III-6A08
87  A06 III Y75B8A.21   AGTTTTATAGTCCACCGGGTGTT TAGGGAGCTTTTCATGTCTTCAG III-6A12
87  A07 III Y75B8A.23   AGCCAATTTTTCGGTTTAAAGTC AAATCGTTGAAAAACAACGAAAA III-6A14
87  A08 III Y75B8A.25   AAATGGATGATGATGTCCCATAC CTTTTTCTCGTTTTTCCTCCATT III-6A16
87  A09 III Y75B8A.27   AGAATATCCAACAGCAACAAGGA TTTGCCTGGAATTCAAAAATCTA III-6A18
87  A10 III Y75B8A.28   CGATTCAATCATTGCCTCTTATC TAGCAACATCCAATTCTCGTTTT III-6A20
87  A11 III Y75B8A.29   AAGTTCGTTACAAAAACAGTCGC ATTTTTCTCAAATCCACTGCAAA III-6A22
87  B01 III Y75B8A.32   TCTTTTTGATGGCAGTTTTGTTT AAAATGAACAACTTCGTCTTGGA III-6C02
87  B02 III Y75B8A.33   CCCCAAATCACAAACACATAACT AAGTCCGATAATATTTCCCGTTC III-6C04
87  B03 III Y75B8A.34   AAAAACTTATTGAGGAAGCCCAG TAATTTCAAGACCTTCGAAGCAG III-6C06
87  B05 III Y75B8A.36   GGCACGAAAGAATTTATTTTTGA GAAGAAATAAGCTGCTGCACAAT III-6C10
87  B06 III Y49E10.1    ATTTCAGCACAAAAGTCGATGAT CACCTGTTTTAGGCATTTTCAGT III-6C12
87  B07 III Y49E10.2    ATTTATTGTCTTTGACCTCCCGT TAAATTTTCCTCTAAAACCCCGA III-6C14
87  B09 III Y49E10.4    CAAATCGTAAATTCGAGCAGTTT CTATTGAAAAGAGCTTGGAGCAA III-6C18
87  B10 III Y49E10.6    ATTTCCAATGACTCGAAGAAACA TTCTCCTTCTGCTCTCACATTTC III-6C20
87  B11 III Y49E10.7    CACGAGGAACACCAGTAAATCTC AAAGACTCAACTTTCTGTGTCGC III-6C22
87  B12 III Y49E10.8    GGGAAATGGTAACAACAAACTCA GTTCATTCATTCAAACATGCAAA III-6C24
87  C01 III Y49E10.9    TCGATATTCCCTTCTCCTTAACC ATTCTACCTAGCACGAGGTTTCC III-6E02
87  C02 III Y49E10.10   ACATTGATATTTTCAGATCCCCC ATTCTCAGTTGTGGCAACAGTTT III-6E04
87  C04 III Y49E10.14   CTGCACTCAACAACTCAGATGAC CACAAGTTCATTCACAGGACAAA III-6E08
87  C05 III Y49E10.15   AAATGAACAAAGAGATCCGTGAA CGAATTTCTCGTTGTTTTTATCG III-6E10
87  C06 III Y49E10.16   TTCTTATAATTTTGGGTCTCGCA CCAATTCAAAACCACTAACCAAA III-6E12
87  C07 III Y49E10.17   ACTAAGTGCCTGTGGAGTGTCTC CACAAATCACAGGTTCAAGTCAA III-6E14
87  C08 III Y49E10.18   TGGATAAGAGTCCAATTGTCGAT CGGAACTACCTGATAAAGCACAC III-6E16
87  C09 III Y49E10.19   CATGTTCACTGACAACTGGGATA CAAACTCAATGGAGAGGACAATC III-6E18
87  C10 III Y49E10.20   CATATTAAGTCGTGTGAGCACCA ACAGACGGAATATACGAAGTGGA III-6E20
87  C11 III Y49E10.21   AAATTTGTGAACACGATAAACCG GTTGAACTTTTCCTCGAATTCCT III-6E22
87  D01 III Y49E10.23   CAGAAATGTTCAAAATCAGCACA AAACTCACCTTCCCTTCTTCATC III-6G02
87  D02 III Y49E10.24   CCATCAGAAGGACACTCAAAATC GCAACCTCCTGATAGGTAGGAGT III-6G04
87  D03 III Y49E10.25   GCAGGTAGGTAGGGATAGGTGTT TCTGGTCTTCCTTATTGCATTGT III-6G06
87  D04 III Y111B2A.a   CAAGAAATTCGGTGTTTTCAGAC ATGGAAAACGAACAAACTTTGAA III-6G08
87  D05 III Y111B2A.b   TACAGAAACTACGACGTGAGCAA AAAAGAATACGGTGACTTAGGGC III-6G10
87  D06 III Y111B2A.c   ACAAGATTTGGCCTCTGGTATTT ATGATTTTTCTCTCTTTTTCCGC III-6G12
87  D07 III Y111B2C.a   GATCGGAGGAAAAAGTGAAGAAT AGAAAAGACGCAGACATCTCAAC III-6G14
87  D08 III Y111B2C.b   GCAAAATTCGTAGATTGATCAGG TAGATTTCACAAAAGCCCAGAAA III-6G16
87  D09 III Y111B2C.c   ACATGCCCTCATTTCAAAGTAAA GTCCCCTTTCAGAAAAGATTCAT III-6G18
87  D11 III Y111B2C.e   AGATTCCAAAATGCACAAAAAGA GTTTCAGCATTTTCAGGCACTAC III-6G22
87  D12 III Y111B2C.f   TCCATATTCTCCTCGTGATTCAT TTTTTACAAAAACTTGGCTGGAA III-6G24
87  E01 III Y111B2C.g   TTCTTCATTTTTGGTTTTCAGGA AATTTTTGCCCATTTTGATTTTT III-6I02
87  E02 III Y111B2C.h   CGGTATCGAATTAGAGCATAACG TTGAAATTGAAATTATGGTTGCC III-6I04
87  E03 III Y111B2C.i   CTCAAAATCCTACCGAATACGTG ACCACAACCGCTACAGTAGTCAT III-6I06
87  E05 III Y111B2C.k   CACCGATAATTTTAATTCCGACA ACTTTTAATGCCGCTAATGATGA III-6I10
87  E06 III Y111B2C.l   CAAATACTACTGGCTCCAAATCG TGCGCCTTTAAGGAGTACTGTAG III-6I12
87  E07 III Y111B2C.m   AGTGTTACCGTTGACATCGAACT AGAAGAAACCGATGATCTAAGCC III-6I14
87  E09 III Y111B2D.b   TCAACAACAAACAAAAGTCGATG GCTTAGGGCTACTTTTCTCGAAC III-6I18
87  E10 III Y111B2D.c   TTCACAGGAAAACTTGCAAAAAT CTTGTAAAGCAAGGTCACCAATC III-6I20
87  E11 III Y111B2D.d   AAAATTTGGGCGAAAAGTGTTAT ATAAATCACCGCAGTTTTTCTGA III-6I22
87  E12 III Y111B2D.e   TATGTTGTGCAGTACGCATTCTC TTTTCATTTTTACGCCTGTAAGC III-6I24
87  F02 III Y111B2D.h   CGATACCGTTTCAAGAATCAGAC TTCAGTGTACTAAACATGCCACG III-6K04
87  F03 III Y111B2D.i   AAAATTTTTGGGTTAAGACGGAG ACTACAAACTACAAACGGACGGA III-6K06
87  F04 III Y111B2B.a   TCGGCTTTTGACTTTTGAAATAA CCAAGTGATGGATAAAACCGTAA III-6K08
87  F05 III Y111B2B.b   GGGAAATTGAAGGAAATTGAAAG GTGGATTTTAGTGGTTTGCAGAG III-6K10
87  F06 III ZC482.1 TTCCGATTCTTCACTTATCGTGT TTGACTTAATTTCCAGACGGGTA III-6K12
87  F08 III ZC482.4 CAAAATTCGCTCACCTAGTTCAC ACGTGTGGGAAAGTCATGTAATC III-6K16
87  F09 III ZC482.5 ATTTTGGCAACGTCTTCGAC    TTGTGTCGGGCATGTTTTTA    III-6K18
87  G01 III BE10.2  TTGAAAGCGCTGTGACAAAC    CTGCCATACAAGATGCTGGA    III-6M02
87  G02 III BE10.3  TGCGACAAATCGTAGAGCTG    AAAGTGGCAAAAGCTCGGTA    III-6M04
87  G03 III BE10.4  TCATGCAAATTCTCTCACTCTCA CAACACTTACAGCCATTCTTTCC III-6M06
87  G04 III Y37D8A.1    ACAAAAAGTAAAACTGGACGCAA ATGCATTTTTCCAAACAAAACAC III-6M08
87  G05 III Y37D8A.2    AAAAGTTCAAATTTCCAGCTTCC TCATTGAGAGAATTACTGCCGTT III-6M10
87  G07 III Y37D8A.4    ACACAAAAATTTGGGGAAAGATT TTTTGGCTTTTGAACCTTGTTTA III-6M14
87  G08 III Y37D8A.5    GCACAAAACGGATGGAAGTT    CAATTTCGATTGCGATGATG    III-6M16
87  G09 III Y37D8A.6    ATTCAATGGGGAAGACAGAATTT AGTAAAAGTTCACATGCCCTTCA III-6M18
87  G10 III Y37D8A.7    TAATACTTTGTCGCGTATCCGTT ATAAAACGCACTCTTTTTGTTGC III-6M20
87  G11 III Y37D8A.8    GGCTATAGAATTGCAATGTCAGG GCATGTACTGCTGGATGATGTTA III-6M22
87  G12 III Y37D8A.9    CAATTTCCCCATTTTTCAATTTT GAATTGCTGCTAAAACTCGCTTA III-6M24
87  H01 III Y37D8A.10   TAAGCGAGTTTTAGCAGCAATTC GGGAAATAAATTAGGCCAAGAAA III-6O02
87  H02 III Y37D8A.11   AGGTTCAATTCGAGCTTTCTTCT CTTCCATTTTCGTCACATTTCTC III-6O04
87  H03 III Y37D8A.12   AACCTGCAAAAATGGAAACG    TACATGAGATCCCGGTGTGA    III-6O06
87  H04 III Y37D8A.13   TTCTCTTCCCGATACGATGG    CGGTTCCGAAGAATGTGATT    III-6O08
87  H05 III Y37D8A.14   TTGCGATTTTCTCATCTTAAAGC ATTAAAGGGGCTCTGAAAAACAG III-6O10
87  H06 III Y37D8A.15   GCCTGACCTATCAATACATCTGC AAACGTCATGAGGATCAAAAGAA III-6O12
87  H07 III Y37D8A.16   TTTTTGACAAGTTTTGCTGGAAT TCTCACAATTGTCACACTGATCC III-6O14
87  H08 III Y37D8A.18   AACAAAAATTAAGGCAACGCATA ATTTTTCTGAATTGTCAGCGGTA III-6O16
87  H09 III Y37D8A.19   TTTCAACGTTTTTCTTCGATTTC TGATCGGAACAGGAATAGGTAGA III-6O18
87  H11 III Y37D8A.22   CCAACCTAAAGTTTGCCTTTCTT TCTCGTGGAGAAGATTTTAGCAG III-6O22
88  A01 III Y39E4A.1    CGGTGGCAAATCAAATAATAAAA CCTGAAAAATCGAACACTGAAAG III-6B01
88  A02 III Y39E4A.2    AAACTCCAAAATGAGAAGCCACT CAACATGGCTCAACTTTTACCTC III-6B03
88  A03 III Y39E4A.3    TTTTCAACGAATCCAGTTCTCTC AATTCCTTATTCCCTTCAGATGC III-6B05
88  A04 III ZK1010.1    CAAATCTCATTCCAAAAATCCAA TCAAAATATTGTTCTGGACGCTT III-6B07
88  A05 III ZK1010.2    CAGATTCCTAACCCTATCCGTCT TTGGATTTTTGGAATGAGATTTG III-6B09
88  A06 III ZK1010.3    AAATCGATCCAGACACCGTC    CAGACTTGTTGTCGTCGGAA    III-6B11
88  A08 III ZK1010.5    TTCAATGCTTTCTCTTCCTCTTG AACTACAGCTGATTCAAATGGGA III-6B15
88  A10 III ZK1010.7    GGGAAACCACGAAGAGATAAGTT GACCCAATTCCAGAAGTCATACA III-6B19
88  A11 III ZK1010.8    CTCTTCTCCAATCCGGAACTATT ACATGGTGAGACAGGTTTTGAGT III-6B21
88  A12 III ZK1010.9    TCTCATCCTGATCGAACATTTTT TCAATGTATTTGTCCGTGTGAAG III-6B23
88  B01 III F14F7.1 CCAACGGAATCGAGACCTAA    GGAGCAGAAGCTCAGCAGAT    III-6D01
88  B02 III F14F7.2 TTCTGGCATTTAAAGCACAATTT ATATAGGCCAATCTCATTCCGAT III-6D03
88  B03 III F14F7.3 AAACAACCGTCGAAGAATGC    GCATCCCCCAAGTATTGCTA    III-6D05
88  B04 III F14F7.4 AATGCCTAGCCGCCTTTAAT    TGTGATCATCCCGATTTCAA    III-6D07
88  B06 III F54F12.1    ATTTCAGCGTGTTGCTCCTT    CGCCAAAGTAAGCTACGAGG    III-6D11
88  B07 III F54F12.2    TTTTGGCTTTCAAGTTTCCATAA AGAGAGGGGCATGATAGTTTCTC III-6D13
88  B08 III Y39E4B.1    TCTTATTCAATTTCATCGCGTTT ATCATCTTGATCATCGTCGTCTT III-6D15
88  B09 III Y39E4B.4    ACCATGTCATTTTGCACTTTTCT TATTTAGGCAAAAAGCCAACAAA III-6D17
88  B11 III Y39E4B.6    CGCTCGACAAGCTGTTTATTACT TATCGGAACATACCGTAACCATC III-6D21
88  C01 III Y39E4B.8    AATATATTGGAGAACAGGCCCAT AAGATAGCAAAGGCAAGGTTAGG III-6F01
88  C05 III Y39E4B.13   GGTGAAAATAGTTAGCGCTGTGT CCACTTTATTGAAAATTTCGACG III-6F09
88  C07 III Y43F4A.1    GAACACGAACATCCACATCG    TACCATCCCGTATCCTCCAA    III-6F13
88  C09 III Y43F4A.3    CTCATTTTTGAACGAATTGAAGG ATTCACAAGAAAAACATCCGCTA III-6F17
88  C10 III Y43F4A.4    TTGACTCGTTGACTTGACTTGAA AAATACGAGAGACGCAGAGACAC III-6F19
88  C12 III F56A8.2 GAGCTCAAAAACTTGCAAGAAGA AAACTAGCCAGTCTGGAGGAAAT III-6F23
88  D02 III F56A8.4 TCCTCAGGTTGCCCTATTTG    CTCCTGGAAACCTTTCATGC    III-6H03
88  D03 III F56A8.5 AATCTCCCGGAGCTCAGTTT    TATGCCAAACCACCATCTCA    III-6H05
88  D04 III F56A8.6 TGGCTTGTACTGCTGTGGAG    GACACGATTCGCTCCATTTT    III-6H07
88  D06 III F56A8.8 CAAGTTCACATACGCCTAGCTCT CGCAGTGACATGAAATTAACAAA III-6H11
88  D07 III Y43F4B.1    TCATAAATCGAAATGGCAGAGTT ATGTCTTGAAAGCCGTGCTAATA III-6H13
88  D09 III Y43F4B.3    CGCTGCTAACTTCGACAGTAAAT AACGTACCCCCTCTTCTAATCAA III-6H17
88  D10 III Y43F4B.4    ATGTGCCAGCGATATGACAA    TTGGTTCACGAAGAGTGCTG    III-6H19
88  D11 III Y43F4B.5    CACATCTCTGCGTCTCTCCA    TACCAGTGAACACACGCCAT    III-6H21
88  D12 III Y43F4B.6    CATAGCGAAGCGTGTTGAGA    ATTGTGCGTGAACTCTGACG    III-6H23
88  E01 III Y43F4B.7    CACCACGAAGAAATACAGTTTCC ATGAGTTCAAAACTCCATTCCAA III-6J01
88  E03 III F53A2.1 TGCATTGCTCACTAACCTGC    ATGCTCCTCCCCTCTTGTTT    III-6J05
88  E04 III F53A2.2 TAATTTTCCCATAATCGTGCAAC CTTAAAAATGGGAATTACAGGGG III-6J07
88  E05 III F53A2.3 TGTAAGAGTAATCCTCGCTTTGC TCCGAATAAGTTCCGTGTAGTGT III-6J09
88  E06 III F53A2.4 AGCATTATGAGCCACCTGCT    CCATCCAAGTCGCTCAATTT    III-6J11
88  E07 III F53A2.5 TTTGTGAGATTTGTTCCGAAAAT CAACTAATCGTGCCCTAAATGAC III-6J13
88  E08 III F53A2.6 GTCATTTAGGGCACGATTAGTTG CAATCACAAAACAACGAGTGAAA III-6J15
88  E10 III F53A2.8 CAACTACACACATCATCTTCCGA GACACATGATGTACCTCGACTGA III-6J19
88  E11 III F53A2.9 AAGGTGTTTTGGCTGATTGG    TTCTCCGGAACACTCATTCC    III-6J21
88  E12 III T03F6.1 TTTACTTTTTCCTTGCAGTTTCG AGGCTGAAAAATGTCGGTAAAAT III-6J23
88  F01 III T03F6.2 AGGCGGAGCGATTTAATTTT    GCGTACGACGTTTTGAGTGA    III-6L01
88  F02 III T03F6.3 CATTTTTCCTACATGGCGCT    AACTCCAACGTGGCATCTTC    III-6L03
88  F03 III T03F6.4 CCTGCCTACATGCCAAAAAT    ACTTCCGTGTAAGCGGAGAA    III-6L05
88  F04 III T03F6.5 AACAATTTATTCGTCGGGTTTTT AAACATTATTCCGCCTTCAATTT III-6L07
88  F05 III F11F1.4 AGAAAAACGGAGCATTGTATTGA AGAGTGACCAACTGTCTGGTGTT III-6L09
88  F07 III F11F1.6 CATTCCAATGACCTTTACTCTGC TTCACTTGTCCGTCTTCTTGAAT III-6L13
88  F10 III F45G2.2 GGAGCATTGTCCAAAGCAAT    TGTCACTATTTGCTGCTGGC    III-6L19
88  F11 III F45G2.3 ATGTGGTGGAGCTTTCAAGG    TTCGGAAAAAGGCACAAAAC    III-6L21
88  F12 III F45G2.4 AAATCTTGTTTCCTTCGATTTCC TCTCATTGAAATCGATAACCCAT III-6L23
88  G01 III F45G2.5 CGAACCGATACAGTAATCCTCAC AAATTTCAGAGTCCAAAACTCCC III-6N01
88  G03 III F45G2.7 TCTGAATCCTATCCATCATTGCT TCAGAGATAAATGGCTCCAACAT III-6N05
88  G07 III F45G2.11    AGAAGCAGCACCTCGAAAAA    ATTTTTGCTGAATGTTCGCC    III-6N13
88  G08 III Y76A2A.1    GGAAGCTCTTCGTGGAGATG    CCAAGACCAGGGCGATAATA    III-6N15
88  G09 III Y76A2A.2    GTGTGATGAGAGTGAGATGACGA AAAAAGAAGCATCACTTGCAATC III-6N17
88  G10 III Y76A2A.3    GCCATTTATGTTGCTTTGTTTTC AAGAAGAACGAAAAACCTTCCAC III-6N19
88  G11 III T27E9.1 TTCCCACTATTGCTTCTGGC    CCCTTGAACATAGCGGACAT    III-6N21
88  G12 III T27E9.2 CGAGAGCGAAAATTCACATAAAC TCTAAACGTGTTCGTTCCTTCAT III-6N23
88  H01 III T27E9.3 TTACGTCACCCGAACAAACA    TTTTCCCACCTCAAAAATGC    III-6P01
88  H02 III T27E9.4 TATGCGTCAAGGAGTGGTTG    CATCGCAGCGACATACACTT    III-6P03
88  H03 III T27E9.5 AACGCAATGTTTCGAAATTAAAA ATGCGAGAATACACGAGATTGTT III-6P05
88  H04 III T27E9.6 CAGATCTTCATCCTCATCCTCTG CTAACTCCCTTGCAAAATCAAAA III-6P07
88  H05 III T27E9.7 ATTGAGCTTGACGAGCGAGT    GACAACAATGCCGTCTGATG    III-6P09
88  H06 III T27E9.8 TTTTGTAAGAATGGGGGCTG    TGTGAGGAGAGGAAAGTGGG    III-6P11
88  H09 III T28A8.2 AATACACAAACCGGATTTCCTTT ACGTACCAATATATGCTGAACCG III-6P17
88  H10 III T28A8.3 CTGGAAAAGTTGCGGATGAT    CCGAAGAAGAATGCCTCAAG    III-6P19
88  H11 III T28A8.4 AGCTTTTTGGCGTTGTATGG    GTTTTTCGACTGATCCCGAA    III-6P21
88  H12 III T28A8.5 GCACAAGCACCGAACTATCA    ACTTGCTCGCAGGAAATTGT    III-6P23
89  A01 III T28A8.6 GAGGCAGTACGAAAACGCTC    TTGATGTTCGACGAATGGAA    III-6B02
89  A02 III T28A8.7 AGGATTTAGGGCGTCAAGGT    TCCAACTGAGAAGATGGCCT    III-6B04
89  A03 III Y76A2B.1    TCTCGGGTTCCATCTCATTC    GTCTGGCAAGGGAACCAATA    III-6B06
89  A04 III Y76A2B.2    GACTGCGCATGATACCTTTTTAC ATTGTGGAGATGATGAGAGGAAA III-6B08
89  A05 III Y76A2B.3    AGCGATGAGCCATCTGAAGT    ACGTCAGGAACCACTGGAAC    III-6B10
89  A06 III Y76A2B.4    CCGGTAGCTATAAGGGGAAAGTA TTCACTTGTTGTCACCTTTTCAA III-6B12
89  A07 III Y76A2B.5    TTTCAGAAATTCCAACATCCTGT CGTAATTCTCCCTCTAGCTGTCA III-6B14
89  A09 III T05D4.1 GAGGTGACCATGTTTGGCTT    CTCTTGCACATTTTCAGGCA    III-6B18
89  A10 III T05D4.2 TCTTTTCATTATCCCGCGTC    TATTCGCAACGCATTACAGC    III-6B20
89  A11 III T05D4.3 GAGTTCCCAAAACTCACCCA    TCGCCTACTACCGAAGCAAT    III-6B22
89  A12 III T05D4.4 TCAAGAAGTTCTGCCCGAGT    TCAACCAACAAGAATGGCAA    III-6B24
89  B01 III T05D4.5 ATCCGAATCCGTTTATCAAAAAT AGCACATTTTCAGTGTCTCCATT III-6D02
89  B02 III Y76A2C.a    GCGACTGTTTCATTCAAGACTTC CTCACTTGAACTTTGAAACTCGC III-6D04
89  B03 III T25C8.1 GCTGGACTTCAAAATCCGAA    TTCATTCCCGAAATAGCACC    III-6D06
89  B04 III T25C8.2 CCTGCTTGGAGATCCACATT    CACCCAGTTCTCCTTACCGA    III-6D08
89  B05 III T25C8.3 AAGTTGGTATGGCATCTGGC    TCCTCATCCGACAAAGATCC    III-6D10
89  B06 III T12D8.1 CTGTGCTCTCTGGAGTGCTG    GTTCGGAAGTGTTGTCCGAT    III-6D12
89  B07 III T12D8.2 TTAGACATTCAGAAGGGGTTGAA ATTTCAGAAGACGTCTCACTTGG III-6D14
89  B10 III T12D8.5 CCTGCCAATGATCTCTATGAAAC TCCATGCTTTTTCAAATTTTGTT III-6D20
89  B11 III T12D8.6 CTCATTCTCTCTTTTATCGCCAA CTGGGAGAGAGCGAATAAGAAAT III-6D22
89  B12 III T12D8.7 GTTATTTTTGTGGGGAAATCCAT CTCTTCGCTTGAGCATATTCTGT III-6D24
89  C02 III T12D8.9 CATCAGGAAAAGACGGATGATAG AGATCTTCGATATTTGCATTCCA III-6F04
89  C03 III ZK525.1 AAAAGTTGTTGGCAAGAAAATGA CAAGATTGGAACAATGGGAATTA III-6F06
89  C04 III ZK525.2 ATGGAAATCTCGGGTCCTCT    GGTTGCCAAAAAGCAAATGT    III-6F08
89  C05 III ZK520.1 TTTTTAACTTACGCGTCGGG    TTGCAGTGCTACGAAACAGG    III-6F10
89  C06 III ZK520.2 ATTGGCAAATTCACAGATAAACG TTTTGTAAACTTTTGGCAGGAAA III-6F12
89  C07 III ZK520.3 CCAAAGTTGACAGCAGCGTA    TGAATGGAAAAGGTGGAAGC    III-6F14
89  C09 III ZK520.5 GAACTTGAACTTTGATCCACGAC CTTCGAGAAGCATCACTTCATTT III-6F18
89  C10 III W06F12.1    TTTTCACAGTAGACACCCGAAGT TTTTGAAAGAACTGTGGCATTTT III-6F20
89  C12 III W06F12.3    TATTTTTAGCCGCCGATGTC    CACCTGGCGGAACACTATTT    III-6F24
89  D01 III K08E3.1 CCAACTCCAGCAACCAAGAT    GACAGGGGAATAGGGCAAAT    III-6H02
89  D02 III K08E3.2 TTGATTTGCTTGAACGCTTG    CTCATTGATTCTCGGCCAGT    III-6H04
89  D03 III K08E3.3 TCACGGTTCAGGTAAAATTCCTA GTCGAAAAATACTGACTCAACGG III-6H06
89  D04 III K08E3.4 GCATCATACTGAGACGCATAGTG GAAATCGTGTCCTGAAAATCAAG III-6H08
89  D05 III K08E3.5 CATATAAACGGCACTACTGAGGG GCATTATGGCATCTTCGACTTAC III-6H10
89  D06 III K08E3.6 TGGTTTGTCCTGGTGTTTGA    ACGGTTTTCACGCATTTTTC    III-6H12
89  D09 III 3R5.1   ATTTTGATCTACTGGCCCAAGTT ATTACTGGCACGATTTGAGAAAA III-6H18
89  D10 III 3R5.2   TTTCGTCTTTTGATAAACTGGGA AAACTTTCACTTGAAATGCCAAA III-6H20
89  D11 III C37G2.1 ATTTCCCGTTCTCGACACTG    TGGGATCTCCAGACTGGTTC    III-6H22
89  D12 III C37G2.3 TCTTTATTTGGTCAACCCGC    CGACCCTGTTCGTTCACTTT    III-6H24
89  E01 III C37G2.5 CCGGGATCATGGATACTTTG    TTCAGTGTCAACTTGCTCCG    III-6J02
89  E02 III C37G2.6 TCGAATGATCAACGGAATCA    TCACTTGCATTGGCTCTGTC    III-6J04
89  E03 III C37G2.7 ACCGGGATGTACTTGCACTC    GTTACGGGCAGAACTTCCAA    III-6J06
89  E04 III C51G7.a AAAATTTTGGAGGGAAATTCAAA ACCAAAACTTTGCGAACATTAAA III-6J08
89  E05 III C51G7.b TGCCCTTCCTGTATTTGAAGTAA AACTTAACAGACAACAAATGCCG III-6J10
89  E07 III C51G7.d TTAAATCAAAATCCGCAACAACT ACAGCACAAAAAGAAGGAACAAA III-6J14
89  E09 III C51G7.f AGAAAATGCTCAACGAACACAAT AACATTCTGCTTTTCACCAACAC III-6J18
89  E10 III C51G7.g GACCACACCAAAAAGTGTTAAGC TCCTCTTTGGATGACTGTTTTGT III-6J20
89  E11 III C51G7.h CTTATCGTGAACTGATGGTTGTG AATTTTTCGTCGTATTTGGATCA III-6J22
89  F01 III C51G7.j AAAAATTTCCAGATTTCTACCGC AAGCTTTTCCCACTTTATGATCC III-6L02
89  F02 III M02C10.1    CGTGAGCGAGGATAAGAAGG    TTAGTGGCTCTTGGATTCGG    III-6L04
89  F03 III Y119D3_438.a    CTTAAAAATCCTGGGTCATGTCA ACGTGTCAGGTAAATGCTCTGAT III-6L06
89  F07 III Y119D3_442.b    AAAACTTCCCGAGCTGTAAAATC TTGCCTCTTTGAAACTATGGAAA III-6L14
89  F10 III Y119D3_443.c    AGTTAGTTGGGAAGGTCTTGAGG TGATGATGTCATCTACCGCATAG III-6L20
89  F11 III Y119D3_444.a    CTCTTTCTCTACCGCTACCCATT ATGAGATGTCTGCGTCTCTTCTC III-6L22
89  F12 III Y119D3_444.b    TGGGAGAATTTGGTTATTGTGAC ACCCCATAAGCCTAAAAATGAAA III-6L24
89  G01 III Y119D3_445.a    CGAGAGCTTTTCAATACTCTGGA TGCTCCAAATTTCTAGTCTTTGC III-6N02
89  G02 III Y119D3_445.b    ACACAGATATATGCCAATACGCC AAATGTGTAGAATTGTGCGCTCT III-6N04
89  G03 III Y119D3_446.a    TTGGAAAAAGGCTGAAAATTGTA AAGAACTTTCATCCAGCCATGTA III-6N06
89  G04 III Y119D3_446.b    TTGGAAAAAGGCTGAAAATTGTA GAAGCTCATTGGCTAGAGATGAA III-6N08
89  G05 III Y119D3_446.c    ATGAAACCCATAGTCAAGCAGAA AGTTTTTGGAGCGATTTTCTACC III-6N10
89  G06 III Y119D3_446.d    TTTTCTCCAAATTTTTAACGCAA ATTTCCAATTCATTTTCCCCTAA III-6N12
89  G10 III Y119D3_448.a    AGCTGTGCTGATTTCAAAAAGTC ATTCCCCTAGATTTCTCGAGTTG III-6N20
89  G11 III Y119D3_448.b    ACTTGCATAGAAATTCGGTCAAA GATCGACAAAGCGGTTATCATAG III-6N22
89  G12 III Y119D3_450.b    TAACTCCCGTAAATCGCTTCATA TGAAAATTCGTCGAAAAATCAGT III-6N24
89  H02 III Y119D3_450.d    AATTTGGCGATTTTTAGGGATAA TGAAAATTCGTCGAAAAATCAGT III-6P04
89  H04 III Y119D3_451.a    AAAGACGGGGATACGGTAGATAG ATTTATTGATAGCTTTTCCCCCA III-6P08
89  H05 III Y119D3_451.b    TTTTGGAATTTTGGCTTTGACTA ATCGGAATGATAAGAAACCCCTA III-6P10
89  H06 III Y119D3_451.c    TAAAAACTCCGATTTCTGGATGA GGGGTTATTTTGAAGCTGAGAGT III-6P12
89  H08 III Y119D3_455.a    AAGCCTAAGCCTAAACCTAAGCA GCCTAAGCCCAATCCTAATTCTA III-6P16
89  H09 III Y119D3_455.b    AAAAGGATCACAATTTTTCCCAT AATTCAGCTCATTGAGAGCTTTG III-6P18
89  H10 III Y119D3_455.c    ACTTTATGTTTTCCCCTCGAGAC CCCCCAGAACACTAACTTTCTCT III-6P20
89  H12 III Y119D3_456.a    CATGAAGACCTTGGTGGAAAATA AGTAACTCTCACACACGTCCGTT III-6P24
90  A01 III Y119D3_456.b    AGAGCACTTTTGTCATATTCCCA TGATTGCAACGAGAGACACTAGA III-7A01
90  A02 III Y119D3_456.c    AAATGAGAAATGCAGATTTGGAA TCAGTGGGTCCTATAGCAGTTGT III-7A03
90  A03 III Y119D3_456.d    AATACGAGGTCGCTATCATTTCA ACTTAATTTGCCAACACAATGCT III-7A05
90  A04 III Y119D3_457.a    CGAGGCCTGGCTTTATTATATCT ATACTTTTCTCAAATGCCAACGA III-7A07
90  A05 III Y119D3_457.b    ATCAAATTTCTCGTGTGCAAAGT TTCTGACTCAATTAACCCGAAAA III-7A09
90  A06 III Y119D3_457.c    GGCAGAATTTTGAAATAAGAGCA TCGAATATTCAAACGACGAGAAT III-7A11
90  A07 III Y119D3_460.a    CAATTTGATGTCCGTGGTATTTT TACTCAGTTTCAGACAGCCTTCC III-7A13
90  A08 III Y119D3_460.b    CTATAACTCTGCAGGGAATGGTG GCATCCCTATGATTGAACTTTTG III-7A15
90  A09 III Y119D3_460.c    ATGTTTCAATAGGTTTTCCCGAT ACTCTCCAGACTTTGCAGTTCAC III-7A17
90  A10 III Y119D3_462.a    ACCAGTCCACTAAAACAAGCAAA GCGACTTCAGTCTCGAAGAAATA III-7A19
90  A12 III Y119D3_462.c    AATATGCCTCTGGACATTGCTAA AAAAGATTTTCCGAACATAAGCC III-7A23
90  B02 III Y119D3_463.a    AACTCAAAATTTGCGAAAAATCA AATGTGAAAATTTGCTGGAAAAA III-7C03
90  B03 III Y119D3_463.b    TGATATTTCCCCAAAATGTTGTC AATTACAGTAGCCGGGACTTTTC III-7C05
90  B05 III Y119D3_463.d    CCAAACAACACTGATCTTAAGCC GAGTAAATTATCGATTGATGCGG III-7C09
90  B08 III Y119D3_464.c    TTAGGATTAGGCTTTGGCTTAGG ATCGACTTTGAGAAAATGAGCTG III-7C15
90  B10 III Y119D3_464.f    TTTGAATCGTGAACTTATCAGCA CAGACAGGCAGAAGAACACTTTT III-7C19
90  B12 III Y119D3_464.h    CTAAGCCTGAACTCTACACGGAA ACAAGTCGGTGTCGTAACTGTTT III-7C23
90  C01 III Y119D3_464.i    TACCCATTCTAAGTGCCAGAAAA TTTTCAACCTTAATGCCTTTCAA III-7E01
90  C02 III Y119D3_465.b    TAAGGGAGTAGCCAACGTATTCA TTCAAGACCTATTTTCCCAGTCA III-7E03
90  C03 III Y119D3_465.c    AAGCTGAAGTTTTGTCGCATTAG TATTCATTCCAACAACATCCACA III-7E05
90  C04 III Y119D3_465.d    TGGAAGTTATAACAGTTTTGGGC AGTTATTTGAGAACTGGGAAGGC III-7E07
90  C05 III Y119D3_465.e    TTTTGAGACCTTGCTCACTTCTC GGCCCAAAACTGTTATAACTTCC III-7E09
90  C06 III Y119D3_465.f    TTTGAGAATGATGTGTCCAAGTG GTACACAGTAATTTTGGCGCTTC III-7E11
90  C07 III Y119D3_465.g    GGCAAATTGTCGTGATTTAGAAG CTCACCTTTAGCTCAGTTCTGGA III-7E13
90  C08 III Y119D3_465.h    ATCTTTTTCACGTCTTGAACCAC ACCAGAACTTTTGACCAACAGAA III-7E15
90  C09 III Y119D3_465.i    TGGATATTTGGATCGATATCAGG AGACGTGAAAAAGATCTGCAATG III-7E17
90  C12 III Y119D3_465.l    TCAAGACGAAATAAGGCTCTCTG CATAATTTGGACCATATCAGCGT III-7E23
90  D01 III Y119D3_465.m    CACAAAAAGTTCACACCTCACTG ATTTGCCATGTAATCCATGTTTC III-7G01
90  D02 III Y119D3_465.n    GATATCAAAATGGACTCGCTGAC GTCAGCTTCTCATCCTTCTCAAA III-7G03
90  D03 III Y119D3_465.o    AATATTTCGCAATAGCTTGACCA TTTTGTAACCAGCTAACCGAAAA III-7G05
90  D04 III Y119D3_465.p    TCAATTACTATGCATTTTCGGCT TTTTTAAAACAAGACATGTGGGG III-7G07
90  D05 III Y119D3_465.q    ACAATGACACATTTGGAAGATCC AGATGCTGAAAATCGTCGTCTAA III-7G09
90  D07 III Y119D3_465.u    TTTTAAACAAATAGGTCTCGCCA TGTGCAAAATTTTATGAGCAATG III-7G13
90  D08 III Y119D3_465.v    CACAATTAGAAAGAGCGAGGAGA AACTTTGAAGCGCTGTATCTTTG III-7G15
90  D09 III Y119D3_465.w    AACGCTCTTGTGTCTATCCCATA GAAATTTTTGAGAGGGCTTTGTT III-7G17
90  D10 III Y119D3_465.x    GATTTCGAAACACGCAAACTAAC GTACCTTGACTTTATCCCCAACC III-7G19
90  D11 III Y119D3_465.y    ATGATTGCTCTGCCAAGATGTAT GCAAGCATATTATTGCAGGAAAC III-7G21
90  D12 III Y39A3C_78.a GGAGCTACAGTAACCCTGTTGTG TTGAGAAGAAAGACGATTTCAGC III-7G23
90  E01 III Y39A3C_80.b TATCGATTTTTGCAGCTTTCATT GAGATGCAAACCGATTTTAAGTG III-7I01
90  E02 III Y39A3C_81.a CGACTCGTTTTTGTGGTAAATTC GGTATTTATTCCCATTTTCAGCC III-7I03
90  E03 III Y39A3C_82.a TACTGTAGTTTTCGTGGCGAGAC TTTAAAAACTCAAAATTTCCGCA III-7I05
90  E04 III Y39A3C_82.b AAAATTGCATTAAACAGCGAAAA TCCAGAGTCCAAAATTAACGTGT III-7I07
90  E05 III Y39A3C_83.a TGCTCAGAGAAGAGATAGGGATG ATATGGGGCTCATTTTAAAGCTC III-7I09
90  E06 III Y39A3C_83.b TTCCTAACTTTGACAGCCCATAA AAGCTATTTACACGCCAAATTCA III-7I11
90  E07 III Y39A3C_83.c TCAACAAGACCTTTCAAATGACC ATTTTAAACAAATTCCCGTCGAT III-7I13
90  E08 III Y39A3C_83.d TTCATCATTTTTCAGCGATTTTT GTTTCTCGATTTTTCCTGGTTTT III-7I15
90  E09 III Y39A3C_84.a TTTTAGGATGAAAATTGGGGATT ATTTCAATTTTCCGGGTTACTGT III-7I17
90  E10 III Y39A3C_84.b TAATACTTGAAGAAACCTGGGCA TCACAGTTAGAGGTCCGGTAAAA III-7I19
90  E11 III Y39A3C_85.a TTGGCTTAAAATTTCGCAAATAA AATTAAGCCTCAAAATTCTTCCG III-7I21
90  F04 III Y39A3C_86.b GAAGCATCCAGTTCAATATCGTC ACAAAGAGCAAAGAGCAGAGAGA III-7K07
90  F07 III Y50D7_159.a ATTTTGGGTCGGAGATATTTTGT AAAAATGCTTTACAATGCTCCAA III-7K13
90  F10 III Y50D7_162.b AGCTTTTCTGCAAAAATTGAGTG CTGAAGAAGACCAGCAGAGAGAG III-7K19
90  F11 III Y50D7_164.a TTGCGCATTTTATAGCAATTTTT GAGACTATGATGAAGCAGCTCGT III-7K21
90  F12 III Y50D7_165.a CAGAAGTTTTGATATTCGGCAAC CGAGGAAGAAGAGATCAGATGAA III-7K23
90  G01 III Y50D7_165.b AATTAGGTTTTCGGCGTAAAAAG CTAATCGGTGTTTGCGTACTTTC III-7M01
90  G03 III Y50D7_165.d GGTGAAAAATAACGAGAAACACG TCTGATGGGAAAACGACTAAAAA III-7M05
90  G04 III Y53G8A_1734.a   TTATCAGCTTCAGATTCGTCTCC TCTCGACCATTTATGTACCCATC III-7M07
90  G05 III Y53G8A_1734.b   GAATTTCTTGGGGTACTTTGGTC AACAGATAAATCCGAGGGAGAAG III-7M09
90  G06 III Y53G8A_1734.c   TATTTGTGCAGTCTGAACCCTTT GAGCAAAATAGTGATGAAATGCC III-7M11
90  G07 III Y53G8A_1734.d   GGTGTTTTCTTCTTGAAACATCG AAATGGGGTTTAGAGCAGTTTTC III-7M13
90  G08 III Y53G8A_1734.e   AAACCCTCTCAAATAAGACTGCC ATCCACATTCACATGCCAATAAC III-7M15
90  G09 III Y53G8A_1734.f   GTTATTGGCATGTGAATGTGGAT TTTTCGCCAAAAATTCATAGAAA III-7M17
90  G10 III Y53G8A_1734.g   ATGAAAATTCGAAAAATTTGGGT TATGGTGGTCATTTTGAAGCTCT III-7M19
90  G11 III Y53G8A_2702.a   CCCGACATCCTACTGATTTACTG ATGGCAATCGATACTACTGGAGA III-7M21
90  H01 III Y53G8A_2702.c   TGTTCCCTTCATCACGACTAGAT GAGCCCAGAACATCCTTTAGAGT III-7O01
90  H02 III Y53G8A_2702.d   ATGATCTCAAGCTCAAGATGGAA AGCAACTCTTCCATAGTCACGAG III-7O03
90  H03 III Y53G8A_2706.a   AACCATGGATTTGATAATTGCAC TTTTTCTTGAGATAAAATCCCCC III-7O05
90  H04 III Y53G8A_2706.b   ACGTCGATTCGCTTATTGATTTA GACAATTTCTCTTATCACTGGGC III-7O07
90  H05 III Y53G8A_2706.c   CATGTCACCAACTTGTCACCTTA TCCTGCTATTCACAGGGAATTTA III-7O09
90  H06 III Y53G8A_6046.a   TGTCATGGAAACCAATAAAAACC GGGAATTATAGCGGTTTTACCAC III-7O11
90  H07 III Y53G8A_6046.b   GAATTTTAATCAAACATGCTCGC GAGTTCCCGAGTAAGTGACAATG III-7O13
90  H08 III Y53G8A_9248.a   GAAATTCTTGCATCCGTAGTGTC TCAGCTTGTGACTCTGATCGTTA III-7O15
90  H09 III Y53G8A_9248.b   CACAATTATGGATTTTTGCGATT GAGTTTGGAATTTGTTTCGTCAG III-7O17
90  H10 III Y53G8A_9248.c   TTTCAGCCATTTTCAGTCATTTT ATTTCAAAGCTTCTCATTCCTCC III-7O19
90  H11 III Y53G8A_9248.d   CAAAATTCTCGATTCATTTACGC GATCCATATTTCATGGCTCTCAC III-7O21
91  A03 III Y53G8B_93.b ACAATAAATGGTGTGAAGCTCGT TCCGTTAATTTGACACCCATATC III-7A06
91  A05 III Y53G8B_93.d TTAAAGGCGCATACAGTCATTTT TCGATGGTCTTGCATTAAATTCT III-7A10
91  A06 III Y53G8B_93.e GTTGAGATGTGAAGTGCTGACTG CATTTTTGGAACTTTCCGTGTAG III-7A12
91  A07 III Y53G8B_1025.a   AGTCAAGCATGGTCTTCGTTAAG GGAGTGTCGTTAATTCTAATGCG III-7A14
91  A08 III Y53G8B_1025.b   GTCAGTATCTCCAAATCGGTGAG ACGAATAAACTTTTCTCCCGAAG III-7A16
91  A10 III Y53G8B_4255.a   AATATGGGAAATTTCAAGGGCTA AGCTATATTCCCCGCTGAGATAC III-7A20
91  A12 III Y53G8B_4255.c   GAATGGCTTAAATCTGTGTACCG ACTCAGGTTTGAGCTTAGGCTTT III-7A24
91  B01 III Y53G8B_4255.d   AAAGCCTAAGCTCAAACCTGAGT GTCGATCAGAATCGATTTACCAG III-7C02
91  B03 III Y55B1A_115.b    ATTTTTATCCCAGAACCGATGTT TTTCAGTTTCAGACAAACCCATT III-7C06
91  B04 III Y55B1A_115.c    ATACTCGAAGCTTAATCGCATTG ACTCCTCTTTATGTCAAGGAGCC III-7C08
91  B05 III Y55B1A_115.d    TGTATCATGGTTGTTGTGATGGT GACGCAGAGTTCTCAACTGATTT III-7C10
91  B06 III Y55B1A_115.e    AAAATAGTCTGCGCTTCACACTC CGATGAGAAAACCTTGATTTTTG III-7C12
91  B07 III Y55B1A_116.a    AATTTGGTGCAAAACAGAAGAAA ATTTTCCTGAAAGAGTTCCGAGT III-7C14
91  B09 III Y55B1A_120.a    TTCACAAGACGATCCGAATAGAT GTCGGTAGGCAGACACAGATTAC III-7C18
91  B10 III Y55B1A_120.c    TTAAAATCTTCCTCCGTTAAGCC ATTGACATGGACTCGCTAAATGT III-7C20
91  B11 III Y55B1A_120.d    TGCCCTTTGGAACTAAGTAATGA ATAAAACATGCGATTTAGAGCCA III-7C22
91  B12 III Y55B1A_120.e    GTCTATACGTTCAAAATCGTCCG AGCAGACCTACATTGGTTGAAAA III-7C24
91  C01 III Y55B1A_120.f    TGCCCTTTGGAACTAAGTAATGA ATAAAACATGCGATTTAGAGCCA III-7E02
91  C02 III Y55B1A_120.g    CCAAGAATTTTGAACAACGTTTC ATTGACATGGACTCGCTAAATGT III-7E04
91  C03 III Y55B1A_122.b    GCTTGATTTATTTGTCAACAGCC TTCTCCATTTTCAACCACATTTT III-7E06
91  C04 III Y55B1A_122.c    CTTAACAACTTCATGCCAACTCC AAAACCAAGATTTGACCCGTAAT III-7E08
91  C05 III Y55B1B_113.a    TATTTTCAATAAATCCACGGTGC AATTTTCCAGATCAATTTCCGAT III-7E10
91  C06 III Y55B1B_113.b    GAACTCTTGTCTCTGCTTTTCCA GTTTAAGCGCCAAATTTTAGGTT III-7E12
91  C09 III Y55B1B_119.b    GGAGGACGTAGAGTTATCGGACT TCTCCTGTAACCTCCAATTTTCA III-7E18
91  C10 III Y55B1B_119.c    CTGAGAATGAACTGACGAGGAGT CACAAGCGGTTTCAGAAATAAAC III-7E20
91  C12 III Y55B1B_119.e    GAAATCACAGTTTCAGATTTCGG GCGACTTTCATTTGTTCTATTGG III-7E24
91  D01 III Y55B1B_119.f    AGAACCGCAGACAAATATTTCAA ATTCGACGACTACACCACCTTTA III-7G02
91  D02 III Y55B1B_119.g    TAGGTTTGCGGTTAGTAGTGGAA CGCCAAGATATTTTTCACAGAGA III-7G04
91  D04 III Y55B1B_121.b    TTCTTAACCATGCGAAATCAGTT GTAGATGTCGTTTTTCATCGGAG III-7G08
91  D05 III Y55D5A_391.a    TTGAAAATAGAAAATTTTGCGGA CTCCAAATCCTACCAAATTACCC III-7G10
91  D06 III Y55D5A_391.b    TACTGTTTGAAGACACTCTGCCA AAACTGTGCTACACGAAAACGAT III-7G12
91  D07 III Y55D5A_391.c    ATTTTTCCCGTGATAATCCAACT CGAATTTGGGAATGAACTATTGA III-7G14
91  D09 III Y55D5A_392.b    ATGAGGAGTACAATTCGCAAAAA AGAAAAATGTGGCCAACTAACAA III-7G18
91  D10 III Y55D5A_392.c    AATCAATAAAACCTCTGGCCAAT TATTTTACGACGGAAATTCAGGA III-7G20
91  D11 III Y55D5A_392.d    AGATCCGAACGACTCATACTGAA AATCATCGAACTTGATGGAAATG III-7G22
91  E01 III Y55D5A_392.f    ATTTGAAAGCTCTGAACTTGCTG GGCACGGAATTTGTAGAGTATTG III-7I02
91  E03 III Y71H2_375.b TCCAAAATATCTCCGAAAACTGA CCAAACAAAACCACACCTACAAT III-7I06
91  E04 III Y71H2_378.a CCAATAATTCTGACACTTGCTCC TATCAGCGGCTTTATCATCGTAT III-7I08
91  E05 III Y71H2_380.a TAATGGGACATTATGACACCACA ACAAATTCTCAATGGTCAGTGCT III-7I10
91  E06 III Y71H2_381.a CAAAAACTGTTAAAATGGCAAGG TAGTAAAATTCCTGCGGTCAAAA III-7I12
91  E08 III Y71H2_384.a TTGTCGTATTTTGTGACTCATCG CAAATTTTCTAAAATCCCCCAAG III-7I16
91  E09 III Y71H2_385.b CCAACTTTGTGCAATTTTAAAGC AATCCTCTGGGAAATGGTGTTAT III-7I18
91  E12 III Y71H2_387.b GATTGTAAACTTACGGCAAACCA TTTCTGAAACCAGACTCCAATGT III-7I24
91  F01 III Y71H2_388.b GTCTTCACAGTGAGAAACATCCC CATCGAAAAATGTAAAATCTCGC III-7K02
91  F02 III Y71H2_388.c CCTGTTCTCGAATACAATCGAAC GCATGTCGATAAAGCTGATAACC III-7K04
91  F03 III Y71H2_388.d ATAAAAACCACCGGAACAAAAGT ATTTCTTATGGCGTTATGAGACG III-7K06
91  F04 III Y71H2_388.e TATCGATCGTAGAAGAGACGAGC AAAAATCACACGCTTTCATCAGT III-7K08
91  F05 III Y71H2_388.f GGGTCTCCTTCTTGTACCAGTCT TAACCTTAAAAGCGAACATTCCA III-7K10
91  F06 III Y71H2_389.a CAATTTAGTCGGTGGCTTAACAC TCCGATGACTTAAAATCGAAAAA III-7K12
91  F07 III Y71H2_389.b CGAATCGATCCTGTTTATTGAAG AACGGGCAGAATAAAAAGAAGAC III-7K14
91  F08 III Y71H2_389.c ATCATGATATTCGGTCATTGAGG AAATCTCCCGGCTTAAAATTACA III-7K16
91  F10 III Y71H2_389.e AAAATTCGGCTCAAACATCTGTA GATTTTACAGGAACTCCAATCCC III-7K20
91  F11 III Y71H2_390.a TTTTGGGAATTTGTTTTCTACGA AGTGATCAATCATCATTGTGCTG III-7K22
91  G02 III Y71H2_390.d AATAATTAGGGAAGTGGAGCGAG AGATATGAGCCAGCAGAGTTGAG III-7M04
91  G03 III Y71H2_390.e AACTTATTTCGCTACGATCCTCC TTCATAGGTAAGGTCGCCTTGTA III-7M06
91  G07 III Y71H2_391.c TAACAGTTCATATCCCGGATGAC ATATTCGAGCAATTGAAGCACAT III-7M14
92  A02 IV  Y38C1AB.c   TGAATTCCTTCATTTTGTCGTCT TCTAGGTTTTTCTTCCAGTTCCC IV-1A03
92  A03 IV  Y38C1AB.d   TTTCTAAATTTTGGTTAACGGCA GAGATATTGCCACTGGTGAACTC IV-1A05
92  A04 IV  Y38C1AB.e   CGGCTCGATAATACCAGTCATAC GTAGCAAAACTCAAAGTTTCGGA IV-1A07
92  A05 IV  Y38C1AB.f   GCGAAACGTGATGAAAACTAATC GAGCGTCTGAGTGATTGTCAGTA IV-1A09
92  A06 IV  Y38C1AB.g   TTGACGACCTAGATGACGATTTT TCGAACTAAACTCACCTTGCTTC IV-1A11
92  A08 IV  Y38C1AB.i   TCTAGGTTTTTCTTCCAGTTCCC TGAATTCCTTCATTTTGTCGTCT IV-1A15
92  A09 IV  Y38C1AB.j   GAGATATTGCCACTGGTGAACTC TTTCTAAATTTTGGTTAACGGCA IV-1A17
92  A11 IV  Y38C1AB.l   GAGCGTCTGAGTGATTGTCAGTA GCGAAACGTGATGAAAACTAATC IV-1A21
92  A12 IV  C15E6.1 CGTTATCAAAAGCCGGGATA    TCCCCTCAATTTTCTTGCAG    IV-1A23
92  B01 IV  T05C7.1 TGCAAAATTGTATTTTTCGGTTT ATTTTTCTAATTTTCAGGTCCGC IV-1C01
92  B02 IV  B0545.1a    ATCAATTCAGGAGCGATAAAACA TACATTCCGTATCATCATCCTCC IV-1C03
92  B03 IV  B0545.3 TCCATAAAACATAGGCCTCAGAA GTGTCTACTTTTGCCTACATGCC IV-1C05
92  B04 IV  B0545.4 GCAGTGTACCCGACTTCCAT    GCGTCCGAGTTGGATTTCTA    IV-1C07
92  B05 IV  F29C4.1 ACGAACAACACGAAAGACCC    GCGTCTTCTGGCTTGGATAA    IV-1C09
92  B06 IV  F29C4.2 CTCTGTTTATTTTGCACGTTTCC TTCGGAACAAACCAAGCTATTTA IV-1C11
92  B08 IV  F29C4.5 GGAGCAATAGGATGCAAGGA    AGGGACGAGGAAGTCGTTTT    IV-1C15
92  B09 IV  F29C4.6 ATTTTCAACGTCGGCATTTC    TCCGCTTAATTTTGCGATTT    IV-1C17
92  B10 IV  F29C4.7 CTGCAAAATTCCTAACAACATCC CCTAAGCCCCAAAAATCTAGAAA IV-1C19
92  B11 IV  F29C4.8 TCGACCCTGTTTGGATAGATAGA GGCACAATTTTAACCTCACAAAA IV-1C21
92  B12 IV  R02D3.1 AGAGCCAAAGACGCTGATGT    ATTGGTCGTTGAATTCCTGC    IV-1C23
92  C01 IV  R02D3.2 AAAATTCATCGAAAAATCGTTCA TCAGAAATTGGAGAAAATCCTCA IV-1E01
92  C02 IV  R02D3.3 TGGGCAATTTTGTAGTTAGAGGA TCAGAAAAGATTCTTGCGACTTC IV-1E03
92  C03 IV  R02D3.4 CTTTTTCCAACCTTTTGCCA    CCTGATAGCCTCACCCAAAA    IV-1E05
92  C04 IV  R02D3.5 CGTTTGAGCAAGAAGACTCTGAT GACAGCGATATTCCATCTTCAAC IV-1E07
92  C05 IV  R02D3.6 ATATTCACTTTTCACCAAACCCC CACTGTATCTGGAAAATGTGCAA IV-1E09
92  C06 IV  R02D3.7 ATTTTTCCAGCATCGTTTGG    ATTTTCAGCCAAATTGCCAC    IV-1E11
92  C07 IV  R02D3.8 GAAAAATGGCGGAAAAGTCA    CTCGGGAAGTGAAGAAACCA    IV-1E13
92  C08 IV  T21D12.1    TTGGAGCCTGTGATTTGATAGTT AATGTCGATAAACTTCACGAGGA IV-1E15
92  C09 IV  T21D12.2    CCCTTCAAAAGGCAAAGACA    CCGTTTTTCGATTTTCTCCA    IV-1E17
92  C10 IV  T21D12.3    TTCCCCAAATTTCAAATGGA    CAGCTCTTCTCGCTCGACTT    IV-1E19
92  C11 IV  T21D12.4    TCTCCTCGTGGCTTTGAACT    CTGACTAAGGAAACAGCCCG    IV-1E21
92  C12 IV  T21D12.5    TGTTCGCTCACTACAACTCATGT GCTTCAGTTTTCTGATGCATTCT IV-1E23
92  D01 IV  T21D12.6    GTTTGCAGTCTCATTCACACAAG GCAGACAGCTAGACAAACGACTT IV-1G01
92  D02 IV  T21D12.7    AGGTGTTTGGATTGGACAGC    TGCCACGTGTATGGAGGATA    IV-1G03
92  D03 IV  T21D12.9    GGTTTAACGAGCTTGGAAGTTTT CTTGCCACACATTGATATTCAGA IV-1G05
92  D04 IV  T21D12.11   AGGGAAGAAGTGCATGTTGG    TCGTCCCCACTGTTGTTGTA    IV-1G07
92  D05 IV  T21D12.12   CAAAACGCTCCCTTATTTTCTTT GCAAAGTTGTTAGCATTTCCATC IV-1G09
92  D06 IV  K02D7.1 ATGCTATACTTTGTGGGGCG    GACGCCACTATCCTTCCGTA    IV-1G11
92  D08 IV  K02D7.3 TTCAAACGACGGAATTCTCC    CAATTGTGGCTGTTCCAATG    IV-1G15
92  D09 IV  K02D7.4 AATCGTCGAGTCATCCAACC    AGGCGGATTCTCATGTTCAC    IV-1G17
92  D10 IV  K02D7.5 AGTCTGCAATGCCTTTCAAAATA GAAATTGGCCACATTAAAACAAA IV-1G19
92  D11 IV  F18F11.1    CGGAGGTGCAAATCTAATTACTG TTTTGTCAGGTTTCAGGGTAAGA IV-1G21
92  D12 IV  F18F11.2    GTTTGTGTTTGTAAAATTGCCGT CACCCCAGTTTGTCTACTGGATA IV-1G23
92  E01 IV  F18F11.3    AAATGCTGAAATTGGGACTGATA TTTTGTTCTGAAGATACGCCAAT IV-1I01
92  E02 IV  F18F11.4    CTGGCGGATCCTTTTATTGA    GGACTTCCGCAGGTTTATCA    IV-1I03
92  E03 IV  Y66H1B.1    GTAGTCGATATGCCAGTTGAAGG TCCAATATCTCCATCTTCTTCCA IV-1I05
92  E04 IV  Y66H1B.2    TCTCCAGTTCATAAGCATCCAAT ACGTGAAAGACTCACCATTGACT IV-1I07
92  E05 IV  Y66H1B.3    GATCAACAACAATTGCTTCAACA GCGTTTTAATTCTTTACCACACG IV-1I09
92  E06 IV  Y66H1B.4    GAAGTTGAAGGTGGAGCTGAATA TGAACAAAATTACATTGTGAGCG IV-1I11
92  E07 IV  T07A9.1 TATGGGAATTTCTTGGAGAGACA TGATTGTCCGAATAAATGGAATC IV-1I13
92  E08 IV  T07A9.2 GTGGACTGAGAACCGCATTT    ATCTTCTCGCGATGTGGAGT    IV-1I15
92  E09 IV  T07A9.3 AAGCATCTTCACAATTCGGG    CAGTGAAAATGTCGTGGTCG    IV-1I17
92  E10 IV  T07A9.4 ATCAGAAGTTGCAAATCGGAATA TTGGAGAATAAACAGACGGAAGA IV-1I19
92  E11 IV  T07A9.5 AATTCGTTGGCTAAGACACAAAA GCGAATTTTGTATGCAGTTTACC IV-1I21
92  E12 IV  T07A9.6 CGGAATCAGGAAAAAGTGGA    TACCACTGGCAACGAATGAA    IV-1I23
92  F01 IV  T07A9.7 CTGTTCCCTTTATTCGTCCTTCT GCAAACATCGTGAATCAACTACA IV-1K01
92  F02 IV  T07A9.8 CCGTTGAATTTTTCGCTGTATTA CAAAATTGTTTGATTGACACGAA IV-1K03
92  F03 IV  T07A9.9 AAACGACGGGTGTTCTCATC    AAGTACGCCGACTCGCTTTA    IV-1K05
92  F04 IV  T07A9.10    CAGCTACTTTGAACTCCCGC    CGAGGTGACACTTCAAGCAA    IV-1K07
92  F05 IV  T07A9.11    CTTCTTCGGTCTTCACCTCG    CGCCAAACCACGTTTATCTT    IV-1K09
92  F06 IV  Y66H1A.1    AGTTGTGATAAAACAAAAGGCCA ATGAAATTCGTACTATTCGGCAA IV-1K11
92  F08 IV  Y66H1A.3    CTTTTTCGTAAGTGAAGCCATTG TGTTTTTGAGCCAGAAATACGAT IV-1K15
92  F09 IV  Y66H1A.4    ATTCTTCGAAATAGGCGAAAATC GCAGATGAGAAAAGGAAAACAAA IV-1K17
92  F10 IV  Y66H1A.5    CGCACTCTTTGAAGTTTCATTCT TTGGACAACTGATAAGGGAGAAA IV-1K19
92  F11 IV  Y66H1A.6    ACTCAACATTTCCCAAGTGAAGA GTGGCCAACATTCTCATATCAAT IV-1K21
92  F12 IV  M04G7.1 CGAAAATGAGTCACACCCCT    CTAGACAAAGCTTCCGGCAC    IV-1K23
92  G01 IV  M04G7.2 ACCCCGTGTTGGTGTAAAAA    CAGAAAGTTGACTGTGCCGA    IV-1M01
92  G02 IV  M04G7.3 AGACAATCAGGCGTAATGGG    ATGCCATCAAATTCCTCTGC    IV-1M03
92  G03 IV  W03G1.1 TAATTTTCCCTTCCCGCTCT    GCTAGGCACGCAGGAATTAG    IV-1M05
92  G04 IV  W03G1.2 AAACCCTAACACCTCCACAATTT AAATCAAGGCAAAATCAAGTTCA IV-1M07
92  G05 IV  W03G1.3 GGTTAGTGGAAGGAGCCACA    GCTCCGTCTTTTTGCTTGTC    IV-1M09
92  G06 IV  W03G1.4 CCCGGAGTCTTCTGATTCAA    CACTGGATCGTCATGATTGG    IV-1M11
92  G07 IV  W03G1.5 GCGTGTCTCAAACAAAAGCA    TTGAAGCAGCTGAAGAAGCA    IV-1M13
92  G08 IV  W03G1.6 CTTCCTGTGCAATAGAGCGTAAT ATTTACAGGATTCGGAAAAGTCC IV-1M15
92  G09 IV  W03G1.7 CTTCGGTGTGAAATGTGGTG    GCAATTTGAGTGGGGAGAAA    IV-1M17
92  G10 IV  W03G1.8 CAAAATGATTGACTTTCTTTGGC GTGGTATTGGCAGTTTCTCACTC IV-1M19
92  G11 IV  W03G1.9 CGAAGAGTGAAGTGAATAGTGGC TTGGGCTTGTCGTTAATAACAGT IV-1M21
92  G12 IV  F09C11.1    CGTTTAATTGAAGGTGTTCAAGC AATTCCCAAAAAGGTTGTTTTGT IV-1M23
92  H01 IV  F56A11.1    GAGCACACAACTGTATATGGCAA TTGATAATGCAGAAGTCGAGTGA IV-1O01
92  H02 IV  F56A11.3    AACCGGAAATGAAGGTCTCTAAG AATACCCGGAAAACGATTAAAAA IV-1O03
92  H04 IV  F56A11.5    GGTTGCATGTCCTTGTCCTT    CTGGCACTGAAAGGTTTGGT    IV-1O07
92  H06 IV  C18H7.1 AGAAACTCAAATATGTTCGGCAA AAAATTGGTAATTAAGGAAGGCG IV-1O11
92  H07 IV  C18H7.2 CGGTCACCCGATAGAATGTT    AAATTTCAGGCTTTTCGGCT    IV-1O13
92  H09 IV  C18H7.4 CAGGAGCATACGGGACAGTT    CATAGTGCTCTCAAACGGCA    IV-1O17
92  H10 IV  C18H7.5 TACTCCTCGTGTAGCAATGGAAT CGTCTAAACCACAGCAGAGTCTT IV-1O19
92  H11 IV  C18H7.6 TTCCATTTTCCTCATCCTCG    TTCACACCGTTTGTCCTGAA    IV-1O21
92  H12 IV  C18H7.7 TTAACTACGCAGGCTCAAGGTAG GGAGGTGTGGTACGTATTATGGA IV-1O23
93  A01 IV  C18H7.8 ACGTGTGGATTTACGGAAGC    TCGAAATGGGTTCAGACCTC    IV-1A02
93  A02 IV  C18H7.9 TTACAAGTCCTCCATCCACAAAC TAGGCAAACATTGTGGAAGTTTT IV-1A04
93  A03 IV  C05G6.1 GTACGAGCACATGTAATGAACCA CAACTAAATGAAGTTGGAAACGC IV-1A06
93  A04 IV  C05G6.2 CTTCCGATTACTCATATCGTTCG CATACCGTACCTACAATTAGGCG IV-1A08
93  A05 IV  C05G6.3 GCCGAGAACTCATGGACATT    TAACGGGGAGATGGTGAGAG    IV-1A10
93  A06 IV  K11H12.1    TTCGGTAAACTCTTCCATTTCAA CCGAAAATGAAATGGTTGTTATC IV-1A12
93  A07 IV  K11H12.2    GATAACAACCATTTCATTTTCGG TGTTCCATTCTTCGATTCACTTT IV-1A14
93  A08 IV  K11H12.3    CCGGTGACCAGTTCAAGTTT    AGTTTGGTGCGTCTAGCGAT    IV-1A16
93  A09 IV  K11H12.4    ACTCACGAAAAACCCAGACG    CATCCGGTGATGACAATCAG    IV-1A18
93  A10 IV  K11H12.5    GCTCAAATTCTGGTTTCCCA    ACGGACACATTTTTCGAAGG    IV-1A20
93  A11 IV  K11H12.6    ACATCATTTTTGCTTCTTTGGAA AATTGCTTCAAAAAGTTCTGCTG IV-1A22
93  A12 IV  K11H12.7    AGTGTTAAAATTTTCCCAGGCTC GAAATGTTCATGACTAAAAGCGG IV-1A24
93  B01 IV  K11H12.8    TAACTCCTCGTTGCATCATTTTT TTCAGATTTCAGCCATTTTCAGT IV-1C02
93  B02 IV  K11H12.9    TGTCTTTAAATTTCGGCTCTCAG TCTCTGACATGTTGAATGGATTG IV-1C04
93  B03 IV  F41A4.1 GTGCTGCTCTGCACAACAAT    TTCTTTCACAATATCCCGCC    IV-1C06
93  B04 IV  F41A4.2 AGCGTACAAAACTTCCAGTTTGA TCGTCCAACTGATTCTCTTGATT IV-1C08
93  B05 IV  Y55F3C.b    ATTGTGATGTACACGATGCAAAC TCTCAACATGGAATCTATTGGCT IV-1C10
93  B06 IV  Y55F3C.c    AGTCTTCTGATTCAAAGCGTGAC TTTGAGTCGCCTTAATAATCCAA IV-1C12
93  B07 IV  Y55F3C.d    TGGACGAATAGCTTCATTTTCAT GCACATCCAAACCAGTTAACAAT IV-1C14
93  B08 IV  Y55F3C.e    TTCATTTACATTTTTATTGCGGG ACATTTGGTCTTCGATTCTTCAA IV-1C16
93  B09 IV  Y55F3C.f    GTCGTAGATTATGGCTGATCCTG ATCGATTTCCCCTAAAATCAAAA IV-1C18
93  B10 IV  Y55F3C.g    CAGTTGAAATGAACTTCCTGACC GGCAGAATTTTCAAGCATGTATC IV-1C20
93  B11 IV  Y55F3C.h    AAAAGCACGAAGATGATGACAAT TCTTGACTGCTAGCTATCCCAAC IV-1C22
93  B12 IV  Y55F3C.i    CGGCTTCTTCTTCTTCTCCTAAC AAGACAGGATTCCAGAGCACTTT IV-1C24
93  C01 IV  F56B3.1 ATGGATGCGTTCAAGGTAGG    GGGAGAATCCTTGTGGTCCT    IV-1E02
93  C02 IV  F56B3.2 TTTTGGCCACTTTAAACCTTACA GCTTACAAACCTACCGCCTATTT IV-1E04
93  C03 IV  F56B3.3 TGCTTCTGGTTCATATGGTTCTT GCGTCTTCTGATGTTAGTCGTTT IV-1E06
93  C04 IV  F56B3.4 CTACTTCAACTGGCTTCTTCCAA GTACGCAAGCACAATTTACCTTC IV-1E08
93  C05 IV  F56B3.5 TTGGTTTTTCAGTAGGTGGAGAA GGTTTTCATCGAAAGATTGACTG IV-1E10
93  C07 IV  F56B3.7 TCTGTAGTCACTCCCACTTCCAT ATGGAACAAATATGGTGACAAGG IV-1E14
93  C08 IV  F56B3.8 CATTCGCTACCTTCTATGCATCT CATAAACCGCTCAGAATTAATCG IV-1E16
93  C09 IV  F56B3.9 CGAAAGAACGAAGCCAAGTC    CATAATGCGAGTGAGGCTGA    IV-1E18
93  C10 IV  F56B3.10    TTGCATTCAAAACCTCCAAATAC TGGAAACTTTTTAAGCTGTTGGA IV-1E20
93  C11 IV  F58H7.1 ATCTGCGATGCACCATAACTATT CAGACCTACCGTAATCTCAATCG IV-1E22
93  C12 IV  F58H7.2 TCAATCAAAACCCGTACAAAATC AAGCTATCCATCAAATAGAGCCC IV-1E24
93  D01 IV  F58H7.3 TCCAATTCTTTCTTTCAGATGGA CAAGTACAAAATTTTTCCGAACG IV-1G02
93  D02 IV  F58H7.5 TATTGCTCTTGTTCGTTGCG    TGTTTTTCAGAGCACATCGC    IV-1G04
93  D03 IV  F58H7.6 ACTGAGGATTTTGCCACACC    GTGGTCATTGGCAACAAGTG    IV-1G06
93  D04 IV  F58H7.7 CTGATATGAAGGCCCAAGGA    GGCGAAAATGTCATTCGTCT    IV-1G08
93  D05 IV  F58H7.8 TCTGGAAATCCTCCAACTCG    AAAATCTGCACCACTCCACC    IV-1G10
93  D06 IV  C44C8.1 TCAATGAGCCACACGACATT    TCTGATTTCCAGATTTCGCC    IV-1G12
93  D07 IV  C44C8.2 TCAATGAGCCACACGACATT    TCTGATTTCCAGATTTCGCC    IV-1G14
93  D08 IV  C44C8.3 TCAATGAGCCACACGACATT    TCTGATTTCCAGATTTCGCC    IV-1G16
93  D09 IV  C44C8.4 TCAATGAGCCACACGACATT    TCTGATTTCCAGATTTCGCC    IV-1G18
93  D10 IV  C44C8.5 TCGAAAATTCCAACAGAAAGGTA GATCTATGTTGTCCGAGCAATTC IV-1G20
93  D11 IV  C44C8.6 CATATCCGTCCATTGTTCCC    GCGTAGGAATCAACGGAAAA    IV-1G22
93  D12 IV  C44B12.1    TAACGTTTTCCCCTCAAACTACA CATTTTTCCACACTAATCGGGTA IV-1G24
93  E02 IV  C44B12.3    AAGATGCTCTTCAAGAAGTTCCA CGAGCAATTTTTGAATTTTAACG IV-1I04
93  E03 IV  C44B12.4    AAGCCGATTTAGGCCATTTT    TCACTCGAACTGTCACAGGC    IV-1I06
93  E04 IV  C44B12.5    GTCCTTAAAATATTCCCCACCTG CTTCAGATTCCCTTCTTTTTGGT IV-1I08
93  E05 IV  C44B12.6    TCAAACTTGTGTTGAGAGCAAAA TTAATTTAGGGGGAAAATGCTGT IV-1I10
93  E06 IV  C44B12.7    AAATTGCCGCTTCTTTAGCA    TCCGCCGGTAATTTACTCAC    IV-1I12
93  E07 IV  C50A2.1 ATGCAACTTCTGAACACTGGAAT GGGCATTTTTAATTAATTTTCCG IV-1I14
93  E08 IV  C50A2.2 AGGAGAGGATTAACCAAGGAGTG TTTTGGTGGTGCTACAGTAACCT IV-1I16
93  E09 IV  C50A2.3 AAAATTAAGCTGATGACGTGGAA TTTTGGGGAAAACTCAAAAATTC IV-1I18
93  E11 IV  Y104H12D.a  CAATCATCCCGTCTTACTGAGAG TCCCTTTCTTCTCTATTCCTGCT IV-1I22
93  E12 IV  Y104H12D.b  ATGTGTCTCAAGCAACGAAGATT TTTCTCCTCGGAATTCTCATTTT IV-1I24
93  F02 IV  W09G12.3    CAGACAGCCGATCTTCCTACTAA AACTAGAACCCTTCCTGGCATAC IV-1K04
93  F03 IV  W09G12.4    TAACGCACATCAGGCTTCTG    TGCCGAAAATTTTGGAGTTC    IV-1K06
93  F04 IV  W09G12.5    CTCTCGGTAAGCTGAACTCAAAA TGTGCAAATCTTTGTGAAAAATG IV-1K08
93  F05 IV  W09G12.6    AAAATTTCCAGTCATTTTCAGCA TTCTAACCATGAAGCTTTTCCAA IV-1K10
93  F06 IV  W09G12.7    CGTGTGCTCATGCTCATTCT    CCATTTTCCAGCCTTCGTAA    IV-1K12
93  F07 IV  W09G12.8    AACTCCTCAGAAAATGAAGGAGG CAGACAGACAAATGGATCAAACA IV-1K14
93  F08 IV  W09G12.9    AAGAGATATGGAATGCAACAGGA TTCACGAACATGTCAATAACTCG IV-1K16
93  F09 IV  Y104H12C.a  TGTGCAAATCTTTGTGAAAAATG TCATAAAAACTCTGTGCTCCTCC IV-1K18
93  F10 IV  C09E9.1 AATCAAGAAAATCGGGTGAAAAT CTGATGGCCTAGAAACACAAAAC IV-1K20
93  F12 IV  F38A1.1 TTTGCTCGTTGGTTCAATTCTAT AAGCTCAGAACTGTGAGGACAAC IV-1K24
93  G01 IV  F38A1.2 CTCCTGTAAGACGGCAAGAGATA CACCATAAACATTTTTACGCCAT IV-1M02
93  G03 IV  F38A1.4 CAGGAAGGCGTTTCAAGAAC    TCCACCAAACTCACCTTTCC    IV-1M06
93  G04 IV  F38A1.5 TTCGCTTGGGATAATGGAAG    AAGGTATTGCCCCCGTATTC    IV-1M08
93  G05 IV  F38A1.6 CTGGTTCCAAGAATGAAAAGTTG CAACAACTGCTTTGAAACAACAA IV-1M10
93  G06 IV  F38A1.7 TGACGGATCTGTGGAACAAA    GATCTTTGCCGCATTTCATT    IV-1M12
93  G07 IV  F38A1.8 TTTTCCGGCTAAAATGATCG    CGGTTTCGGTGAAAACTAGC    IV-1M14
93  G08 IV  F38A1.9 GTTACCATTGTTCGACAACATCA GCACAAAAACACAATCAAAAACA IV-1M16
93  G09 IV  F38A1.10    TCCATGGTTTTACTGATAAGCGT TCTTCGAAATATCCGACTCGTTA IV-1M18
93  G10 IV  F38A1.11    GAAAGCCTGTGTCTCGGAAG    AATTTCAAGTCGCATTTGCC    IV-1M20
93  G11 IV  F38A1.13    TCGGAATTTGTTCAAATCAGAGT ATCAATGAACGTTCCGTTCTCTA IV-1M22
93  G12 IV  F53H1.1 CACCTACGGAGGAGTTGGAA    GTGGCCGATAATTCAGTCGT    IV-1M24
93  H01 IV  F53H1.3 CAAAGTAGGTCAAAATTGAACGG CAAATTTATGGCATTCCTCTCTG IV-1O02
93  H02 IV  F53H1.4 ACTTCGATTCCTGTTGAATGTGT TCGGAAAAGTCCTAAATTGTTCA IV-1O04
93  H03 IV  F58F6.1 AATTACTGGAAATTAAGCTCCGC AACAAAAATCCTACAAAACCCGT IV-1O06
93  H05 IV  F58F6.3 AGATAGACGATCCTGGTCAAACA ATCAAGTGTGAGGAATCAAGGAA IV-1O10
93  H06 IV  F58F6.4 AATGTGCCGAATATTGTTTTGTC TACCTGTAAATTGTTCAACGCCT IV-1O12
93  H07 IV  F58F6.5 GGAAATACCGGACTCTGAAAAAC TTTGAAGAGATATAGGTTTGCGG IV-1O14
93  H08 IV  F58F6.6 ATCTGAAAATTGACTCGTTGGAA CTAACTTGTATGTTCGACGGTCC IV-1O16
93  H09 IV  F58F6.7 TACCGTATTCCAACCAACAATTC TACAAACGGCACACAAAGATATG IV-1O18
93  H10 IV  Y104H12A.1  ATAACGGTCTGAAACACCTCTCA AAGGGAAAATGTTTTTCTCAAGG IV-1O20
93  H11 IV  Y77E11A_868.a   CATGGGAGTACTCGAACTACTGG CGGAAAACAAAGCAAGATAAATG IV-1O22
93  H12 IV  Y77E11A_868.b   TAAACTCACCCCAAAATCTCTGA TACTCTATAGGCAGTCATCCCCA IV-1O24
94  A01 IV  Y77E11A_3443.a  GGAGTCCTTAACAAAATGCACAG AATTTCGAGTTGAATTGCAAAAA IV-1B01
94  A02 IV  Y77E11A_3443.b  ATCGTCGAAACAGAGTAAACGAG TTGCAGAAAAACGATGGAATACT IV-1B03
94  A03 IV  Y77E11A_3443.c  AAAATTTGAATTTCCCGCTAAAA GTCGGGGTACTGTAATAGCACTG IV-1B05
94  A04 IV  Y77E11A_3443.d  TGAAACTTGATTTTTGGAAGGAA ACCGTATCCTTGACCATAATCCT IV-1B07
94  A05 IV  Y77E11A_3443.e  CGAAAACCCGTACAATAAAAACA GAATGACTTTTCGTGTGTGATGA IV-1B09
94  A06 IV  Y77E11A_3443.f  GAAATTTGTTCCAATCAATCCAA GAGTCTTGTAGATCTGCTCTGCC IV-1B11
94  A07 IV  Y77E11A_3443.g  ACCTCAAAAATCAGTGGCAATTA TGAAATTCCTCTTGGCTAATTCA IV-1B13
94  A08 IV  Y77E11A_3443.h  GCACTCTCTCATTCTGCAAGTTT GATACACTAGCGGAGAGCTCAGA IV-1B15
94  A09 IV  Y77E11A_3443.i  GGCAAAACTTTCCGACTTTTACT AAAAACCACAAAAACCATTTGAA IV-1B17
94  A10 IV  Y77E11A_3443.j  ACTAAACAGTGTGGTCGCATTTT TGCTTGAATTAGCCAACTGGTAT IV-1B19
94  A11 IV  Y77E11A_3443.k  AGGATTATGGTCAAGGATACGGT TTTTCTGCAATTTCATCGTTTTT IV-1B21
94  A12 IV  Y77E11A_3443.l  CAGACTCTACGGAGGCTATGAAA CGGAAAACAAAGCAAGATAAATG IV-1B23
94  B01 IV  Y77E11A_3443.m  AGTAGTGCCACCTGATCAGTCAT GAATCTTCTGTCCAATCAACGAC IV-1D01
94  B02 IV  Y77E11A_3443.n  AACGGATACTTCAGTGAGAACCA TCTCATTTATTGCCCAAAGAAAA IV-1D03
94  B03 IV  Y77E11A_3443.o  TGCCTAAACCAAAGTTTCCATAA TTAACTAAAGAAAACGGCTTCCC IV-1D05
94  B04 IV  Y77E11A_3443.p  ATTTTTGAAGCTAAAACTTCCCG TGTCATTTTTGGGTGAAAAATTC IV-1D07
94  B05 IV  Y77E11A_3443.q  GCTACTGAAGGAGTTGCTCATGT CGAAATTAAATCAATTCTGCCAA IV-1D09
94  B06 IV  Y77E11A_3670.a  TCCATTTTTCAAGATAGTCGGAA TTTCCCGTATTTTTGGAATTTTT IV-1D11
94  B07 IV  Y77E11A_3670.b  AAATGTTTTTAGAAGACGCCACA TTTTTCCACAAGAAATCCTGAAA IV-1D13
94  B08 IV  Y77E11A_3670.c  GCAATTGTAAGTCGGAAAATCTG TGAGAAAATTGCGGTTTTTGTAT IV-1D15
94  B09 IV  K03H6.1 GTCCGAAAAGTAGCCCATGA    CACTTATGGCTCCGTGGATT    IV-1D17
94  B10 IV  K03H6.2 ATTTCAGCGTATTTCGTCCACTA TTTGTTTTGCATTGATGTTGACT IV-1D19
94  B12 IV  K03H6.4 AATTTGATTTTGCCCGTATTTTT CCTGACGTTAATGAGGGTCATAG IV-1D23
94  C01 IV  K03H6.5 GCACACTCCTGGTTCAAATACTC TGGAAGTACCGAAAAGTGAAAAA IV-1F01
94  C02 IV  C34H4.1 GCTCTACCTGGCATCCTCTG    GTCAGGTGGAGAATGTCCGT    IV-1F03
94  C03 IV  C34H4.2 ACGGAACCTATGCAGATTGG    ATGCCGGCAAATAATCAAAC    IV-1F05
94  C04 IV  C34H4.3 TTCTGGAAAATCGACTTCGG    TGATTACTGGTGGGGTGGTT    IV-1F07
94  C05 IV  C34H4.4 TGATGGATGACATGACTGAGTTC TCCTTAGACGTGAGAGAAACGAC IV-1F09
94  C06 IV  K08D12.a    AAAAATCGATAAAACCCGTCATT AATTTTCAGAAGACGATCCAACA IV-1F11
94  C07 IV  K08D12.b    GATTGAAGCTCTTTGCTGAAAAA TATTGATTTTTCGTCCTTCCAGA IV-1F13
94  C08 IV  K08D12.c    TATTGGAAAAAGGAGTGAACGAA TTTTGTAATTCCTCGCAACTGAT IV-1F15
94  C09 IV  K08D12.d    CAAGCGAATTTCTGAATACTTGG TCAGCAATTTCCGAAAAATAAAA IV-1F17
94  C10 IV  K08D12.e    AACCGTTAGTGGCTAACAAAACA GAATAGTGTCCATCAGCCAAAAA IV-1F19
94  C11 IV  K08D12.g    TTTTTCGAAATGTTTGATGACCT AGTTGTGGACGGAAAACCTTTAT IV-1F21
94  C12 IV  K08D12.h    TATTGGAAAAAGGAGTGAACGAA TGAAACGAAAATGATGACAAGTG IV-1F23
94  D01 IV  Y38C1BA.a   CCTACTAGATGCCTGCTCGTCTA AAAATCCCTGGTTACACTTCCAT IV-1H01
94  D02 IV  Y38C1BA.b   TGAAAAGATCAGGTGGTTCAGAT ATTCACTTCCTTAGCTTCAACCC IV-1H03
94  D03 IV  Y38C1BA.c   CGTCACCCACCTATAACATCATT AAAATATTTCCGCAATCACACAG IV-1H05
94  D04 IV  Y38C1BA.d   TATCAGAACCGCAAATACGAGAT TGGAAAGCAAAGCTTTAAAAATG IV-1H07
94  D05 IV  Y38C1BA.e   TTAATGTATTTGGACCTGGCATC AAACGAGTGTACCGAATATGGAA IV-1H09
94  D06 IV  Y38C1BA.f   AATTCCCAAAGTTAAACCAGTCC CCCTGTGGAGATACACAACTTTT IV-1H11
94  D07 IV  Y38C1BA.g   GCCTACTACAATCCTACCTGCCT TCTCAATTCTCACCTGCTTCTTC IV-1H13
94  D08 IV  K07A9.2 CGAAAACTACTGTACCCCCTTTT TCGGGTAGATCAAAAGCGTATTA IV-1H15
94  D09 IV  K07A9.3 TGTGCCTAACCCAAAATTATCAC TAACATAGCGTCGTTTTTACGGT IV-1H17
94  D10 IV  F55A8.1 ACAGAAGGATGTTGCAAAGGTAA ACTGCTGCTACTCTACTGTCGCT IV-1H19
94  D12 IV  F52C12.1    TCTGGCCAAATTTTTATTTTCAA CAATTTTTCACAGAAAATGAGCC IV-1H23
94  E01 IV  F52C12.2    CACCAGGAAATATCGATTCTCAA ATTCTTCCACTTCTTCCTCATCC IV-1J01
94  E02 IV  F52C12.3    ATCTACACAATGAGCCTCCGTAA AAAAACCCCTATTTCACAACGAT IV-1J03
94  E03 IV  F52C12.4    CGAGAAGTTTCAGAAGAGTTCCA ATTTTGATCGTTCCTTGGTTTTT IV-1J05
94  E04 IV  F52C12.5    CAGTATCCCCCATCACCAAC    ACAATCCACACGCGTTACAA    IV-1J07
94  E05 IV  Y48A5A.1    TCTCAATAGAGCGCGTTTTCTAC GATTTCATCTCTGAGCCTCTCAA IV-1J09
94  E06 IV  R05C11.1    TGCTCCTCTATCCAATTCATGTT GAAATACGAAACTGTGACAAGGC IV-1J11
94  E07 IV  R05C11.2    TTCACAAATGTGACCTTGAACTG TGCCAAAATCTTGCTCAATTTAT IV-1J13
94  E08 IV  R05C11.3    TGTCAATTTAAACCAAATACCCG ACTCTTTGCAACAATTTAGCAGC IV-1J15
94  E09 IV  C23H5.1 TTTTTCTTTTCAAAAATGTCCGA TTCGGTATAATTCCAAAACATGG IV-1J17
94  E11 IV  C23H5.3 GATTTTTCTCCCATTTCCTGACT AAAAGGGGAAACAGAAGTGAAAG IV-1J21
94  E12 IV  C23H5.7 ACGAAAAGATTTTTGCACCG    TAGCCCGGAAAAATTTGATG    IV-1J23
94  F01 IV  C23H5.8a    GTAATCGACCTGCAAGTTATTCG TCGGCTGGTATCTCATAGAAAAA IV-1L01
94  F02 IV  C23H5.9 TGAAGGGACATAGAGGAAGAACA CGGAAATTACAAATTTTGCAGAG IV-1L03
94  F03 IV  C54E4.1 AACATTCCCATAACTCTGCTCAA TCAGTCTCGTCGGTCATTTTTAT IV-1L05
94  F04 IV  C54E4.2 AGTGGGAGAAACGGACTAAATTC TCTTTAAGCGTACCAAGAAGGTG IV-1L07
94  F08 IV  T04C4.1 AGTTAATGAAATGAGGAGAGCCC ACATTGATCTACCGAGTCCTTCA IV-1L15
94  F09 IV  M70.1   GTGGAAGAATGTTGGCGATT    TGATCGCTTTTCAGTTCACG    IV-1L17
94  F11 IV  M70.3   GGATGTCCACACTCGGAAGT    TTGATGAGCACAGTGGCTTC    IV-1L21
94  F12 IV  M70.4   TCAGAAAAATTGATGGCCTAGAA GCGTCGTAATTTGAGTGAAAATC IV-1L23
94  G01 IV  M70.5   CGGATTTTCTTCAGATTTCACAC AAGTTAAATTTTCGTTTTTCGCC IV-1N01
94  G02 IV  C37F5.1 TTTTCCAAACGATTTTCAAAGAA TTCCCATTTTCAATTTTTCTCCT IV-1N03
94  G03 IV  C45G7.1 TTGATTCTCTGGAAAATCGAAAA TAACACCGCAACTCTCGTTTATT IV-1N05
94  G04 IV  C45G7.2 ATGTTTCAAACTGTGCTTTCGAT CCAGAACCTCAACCTATCCTCTT IV-1N07
94  G05 IV  C45G7.3 ATGCCAAAATCAAATGCACA    TCCAGTATCCCAGAGTTCCG    IV-1N09
94  G06 IV  C45G7.4 GCACAAAACAAGCGTTTCAA    CCCCGACGAACTTGTTTTTA    IV-1N11
94  G07 IV  C45G7.5 TGAGTTTGATGCGCAGATTC    TGTTGGTGGCCTAGAAATCC    IV-1N13
94  G08 IV  C45G7.6 TGATGGCCTAGAATTCCCAC    CTGGCTCCTACCACGAAGAG    IV-1N15
94  G09 IV  M4.1    GATGGGAAGCTGATGGAGAA    AAAACACGAAATTTCACGGC    IV-1N17
94  G11 IV  T23E1.1 CACCCCAATCTATGCCACTT    TTTCCTCCGAATTTCAGTCG    IV-1N21
94  G12 IV  T23E1.2 TCCAGATTCATCTGCTTCTTCTC AAGTCCGGAATATTCAAACCATT IV-1N23
94  H01 IV  T26C12.1    AGTCGCTCGTCTTCGTCAAT    GATCGAGCCATTGAAGTGGT    IV-1P01
94  H03 IV  T26C12.3    TTTTTCCGATAGCAGTTGGC    TTTCCAATGCTCTAAGGCGT    IV-1P05
94  H04 IV  T26C12.4    CTTCCGGATTCTCATTCCAA    AATTGCGACGGAACAAAAAC    IV-1P07
94  H05 IV  W08E12.a    GGATCGCACAGTTTATGACTTTC CAAACACGATGAGGGGATTATTA IV-1P09
94  H06 IV  W08E12.b    CTCCAAATTTCAGATCTTCGTTG CTTCTAATCTGCCAAGAGCATGT IV-1P11
94  H07 IV  W08E12.c    GCGATAGGATTTTCCTTCACTTT AGTTTTGAGACTGGGAAACATGA IV-1P13
94  H10 IV  W08E12.f    TTCTTTGAACCTCGGAAATTGTA AGCTGGTATGGAAATCTGTCAAA IV-1P19
94  H12 IV  W08E12.h    CCATCAGCTCTTACATTTATCCG TGAATTTCCAAAAACTAAGGCAA IV-1P23
95  A01 IV  W08E12.i    CCATCAGCTCTTACATTTATCCG AGTGCCTGCTACGCAACTTATAG IV-1B02
95  A02 IV  W08E12.j    GGATCGCACAGTTTATGACTTTC TGCTGCACAGTCACAAGTAAGTT IV-1B04
95  A05 IV  Y55H10B.b   AACCAAGCTTCTATCCCGTAAAC TTGTGATGAAGGTTATGCAACTG IV-1B10
95  A06 IV  Y55H10B.c   AACTTTTCGCTGAGTATCAAACG CATATAAAACGAAACCGGGAAGT IV-1B12
95  A07 IV  Y55H10B.d   AGTGAACTACGCAGAAAACGAAG AATGACGGTAAGTTCGTCAGAAA IV-1B14
95  A08 IV  F42A6.1 ATCAACGCGGTTCTACTAATCAA AACAATCTGTTTTACAGACCGGA IV-1B16
95  A09 IV  F42A6.2 AAAATTTGAAAACTTTTGCACCA GCGGGACCTAGCATAGTCTTATT IV-1B18
95  A10 IV  F42A6.3 TTTCGCTTAGCAGTGGTGTG    ATTGGAGTGCAGCTTTCGTT    IV-1B20
95  A11 IV  F42A6.4 TTGAGGGTTGAATCTTTGGG    GCTGAACCAATCTCTGCTCC    IV-1B22
95  A12 IV  F42A6.5 AAAAACCAGGAAAAATGGAAAAA TAGGACGTCAATGGCTTGTAGAT IV-1B24
95  B01 IV  F42A6.6 ATTTTCCATGATTTTTCAGGGTT GTTTATCTGGATCTGGACGACAG IV-1D02
95  B02 IV  F42A6.7 GACACTTAGAGGGGCTTAAGGAA TGTTTTCGCGTAATTCTTCATTT IV-1D04
95  B03 IV  F42A6.8 GGCGATCTGAGGAGAATCTG    GGGACCTGGGCTAGATCTTC    IV-1D06
95  B04 IV  F42A6.9 AGATCCCGATTCATATCTCCAAT ACCCATGTTTTTGTAGGTTTCCT IV-1D08
95  B05 IV  Y55H10A.1   ATCTACGGAGAAGAATGGACCTC TCGCTGAAATAGGCTTAGAATTG IV-1D10
95  B06 IV  Y55H10A.2   ACACTAAACCCGCTCTACCATTT TAAAGTCGTGGAAGTTGGAAAAA IV-1D12
95  B07 IV  B0546.1 GATAGAATTCCCGTATCTTCGCT TACTGCAAATTATTCCTTTCCGA IV-1D14
95  B08 IV  B0546.2 ATTTCCTCGTATAGTCCTGAGCC ATGACCAATTTTCAGGGGTCTAT IV-1D16
95  B09 IV  B0546.3 TTCAGACCAAGGAAAAACCG    TGTTCGACGAAGACGATGAG    IV-1D18
95  B10 IV  B0546.4 AGTTTTGGGGGAATTTCAGATTA AAGTGCGAGAGAGTACACGAAAC IV-1D20
95  B11 IV  B0546.5 AAAGCTTCTTTCATGTCTCGATG ACAAGCAGGTCATCAACCAGTAT IV-1D22
95  B12 IV  C04C3.1 CACCATTTCAATGCTAGGTTCTC TCAAACAAGCCAATTTCAAGAAT IV-1D24
95  C01 IV  C04C3.2 TGAAATTCATGGAAGAGGGC    CAGACCCATGGAATTTTTGG    IV-1F02
95  C02 IV  C04C3.3 GTTTTCCTGATGGGAGAAGAAGT AAGTTTTGTGCCATTCTTAGCAG IV-1F04
95  C03 IV  C04C3.4 TCAAATGTTCTCCGTTGTTTTCT CGCTCCGTCTCTATGTAGTTTGT IV-1F06
95  C04 IV  C04C3.5 ATCTACCCTCCCAAGCACCT    ATCACAACTCCCGGAAACAG    IV-1F08
95  C05 IV  C04C3.6 ACAATTTGGTCCTATCGAAATCA ACTACTCTCCTTGGATTTCTGGG IV-1F10
95  C07 IV  W05E7.1 ACCAAGCGAGGCAACTCTTA    TGGTTCCACTTGCACACATT    IV-1F14
95  C08 IV  W05E7.2 CTTGCCCACCATGAGTTCTT    TTTTGCGGAGAACTTTGCTT    IV-1F16
95  C09 IV  F09D12.1    TTTCTGAAGAAAAGTGCACAACA AATGTGCCAAATTGAACCAATAG IV-1F18
95  C10 IV  F09D12.2    TCTCGTGCACATTTTTCAGC    CCCGAGTAACGGAACCTACA    IV-1F20
95  C12 IV  F58E2.2 AAGAGGCGACTAAAGCAGAAGAT ATTAAAGTTGGACATTTTCCCGT IV-1F24
95  D01 IV  F58E2.3 CCATCTTGGGAGGCTTGATA    GGGCACCGATAAATTTGCTA    IV-1H02
95  D02 IV  F58E2.4 CACCTGCTAGTTAGCCTGCC    CGATGGATTTTCAGGTCGTT    IV-1H04
95  D03 IV  F58E2.5 CCCACTAAATGAGAACCTGTGTC GAACAGAGAACTGAAGAACCACG IV-1H06
95  D04 IV  F58E2.6 CAAATCAAGATCACGAGGCA    TGACACCAAACTCCCACAAA    IV-1H08
95  D05 IV  F58E2.7 CGCTCAGTCAAAATGTGGAA    GGTCGTCATGCTCGGTAAAT    IV-1H10
95  D06 IV  F58E2.9 AAGCCCAGGGTGTTTTCTCT    CCGCATAAAACTTGCACAAA    IV-1H12
95  D07 IV  C09G12.1    TCGATTTGGTAAAACGTCTTGAT GTGATGGGAAGAGAGATTAGGCT IV-1H14
95  D08 IV  C09G12.2    ATCAGGCTTGCAGGAAAATG    CGCATTTGCATGAATGTACC    IV-1H16
95  D09 IV  C09G12.3    TGCAAGTGAACAACTTGAAGAAA GGAAAAGTAGGAAGAGATTCGGA IV-1H18
95  D10 IV  C09G12.4    TGTGACGACAGCAAGAAAGG    CTGCCATTTGCAGAGTTTGA    IV-1H20
95  D11 IV  C09G12.5    AGTTTATACATCGTTCCCCGATT AAAGCTATCGCAGTTAACGTCAG IV-1H22
95  D12 IV  C09G12.6    TTGGTGCCTTTTTCGGTTAG    AAAGCTTCAAGGTGGCAGAA    IV-1H24
95  E01 IV  C09G12.7    GATAGCAAATCACTGTGTCACCA AGCTTACACAACGGCTTTATGAG IV-1J02
95  E02 IV  C09G12.8a   TAGTAATTTTCAGCCGATTTGGA ATTTTTAAGCCAATTTTTCCAGC IV-1J04
95  E03 IV  C09G12.9    CACATGTCAAATCTTTCGCATAA TGTGATTTTTCATGCATTTTGAG IV-1J06
95  E04 IV  Y37E11C.1   GCAAAACCTCTGAAAAAGCTGTA TTAGATAAATCACTTCCGGGGAT IV-1J08
95  E05 IV  M57.1   AACTTGATTTCGATGGGTCG    CGAACACGAATCCCTTCAAT    IV-1J10
95  E06 IV  M57.2   AAAAGAGCACACGAAACGCT    CCAACTTCCAACAGCCATCT    IV-1J12
95  E07 IV  B0212.1 AGCTGGCTCACTTGCTCAAT    TCAACAGCTTGACAACTGCC    IV-1J14
95  E08 IV  B0212.2 GGGGTTTTTAGAAGTGTACCCAC TGATAACAGATTGAGCTTGAGCA IV-1J16
95  E09 IV  B0212.3 CGTAATGTTCACAAAAAGGAAGC GATCACTAGCTCTGGTGGAAGAA IV-1J18
95  E10 IV  B0212.4 TGCGAAAATTTCAAAAACCC    GGAAGACAAAAGTGGGACGA    IV-1J20
95  E11 IV  B0212.5 TTTCTACCCAACTTGGTGGC    AACATTCATTTCAGGCGGAG    IV-1J22
95  E12 IV  Y37E11B.1   ATTAATCATTTTTCTGTTGCCGA TGGCTTCAGATTATCATGTTTCC IV-1J24
95  F01 IV  Y37E11B.2   AAGCAAAGTCTCAAAGTTCGGTA ACTTGGGGATTCCATCATAACTT IV-1L02
95  F04 IV  Y37E11B.5   CTTTCCGTCAACTTTCAGAGAGA AATTTCCGCCTAAAAATCAATGT IV-1L08
95  F06 IV  Y37E11B.7   GTAGAAAAGCTGCTGGAACAAGA AAGAAATTGTGGGTTTTCCAAAT IV-1L12
95  F07 IV  Y37E11B.9   ATCTTAAAGTCGAGCGTCATTTG AAATTCATTCATTTTGTGGCAAG IV-1L14
95  F08 IV  Y37E11B.10  ACTTTTTCGAGAAGTCCGCA    ATCTCGACGTTTCCATCAGG    IV-1L16
95  F09 IV  ZC416.1 GCTACCTTTTCCCCTGTTGTAGT TCAATTCACGCCTTATTCCTAAA IV-1L18
95  F10 IV  ZC416.2 CAGGGATATTACAACCCAAATCA GAGTAATAAGACGGGGGAGCTAA IV-1L20
95  F11 IV  ZC416.4 GTTGGTTGAGCTGGTTGGTT    CGTGATCGGTTTGATAGCCT    IV-1L22
95  F12 IV  ZC416.6 ACGAAAATCAGGGGAAAAGG    CACGCCTACTCACCAGTTCA    IV-1L24
95  G01 IV  ZC416.8 ACAGAGAAGGATGAAAGGACACA CAAACTCAAACGTTTCTTTCCAG IV-1N02
95  G02 IV  CC8.a   TCTATCGCGCTTCTTTTAAAGTG CTATAAAACATCGCCAACTTTCG IV-1N04
95  G03 IV  CC8.b   TGGCCGAAAAATAAAAGTGTCTA ACAGAGAGATGGGATTATGAGCA IV-1N06
95  G04 IV  CC8.c   AACATTTGCTGCAATACCTTGTT TTTTCCTAAAGTTCGACAAGCTG IV-1N08
95  G05 IV  W07G9.1 ACAAGTTTCATTCTCTGCGTCTC TGGGGATTAAGATTAGGGACATT IV-1N10
95  G06 IV  K09B3.1 CAGCACTATGTTTCTCCTGCTCT CACGGGTGATATCGAGAATAAAA IV-1N12
95  G07 IV  K09B3.2 TGAGTTTAATAACGGCTGACGAT ATACAAAAACAGAACGGAAGCAA IV-1N14
95  G08 IV  M02B7.1 CTCGAAGCCGATCTCGTATC    GGGAATTTGTTCGGGTTTCT    IV-1N16
95  G09 IV  M02B7.2 CTCGTCATTTGTGGAAAGCA    GTGTCCTTGGAGCCTGTGAT    IV-1N18
95  G10 IV  M02B7.3 GAGGTGGTCGTTTTGCAGAT    GAGTATGAGCGGGAGCAGAC    IV-1N20
95  G11 IV  M02B7.4 TCCAAATTTCCATCTTTCTGTGT TTTGTTGTTTTCCAGCAGAATTT IV-1N22
95  G12 IV  M02B7.5 GGAAATACCTCGTTGGAGAGAGT ATATTGATCGAAAAACGCTTGAA IV-1N24
95  H02 IV  F28F9.1 CTTCTTTGTCCCCCTCCTTC    GTCCCCCGGTCTATCTTCTC    IV-1P04
95  H03 IV  F28F9.2 GGTAATCCGACCAATCAATGTAA TTCCCGAGATTGTTTTCAAGTTA IV-1P06
95  H04 IV  F28F9.3 ATTTTGAAGGAAACACCAGTTGA ATTTGAAGTTTTGAAGCCGTGTA IV-1P08
95  H05 IV  F28F9.4 ATCAAACTGAAGCAGGTGGG    CCTTCTTTGGCTTTCACTGC    IV-1P10
95  H06 IV  F37C4.1 ATTAGCTGTTGCTCTGGCGT    CCCCTCCCCAAATCTTACAT    IV-1P12
95  H07 IV  F37C4.2 ACCCACATATCCACACTACCAAG GAATTCTTTGTTCAAAGTCGGTG IV-1P14
95  H08 IV  F37C4.3 CCTTCGTAACAATGGGCACT    TACGTGGAACTGCATCCAAA    IV-1P16
95  H09 IV  F37C4.4 GTTTGATCGAATTGTGAGTGTCA GCAACAAATGGAATTGGAATTTA IV-1P18
95  H10 IV  F37C4.5 CCCAACGACACCTCAAACTT    TTTTCAGAACCTCCCATTCG    IV-1P20
95  H11 IV  F37C4.6 AGTTCGGAAGCTCCTTCACA    AAAATTGTGCGATTCTTCGG    IV-1P22
95  H12 IV  F37C4.7 AAGAGCAAAAATGGAAAGAGACC TATCTGGCACAACTCACTTTTGA IV-1P24
96  A05 IV  F56D6.5 AATCCCACGTGACCCTATTAGAT CAACACCTTTGATCTGTTGTTGA IV-2A09
96  A06 IV  F56D6.6 TCTTGAACTTCTCGACCTTTGAG GCTTTCTTCTTATCCTCTTTCGC IV-2A11
96  A07 IV  F47C12.1    TCTGTCGAAGAGGGAGCAAT    CAGCTGTTCCGATTTCCATT    IV-2A13
96  A08 IV  F47C12.2    CCGGACAAACTTCCGATTTA    AACCACTTGTCCTGGCGTAG    IV-2A15
96  A09 IV  F47C12.3    CCCATTCATATCTTCGGTGG    ATAAGCCCGCTGCTAACTGA    IV-2A17
96  A10 IV  F47C12.4    CAAAGAAAGGGTGCCAAAAA    GTAAACGTGGCCATTTTGCT    IV-2A19
96  A11 IV  F47C12.5    AGTTAAACGCATTTCCACCG    TTACATTTTCACCTGCTGCG    IV-2A21
96  A12 IV  F47C12.6    CTTCGCAAGACCATTTTCATAAG AGTGTGTCCGGAGTGTGAGTTAT IV-2A23
96  B01 IV  F47C12.7    GGGAGAAGCATATTGTGAAGTTG GAGAAATACTTTCCCATTTCGCT IV-2C01
96  B02 IV  F47C12.8    GCTGGTCTTTTACAATCTTGCAC TCAGATCCTGTTCATTTTGAGGT IV-2C03
96  B03 IV  F47C12.10   ACCGCTATGCTCACCTGACT    GATTTGCGCCCTAAATTCAA    IV-2C05
96  B04 IV  W02C12.1    ACTACTTCTGCGTGTGCCCT    CGGCCAGGTTACATTTGTCT    IV-2C07
96  B05 IV  W02C12.2    GAGCTCTTCCCAGAATAGAGGAG TTCCACCTCAAACTCTCATGAAT IV-2C09
96  B06 IV  W02C12.3    CTCTGATGTGTTCTTCGGCA    TCTTCCCATCTATTCACGGC    IV-2C11
96  B07 IV  F35F11.b    CAATCAAGTCTCATTCGCTCTCT TTCTTCTAATCAAATCAAGCCCA IV-2C13
96  B08 IV  F35F11.c    GGCCTAAACCTGAACCTAGAAAA CGAACGACCTAAGTAAGCTTCAA IV-2C15
96  B09 IV  F35F11.d    TTGAAGGTGTTGAAGTTTTCGAT TTTCAGCTTTTTCTCGTTTTCAG IV-2C17
96  B11 IV  W03D2.1 AAAACGGACAAAACGGACAG    TCGAATGCCAGAATAACGTG    IV-2C21
96  B12 IV  W03D2.2 AGTTTCCCCATTCACTCTACTCC ATCAACTCGTTGAACATCAATCC IV-2C23
96  C01 IV  W03D2.3 CGTAGATTACTCCCCCATAGCTC GCTCAGCTCAAAAAGTGATGATT IV-2E01
96  C03 IV  W03D2.5 CCGAAAACGCATAGAAAAACATA ACAGACACGCATGTTTAACCTTT IV-2E05
96  C04 IV  W03D2.6 AAATTTTTCACAAAAGTGCCTCA CCTATGTATTAGTTGCTGGCGTC IV-2E07
96  C05 IV  W03D2.7 TTCAAGAATTTGACTGTTCCGAT AACACTGGTCGGTTTTCAGACTA IV-2E09
96  C06 IV  W03D2.8 CAAAGAAATCAAATGCTGACTCC CACTTCAAATCTTAAGTCCACGG IV-2E11
96  C07 IV  W03D2.9 TTTTCAGTGCAAGGTTTCATTTT ATCCTAACAATGACTGCGTGTTT IV-2E13
96  C08 IV  W03D2.10    GGTTACTGCCGCACACTTTT    AGGTGTCATCACACTCAGCG    IV-2E15
96  C09 IV  C35B1.1 TAGGTTATCAATATGACGACGCC AGATGATTTTTGGGGGTAGAAAA IV-2E17
96  C11 IV  C35B1.3 ATAAATACCCCACCCTATCCCTT GTCTGTACCGATTTTCCAGAATG IV-2E21
96  C12 IV  C35B1.4 ATATCTAAAGTGTCTCCGTGGCA TGAAGCACAAGATTGCAGATTTA IV-2E23
96  D02 IV  F49F1.1 CCCCGCATTTTTCTTATCAA    CTTTGGAGACGAATCCTTGC    IV-2G03
96  D03 IV  F49F1.2 AGCTTGTATAAAACCCCTTTCCA CTGATAAAATTGATTCCGACAGC IV-2G05
96  D04 IV  F49F1.3 TCTTTGGGGAATATGGAGATTTT GTGGGGATAAATCATGTTTCAGA IV-2G07
96  D05 IV  F49F1.4 TCTGAAACATGATTTATCCCCAC GACTGCACATCAATGGAACAGTA IV-2G09
96  D06 IV  F49F1.5 ATCCGTGCGAGGTAATATGTATG GCACAAAACCAAAAGACGATTAC IV-2G11
96  D07 IV  F49F1.6 AAATCAGTTGAGAAGTCTGCGTC AAATACATCTTTGCTTTCGTCCA IV-2G13
96  D10 IV  F49F1.9 AAATGTTTCAACAAACTGGCAAC AATACGTGGTAGAGGTGCAAAAA IV-2G19
96  D11 IV  F49F1.10    GAACTTTGTTTCGTGAAAACACC GCTGGCAGTTAAAGAGAGCAATA IV-2G21
96  D12 IV  F49F1.11    CTTGATGGATTAGGAGTTCGATG CACTATGATTCAACCTCCTCCAG IV-2G23
96  E01 IV  F49F1.12    TTGTAGCCCTCACAAAGAATCAT GTAACCGTACACACTTTTCAGGC IV-2I01
96  E03 IV  R07C12.2    ACTACAACACGTTTGCACGC    AAAGGAAGTCAGGCGATGAA    IV-2I05
96  E04 IV  R07C12.3    CAGTATCCAACTTCCTCTATGCG TTCTCTTACTTGGGAGTTATGCG IV-2I07
96  E05 IV  K08D10.1    GAAAACAAATCGCTCAAATTACG TCCTGCAAAGAAAATGTTACGAT IV-2I09
96  E06 IV  K08D10.2    AAGTCGATTTTCCGAGATTTTTC ATCGGCAAATTTTCTCCACTAAT IV-2I11
96  E07 IV  K08D10.3    TCGACTTTATCCACTTTTTCAGG CGGGAAAAACACACATAAAACAT IV-2I13
96  E08 IV  K08D10.4    CAATTGAAGTTTGCTCCATTTTC TTCATCAAATTCCAGAGAGATCC IV-2I15
96  E11 IV  K08D10.7    GCAATTAGCTTAACGTCCGC    ACATCTCCTGCATGAATCCC    IV-2I21
96  F01 IV  K08D10.9    TTCGATTTGACACTAGCCAATCT GAAGAATGCACATCGACATGTAA IV-2K01
96  F04 IV  K06B9.1 AAACTCGAAACCTCTATTTTGGC CCTCCTGAAGGTCGTAAAAGATT IV-2K07
96  F05 IV  K06B9.2 ATTTTCCCCCAAAACACACA    TCGGATTCCAAGGCACTATC    IV-2K09
96  F07 IV  K06B9.4 ACTAACCCATTTGGCAGACG    TTCCATTCGTCCAAACACAA    IV-2K13
96  F08 IV  K06B9.5 CAGAAGCCAAAACTTCACAGACT TTTGACCTGCTCCATTAATGACT IV-2K15
96  F09 IV  F30B5.1 TGCTTAGCCATGGACATTGA    CGCACAGGAGAAAGTGACAA    IV-2K17
96  F10 IV  F30B5.2 CTAAGCCTACTCCTAAGCCCAAG TTTCCACCTCAATTTTTGCTTTA IV-2K19
96  F11 IV  F30B5.3 TATCTCGAAAGCCATCACAAAAT TTGAGTCTTCTATCAGTGGCACA IV-2K21
96  F12 IV  F30B5.4 GGAAACGAAGTACGGATGGA    CTGCTAAGTGAATTGGGGGA    IV-2K23
96  G01 IV  F30B5.5 CAATGCCAAACAATCATTCG    AAACACGGGATGGAGACAAG    IV-2M01
96  G02 IV  F30B5.6 CAGAATTTGCAGCGAAAACA    GAAGATCCCCAGAAAAAGCC    IV-2M03
96  G04 IV  F36A4.1 GGCAAGAGTGGGTTAAACTTTCT AAAAGCTCCGGGTACAGGTATAG IV-2M07
96  G05 IV  F36A4.2 CCACAGTGAGCATTGAAAATACA AACAAAAACAAAGAACCTCGACA IV-2M09
96  G06 IV  F36A4.3 GCCTTGCAATTCTATGCTCTCTA TGAGTTTTGGGTAGGATGTCTGT IV-2M11
96  G07 IV  F36A4.4 TTACAGGCAGAAGAAACCCATAA TAAGAACGTGAAGCCTCAAGAAG IV-2M13
96  G08 IV  F36A4.5 GCCAAACTGTCACTTAAATTTCG CAGTACCCCTACAGTAATGCTGC IV-2M15
96  G09 IV  F36A4.6 TCGGTTTGTAGCCTACTCCG    TGCAATACCGCAGAAAACAG    IV-2M17
96  G10 IV  F36A4.7 GGACGACGTGTTCCTACGAT    GTTGGCGAATAACTGGGAGA    IV-2M19
96  G12 IV  F36A4.10    ACTCTGGGCTTTAACAGCGA    AGGCGAGACGACAGAACACT    IV-2M23
96  H01 IV  F36A4.11    TGCTTCTTACCAGAGACAGGTTC ATTCTCCCAACATTTTTGGTTCT IV-2O01
96  H02 IV  F36A4.14    GAATTCAATGGGTGTCCCAG    TCCAGAATCCCACAACATCA    IV-2O03
96  H03 IV  F15E6.1 CAGCATCATCATCAAATGCC    CTCAACCTCTGATTCTCGCC    IV-2O05
96  H06 IV  F15E6.4 CAGTAAATGCTAGTCGGAATTGG CCCTCATTTAGCGATCCTACTTT IV-2O11
96  H07 IV  F15E6.5 TTCACGTCTGGAAACTCAAAAAT AAATTTTCAATTGGGCTTCAAAT IV-2O13
96  H08 IV  F15E6.6 TTCACTTTTCCCAAAATGCC    TGCTCCTGTTCAATGTGCTC    IV-2O15
96  H09 IV  F15E6.7 TCAAAACTTCGGGATAAACTTCA TGTTTTCAAATCGTCGTTTTTCT IV-2O17
96  H10 IV  F15E6.8 AAGTTATCCCAAAAGTCCTCCAA CCAATTCCGACTAGCATTTACTG IV-2O19
96  H11 IV  F15E6.9 TTACCAAAATGTCTTCCGGC    TCACCAGGAGCTTCCCTTTA    IV-2O21
96  H12 IV  Y24D9B.1    CGATGGATTCTTTGATGAGTAGG CGATTCCTTATTTCTCGTCTCCT IV-2O23
97  A01 IV  W03B1.1 TCTAAAGCGTAAAAAGCGACAAC CACGATTTTCCAAAACCATTAAA IV-2A02
97  A02 IV  W03B1.2 TTGCCCTAAACGTTTTGAAGTTA AGGAAACCTCCACATAATACGGT IV-2A04
97  A03 IV  W03B1.3 TACTACAGTTCGGGCGCTTT    GGAGGTATGTAGGCAGGCAA    IV-2A06
97  A04 IV  W03B1.4 CTGGCAAGTCTGGAAAAAGC    CGTTTTCGAAGAGGTTCTGG    IV-2A08
97  A05 IV  W03B1.5 TTCCTTCAGGCTGGTCAACT    ACAAGAATATTGGCCGAACG    IV-2A10
97  A06 IV  W03B1.6 CCCAGTTCTTAAATTGCCCA    ATCCTTCACGAGCTGAGCAT    IV-2A12
97  A07 IV  W03B1.7 CTGCCAACTGTCAAATTAAGACC AAGCATTAAACATCCTGTTCCAA IV-2A14
97  A08 IV  W03B1.8 AATACGCAAATCCCTTGTCG    CAGATGATGCGGCAAGATTA    IV-2A16
97  A09 IV  W03B1.9 TTTGTCTACAAGAATATTGGCCG AAAAATCTTCAATTCCTTCAGGC IV-2A18
97  A10 IV  F55F10.1    CGTGGAAATGATGGATGTTG    AGCTCCGAGCACAGTTGATT    IV-2A20
97  A11 IV  F55F10.2    CCTTCTCGTCGGAGAAACTG    AATCCGGTTTCCAGTAGCCT    IV-2A22
97  A12 IV  Y24D9A.a    TATATCCACTCTCGAACCAGGAA TTTCTAGCTCAATCTCAACCTGC IV-2A24
97  B01 IV  Y24D9A.b    CTTCTTTCACTTTCACCAGTCGT GGAAAACTTTGACAATTCAGCAC IV-2C02
97  B02 IV  Y24D9A.c    CCGTTTTTGTGTATGATTACGGT TTGAAAACGCCACAAAATAACTT IV-2C04
97  B03 IV  Y24D9A.d    TCCAAATGAGTACCACGAAGACT TTTCGCGAATTTTAAGACAAAAA IV-2C06
97  B07 IV  Y24D9A.h    TTCTTGAACTGAAGGAGTTCTCG TTGAAAACGCCACAAAATAACTT IV-2C14
97  B09 IV  R08C7.1 CAGAACAGTCCTAGTTTTCGCAT TACTTTGGCATCCATTTTCACTT IV-2C18
97  B10 IV  R08C7.2 GTCGACGCAAGTGAGTGGTA    TGGTCCGGTCGACTATTCTC    IV-2C20
97  B11 IV  R08C7.3 CTTTCTGGTGTTTCTGAACTGCT AAGAATATTGGATGAGGCAGTGA IV-2C22
97  B12 IV  R08C7.4 GAACCGATTCCGTTGACCTA    AGTAGGCAGGCGTTCAGAAA    IV-2C24
97  C01 IV  R08C7.5 TGCCACGTTGCAAATCTTTA    CGGAAAGTTCTTTTGCTTGC    IV-2E02
97  C02 IV  R08C7.6 TTAGGTGCCACCCAGTTAGG    TATCATTGAATCCGCCCAAT    IV-2E04
97  C04 IV  R08C7.8 GACGACCACGGTCTGAAAAT    ATTCTGAAAGTCCCACGCAC    IV-2E08
97  C05 IV  R08C7.9 ATTGTTCCATCCTTTCGTCG    TCCTCTGCCCAATCTACCTG    IV-2E10
97  C06 IV  R08C7.10    GGCGCCAAATATGTGAAAGT    TGGGTATGGATCTCGTGTCA    IV-2E12
97  C08 IV  M01H9.1 CGTAAACTTGTCCCTCTCAGCTA CGGTAGAACTGGAAAATGAACAG IV-2E16
97  C10 IV  M01H9.3 AATGATAATCCAAGAGGGGAAAA TATCTCGCCTTAAAAACAAGTCG IV-2E20
97  C11 IV  M01H9.4 TGGAGATACGATTCTTCGATTGT ACATTTCAGAATTTTCAGACCGA IV-2E22
97  C12 IV  ZK180.1 CGACAACACTCTTCATAAGACCC TCGAATAGTCAGCCCAGATGTAT IV-2E24
97  D01 IV  ZK180.2 TGTTTTGCTATCTCAACCCAGTT TCTTACTATTTACAGCCCCACGA IV-2G02
97  D02 IV  ZK180.3 ATTCGGCAAAAATCACCTTG    GTACGGGGGCAGGTAAAAAT    IV-2G04
97  D03 IV  ZK180.4 ATGGGGATGTTTGAATGATAGTG CACACTGCGTCTCTTTTCTCTTT IV-2G06
97  D04 IV  ZK180.5 TCTGCTCGTATCCTGGCTTT    CCGGAGGATCTTACAACCAA    IV-2G08
97  D05 IV  ZK180.6 AACCTGTGGTTTTGGCTTTG    GAGCAGCAAGCTACCCAAAC    IV-2G10
97  D06 IV  ZK185.1 TACATGCGATGTATCCAAGTCAG AAGATAATCGTGTAGCTGGTGGA IV-2G12
97  D07 IV  ZK185.2 CGTAAATCGACACATGACCG    TTTCTCGATTCTTCCGTGCT    IV-2G14
97  D08 IV  ZK185.3 AATCGAAAATCACTTTGTCTCCA TCTCCCTTTCTTTACTTCCCATC IV-2G16
97  D09 IV  F28E10.1    TCCGGGGTAGGCTAGAATTT    TTCCCTTCTTTGCCAACATC    IV-2G18
97  D10 IV  F28E10.2    CTCTCTCTGAAAAATGGCTGAAA ACTCACCTTTGTAAATCGCATGT IV-2G20
97  D11 IV  F28E10.3    GGACAATTGAGTCGAACAGATTC GTTCTACACGGAGCTCTTCAAAA IV-2G22
97  D12 IV  F28E10.4    CCACCACTATCCGAGGAAGA    CAGGCGACAAGATCATCAGA    IV-2G24
97  E01 IV  F19C7.1 TCGTTTTTGCTGGTACGTAGATT TGTATGTGTGATTCAACCCAAAA IV-2I02
97  E02 IV  F19C7.2 AACAAACGGAGACAAGTGGG    GGGCATGGTAGTGTCGCTAT    IV-2I04
97  E03 IV  F19C7.3 GTCAAATGTGCATGCGAAAG    TCATCGTGCCATACAAGGAA    IV-2I06
97  E04 IV  F19C7.4 GAGGCGTGTCTTGTGTCAAA    ACCTCATCTCCAATTGTCGC    IV-2I08
97  E05 IV  F19C7.5 GAACTACTAGCGGTTCCTTGGTT AATGCCCGAGTTTATTGAAAAAT IV-2I10
97  E06 IV  F19C7.6 TATCCTGGATCATTGTCTGCTTT CGGACTTGGCTTTAATAGAGGTT IV-2I12
97  E07 IV  F19C7.7 CCGCTGTCAAAGAAGACTCC    TTGGGCAAACCTAGATGACC    IV-2I14
97  E09 IV  R105.1  GTGCCCCAAAGGATCTGTTA    GCCCAACGGTTCTTCAGATA    IV-2I18
97  E10 IV  R105.2  TGGCTTAGAAATCCAAAACTCAA TCATTTGTGTGCCCTATCTCTTT IV-2I20
97  E11 IV  F29B9.1 ATGAGCGAACAAAGTGTTGAAAT GCCCTTTTTAGGCCTACTTACAA IV-2I22
97  E12 IV  F29B9.2 GAAAACGCGATTCGTAAGGA    AACCGCGTGAAAGAATATGG    IV-2I24
97  F01 IV  F29B9.4 CCGATTTTTACAGAGACGAAAGA ACAACGGTTAGGAAATTTGGAAT IV-2K02
97  F02 IV  F29B9.5 TTTTCCATCTCTTTTCTCTTCCC GATCGTCTTGATCTCGAACTTTG IV-2K04
97  F03 IV  F29B9.6 CTTATCGATCGGATTTCTGTTTG CTACCACGAAGCAAGCATCTACT IV-2K06
97  F04 IV  F29B9.7 TTACGATGAGTTCGAAAAGTGGT GAAAATTATAAATTCGAAGGGCG IV-2K08
97  F05 IV  F29B9.8 CTCGATTTCAGTGGGTCGAT    GAAGTGGGAACATCTCGGAA    IV-2K10
97  F06 IV  F29B9.9 CAAGTGCTTCTCTCTTTGGACAT CTATAAAGACATCGTCCACCGTC IV-2K12
97  F07 IV  F29B9.10    TCACGTGTAACAGCCACATTAAC TAATGGTGCAGAACAATGATGTC IV-2K14
97  F08 IV  F29B9.11    TCTTTCATGGATGGATAAACCAC TTTCTGTTTTTATAACCGCCTGA IV-2K16
97  F09 IV  T22B11.1    GTAAGAAAAGACTCCCCGGC    CCATCGAACAGTCTTCAGCA    IV-2K18
97  F10 IV  T22B11.2    TTTGGTGCCTATTTCCTCTATCA AAAGATCCCATACCGTCAAAAAT IV-2K20
97  F11 IV  T22B11.3    TGACCAGTTGCATACAGGGA    TGTTTGAGCCTGACGAAGTG    IV-2K22
97  F12 IV  T22B11.4    GCAGATCTACGATGGGGAAA    CGTGGAGGGACACTTCAAAT    IV-2K24
97  G01 IV  T22B11.5    TGAGTGGATCACGCTTCTTG    TCGACTCATTCGTCATTGGA    IV-2M02
97  G02 IV  K08F11.1    TACAAGAAAAATTTGCGATCGTT ACGACTATTTGTTTTGAGCGGTA IV-2M04
97  G03 IV  K08F11.2    AGAAATGCTTCCCTGGACCT    TCTCGTTTTCAGTTGCATCG    IV-2M06
97  G05 IV  K08F11.4    ACTGCCTAGTCGAGATGCGT    TCAGGCAGCTTCCACCTTAT    IV-2M10
97  G06 IV  K08F11.5    ATGAGCGTTGTCATGTTCCA    TCAGAGTGCTCATACCAGCG    IV-2M12
97  G07 IV  K08F11.6    TTTTTCGGAATTATGAAGCTCAA CCTTAGCAAGAAGAACTTCCACA IV-2M14
97  G08 IV  E04A4.1 CGTGTCTCTGCACGCTTTAG    GTCAATTCTCTTTCCGCTGG    IV-2M16
97  G09 IV  E04A4.2 CACATCGGAAAAAGCAAAGATAC AATCTCCCAGTCTACCCTCTGAC IV-2M18
97  G10 IV  E04A4.3 GGACGAAACTGCAAAATGGT    TTGCTTTGAATCGTATGCCA    IV-2M20
97  G11 IV  E04A4.4 GAAAACGGGATCTCGTCAAA    GCATCTCAAATCTGCGACAA    IV-2M22
97  G12 IV  E04A4.5 AACTTGATTTTTGGAAGGAAAGC TCGAGCTTTCAGATTCATTTTTC IV-2M24
97  H01 IV  E04A4.6 TGGCCAGAAAGATACGGAAC    GCAATTTCAGCATCCGATTT    IV-2O02
97  H02 IV  E04A4.7 GGAAAAGGAAAACGAATTTAGGA ATTTTAAGGGCAAAACCTTTCAG IV-2O04
97  H03 IV  E04A4.8 AAGCTGAACAAACAGGATTCAAA TAGAACACGCAACAAAACTAGCA IV-2O06
97  H05 IV  Y17G9B.b    CAAATTTGAACAGATTTTCGAGG CTGCTCTATTGCACCTCTTCATT IV-2O10
97  H06 IV  Y17G9B.c    ATTGGATTATGGCCTCATTTCTT ATCTGGGTATATTCTGAACGGGT IV-2O12
97  H07 IV  Y17G9B.d    GTGGAGATCAGTGTTCTGGAATC CATCGGACAACAATAGTTCACAA IV-2O14
97  H08 IV  Y17G9B.e    AAGCTGAACAAACAGGATTCAAA TAGAACACGCAACAAAACTAGCA IV-2O16
97  H10 IV  Y17G9B.g    TTTGGACAACTTTCTACCCTCAA TTTATTCTAGAAGTGGCTGTGGC IV-2O20
97  H11 IV  Y17G9B.h    CAATTTTCCTCAAGTTTTCAACG CTAGTGAAACTGTGTACGTTGCG IV-2O22
97  H12 IV  Y17G9B.i    AAATCGATGAGTGAAGCTCATGT CTTTTAGTGAAAACCGAGCAGAA IV-2O24
98  A01 IV  R11E3.1 CTACGGAGAGGTTCGCAAAG    ACCAGTGTTCGGTGAGGTTC    IV-2B01
98  A02 IV  R11E3.2 CCCCGCTTATTCACTCAAAA    AAATTTGCGCGTAGGAATTG    IV-2B03
98  A03 IV  R11E3.3 GGAACTGGCGACAAAGAGAG    TGGCAATTTCGTCAATGTGT    IV-2B05
98  A04 IV  R11E3.4 GATGTTTGAAAGGCTTGGGA    ACAATCCCGACTGTTTCTGC    IV-2B07
98  A05 IV  R11E3.5 AGAAACTCGAATTGTGTCACGTT AAATATCATCATTTGGTCGATGG IV-2B09
98  A08 IV  R11E3.8 TAGTAAGATCCCGACGTGGC    AGATGCTGGCGTTGTTTTCT    IV-2B15
98  A09 IV  H06H21.1    AAGGTCTCCCCGCTTACAAT    TGGCTGTGTACACTTCCGAC    IV-2B17
98  A10 IV  H06H21.2    TCGGACACCACTTGATGAAA    TTGTTTAACTTTCGGGTGGC    IV-2B19
98  A11 IV  H06H21.3    AATACTCACGAAATCCAAGCAAA TTAGGGGGAGAAAGAACAGAAAC IV-2B21
98  A12 IV  H06H21.5    TAGTAAGATCCCGACGTGGC    AGATGCTGGCGTTGTTTTCT    IV-2B23
98  B01 IV  H06H21.6    AAAGCGATTAGGCGAAATAAAAC GGTCGTTTCACCTAAACTGTACG IV-2D01
98  B03 IV  H06H21.8    GTCAATCAGCTCTTTGCAGTTTT GATATCAATGGAGAAGCAACTGG IV-2D05
98  B04 IV  H06H21.9    ACGAAAAGCTTCGAGTTCCA    TTTGAGCTCCCAAAGAAGGA    IV-2D07
98  B05 IV  H06H21.10   AATAAGCATCGGCTGCAAGT    TGCTGCTTCTGGAAAGGATT    IV-2D09
98  B06 IV  Y17G9A.a    ACTGAATTATTGCTGGCTGGATA TTGGAGTTTTGATGCGTAAGTTT IV-2D11
98  B07 IV  Y17G9A.b    TTTCATAACTGCAAAATAGGCGT GCGTAGATTGTCTAGGCTGAAGA IV-2D13
98  B08 IV  Y17G9A.c    AATTGAAATGTTTTGAAGGCTGA ATGAGAAAATGCTGCGAGTTTAG IV-2D15
98  B09 IV  Y17G9A.d    GTTCCGCTACACACTATTTTTGG TATGGGGATTTTAATTTCCGTCT IV-2D17
98  B10 IV  Y17G9A.e    ATCTGGGACCTGCAATAGTTTTT TGTCACACGTTCCTCCTTATCTT IV-2D19
98  B12 IV  Y17G9A.g    TTATTGCCAACTTTCTCCACTGT ATAAAAGGAATACCGGCAATGAT IV-2D23
98  C02 IV  T08B6.1 CGCTAATTATCGATCTGTTGTCC AAGAGCCATTCACAAATCAAAAA IV-2F03
98  C03 IV  T08B6.2 AATGGCGGGTGATTCTACTG    ACGCCATCCTCCAAATACAA    IV-2F05
98  C04 IV  T08B6.3 ATGAAATCAAAGGCTCCACG    ATTGGCATAGAGTCAACGGC    IV-2F07
98  C05 IV  T08B6.4 GTCTTGTGCCTTGAACCCAT    AGATAGTGCTACCGAGGCGA    IV-2F09
98  C06 IV  T08B6.5 TCCTGATCTCCCAGTTTTGG    ACTGGAACGACCAACCAGAC    IV-2F11
98  C07 IV  T08B6.6 AGTGAGATATGACCAACTTCCGA ACATTTTCCAGAAATCTGCGTTA IV-2F13
98  C08 IV  T08B6.7 CTGATTATCTTCGTACCTGTGCC CAAACAAAAACGATTCCATTGAT IV-2F15
98  C09 IV  T08B6.8 CATCGCAACAGAAATCAAGAAAT AGCGTTTACAAATATCGTGTGGT IV-2F17
98  C10 IV  E03H12.1    TGATGTTCAAAACGTTGCGT    GCCTCACCTAAAACTGCGAG    IV-2F19
98  C11 IV  E03H12.2    TTCGAAAAACGGCAAAAATC    GGACCTCCGCATGTAAAAGA    IV-2F21
98  C12 IV  E03H12.3    TCGTGTTTCCATGAGAGCAG    AATTGCAAACTTCTGGGTGC    IV-2F23
98  D01 IV  E03H12.4    GAAGTTTTGTGAGCCACAGGTAG TTCGAATGCCTAGTGAAAAATGT IV-2H01
98  D02 IV  E03H12.5    ATACAAGCACTCGAATAAGCTCG TTGGTTTAGGGTTAACTCAGCAA IV-2H03
98  D03 IV  E03H12.6    TTGAGTTGCGGAGAAAACCT    TCACCTGTTTAGCCAATCCC    IV-2H05
98  D04 IV  E03H12.7    GCCCTTCATACAGCCTATTTCTT CCGTGGCATCTTATAAACTTTTG IV-2H07
98  D05 IV  E03H12.8    GCACAACCTAACGTTGAAGAATC TCAGATTCCCAAGAAACTGATGT IV-2H09
98  D06 IV  E03H12.9    ATAAGCGTTTTCACCATCGTCTA TGCCTTTGCTATATATCCTGGAA IV-2H11
98  D07 IV  E03H12.10   TAAGGACCGAGAAAACAACAAAA GAAAAGAAATCACACGCAACTTC IV-2H13
98  D08 IV  T28H11.1    CACCACAAAATCGAATGACG    CCCATGTAAACCGATTGTCC    IV-2H15
98  D09 IV  T28H11.2    CAACACGTGGTTTGATGAGTTTA GCCAAATTTCTTATTTTCCTGCT IV-2H17
98  D10 IV  T28H11.3    CAAAATTCCAGAAATGACGACTC TTCTCAATTGGCGAAAGAATTTA IV-2H19
98  D11 IV  T28H11.4    ACAATTTCTGCTCGATTTGGATA ATTCACTAATTGTTGCGGTGAGT IV-2H21
98  D12 IV  T28H11.5    CAATACTGGTGCACAATCGG    ACGCAAAAGTTGGAGACCAC    IV-2H23
98  E01 IV  T28H11.6    ATCTTACGAAGGACCGAGAAAAC TTACGAAATGTGACTGGTGATTG IV-2J01
98  E02 IV  T28H11.7    GAAACGTTGGAAACAGTTCATTC CTCGAAGTTACTCGGACTTCTCA IV-2J03
98  E03 IV  T28H11.8    AAAATTCAACCACATGTTCCAAG TGCTCCATTTTACTTTGTTGGTT IV-2J05
98  E04 IV  C09B9.1 CGTCCTCCTTTGAAGAGTGC    ATTTTGAAAAGGCGGAACCT    IV-2J07
98  E05 IV  C09B9.2 CTGCGCGTAGAAAAACTTCC    TTGCTCTTCTCGTGATGTGG    IV-2J09
98  E06 IV  C09B9.3 TATGACTTTTGCGGGGTAGC    ACTTAAGCCTGCGCAAGAAA    IV-2J11
98  E07 IV  C09B9.4 CGGTGTTGACAATAACGTCG    CCGTTTTCATCGGTGTTTCT    IV-2J13
98  E08 IV  C09B9.5 ATATGAATGAAAACGAGCGAAAA CCCCAATTCGTACTACCTATTCC IV-2J15
98  E09 IV  C09B9.6 AGGAACATTAGAACCTGCAACAA AGAAATCTGCTCACAAGTCCAAG IV-2J17
98  E11 IV  R13H9.1 ATATGATTTGCTCAAAGCGGTAA GTTCAGCAAGTTCAACATTTTCC IV-2J21
98  E12 IV  R13H9.2 CATTCTTCACTACTTTGCGATCC TCCGATGAAGCAAAAACAATACT IV-2J23
98  F01 IV  R13H9.4 GCCTTCTTATCAAGCCTTCTTTC AAAACAATCAGACTGGACTGGAA IV-2L01
98  F02 IV  R13H9.5 AGCAAGGAATTTGTCGATTTGTA CAGGTTGAAAGATGGTCGATTAC IV-2L03
98  F03 IV  R13H9.6 CTCCTTCGCATTTCTTTTCG    ATCGAAACATTTAAACGCCG    IV-2L05
98  F04 IV  C02B10.1    GCCAGCTGAGTATGGTGGAT    CAAACAGAGATCACTGGGCA    IV-2L07
98  F05 IV  C02B10.2    TAAACTTCCGATTGCAAATGTCT GCATCAGACAGGGTTTAGTGTTC IV-2L09
98  F06 IV  C02B10.3    GGGGTTGAATTGAGAGAAAGTCT ATCTGGATGGGCATACAACATAC IV-2L11
98  F07 IV  C02B10.4    TAAAAAGTGGAGACGAGAATGGA TGTTTTTATCATGCGTTTCACAC IV-2L13
98  F08 IV  C02B10.5    TCCTTCAATTTTCGCTTGCT    CCTGAGTCATCTCCTGCACA    IV-2L15
98  F09 IV  C02B10.6    TCAATCAAGCAGCAATTGTTTAG AATGAAAACCGAGAGAAAACACA IV-2L17
98  F10 IV  Y72A2B.a    TCACGAAGAATCGGTAAGTTGTT TCCAGATCTGATGGCTACTTGAT IV-2L19
98  F11 IV  AC7.1   ACAATGTTCTTCTCGAAATGCTC TTGTTCATCGGAGTTTCGTAGTT IV-2L21
98  F12 IV  AC7.2   TGAAGCAAAATCCCCCATAG    GGGAATCGCTGTCAAATTGT    IV-2L23
98  G01 IV  AC7.3   TTGCTCTCTTCAACAGGAGTTTC ACATTTTGACCTCTCCTTTAGGC IV-2N01
98  G02 IV  AC8.1   GCTATCGAATATGCAAAGTCTGG ATAGAAATGTTGTCGGTGTACGG IV-2N03
98  G04 IV  AC8.3   CGCTTTCGAGAGTACGTCTATGT CAATTGTGCGAAATAAGTGTCAA IV-2N07
98  G07 IV  AC8.6   TACAGAATGTTGCAAATGTGCTC CTTCTCATTCTCTCTTCGGTGAA IV-2N13
98  G08 IV  AC8.7   TCCGTATTTTTACAGCGAATTGT GAAAAAGAAACGGAAGAAAGGAA IV-2N15
98  G09 IV  C24D10.1    AGCTACAAAGCCAAACGGAA    GAAGTGATGCGTTTGTCGAA    IV-2N17
98  G10 IV  C24D10.2    ACGATCACAGTCGAATTTCTCAT GCATTCACATAAGTAGGCAGGAC IV-2N19
98  G11 IV  C24D10.4    TACGCAGCTAAATTTTGGTTGAT AGAGGATTGTCCATTCGTCATAA IV-2N21
98  G12 IV  C24D10.5    TCCATTATCGATTTTGTCCATTC GTTGGAATGTTATCAGCCTCAAG IV-2N23
98  H01 IV  C24D10.6    ATAGAAAAATAACGAGGCGAAGG AAGATTCCTTGTGGACTCCTCTC IV-2P01
98  H02 IV  C24D10.7    AGAAACAAGAAATTTGCCATTGA TTTTCTTGTGCCTGTCGATTTAT IV-2P03
98  H03 IV  C24D10.8    ATCTGTGTCTCTTGCCATTTCAT ATGGGACAGAAATCGTCAGTTTA IV-2P05
98  H05 IV  W03F8.2 ACTCATTCCAGTCTCCACGG    GTCATAGTAGCACGACGCGA    IV-2P09
98  H06 IV  W03F8.3 TGAAAACGGGGAGAAGTTTG    TTAGCTCTTCTCCACCGGAA    IV-2P11
98  H07 IV  W03F8.4 ATGCCAATAACATGTTTACCAGG TGGAAGGCAGTATTTGAGATGTT IV-2P13
98  H08 IV  W03F8.5 AGCGGAGGAGCACTTTGTAA    TCTGATCTGGCGTCAAACTG    IV-2P15
98  H09 IV  W03F8.6 TATTTGAATTGCTGTTCCGACTT TTTTTCGGTCGGAAATAACCTAT IV-2P17
98  H10 IV  W03F8.8 CGATTTTCTTGAACATTTCCATC TTCTTACACTAAACCCCCACTGA IV-2P19
98  H12 IV  F36H12.1    GAGGAAGGTTAAGATCGCTGATT TTTGATGTGTGGAGACTATCGTG IV-2P23
99  A01 IV  F36H12.2    ATTTCCGGTGCGAACAATAG    AGAATCTCCTTCGATCCCGT    IV-2B02
99  A02 IV  F36H12.3    CTATAGTGGTGAGTATCCGCGTC CCTCAACTTTGGCAACATAAAAC IV-2B04
99  A03 IV  F36H12.4    GAGAAAAGCTCGAAAAATTGACA TGTAGAGTTCGAGAAACTGGGAG IV-2B06
99  A04 IV  F36H12.5    CATATTTTTCCCCAAATACGTGA CTTGTCGAAAGTTTTAAGCCAGA IV-2B08
99  A05 IV  F36H12.7    AAAACAATCAGACTGGACTGGAA CGACAACCAACTTATTTCACCAT IV-2B10
99  A06 IV  F36H12.8    CAGGTTGAAAGATGGTCGATTAC AGCAAGGAATTTGTCGATTTGTA IV-2B12
99  A07 IV  F36H12.9    ATCGAAACATTTAAACGCCG    CTCCTTCGCATTTCTTTTCG    IV-2B14
99  A08 IV  F36H12.10   TGGACATCGTTCTGGATTGA    GATTCTTCGGAATCATCGGA    IV-2B16
99  A09 IV  F36H12.11   TACAATACGAGAACGCATTTGTG CACAACAATTATTTTCCGCTGTT IV-2B18
99  A10 IV  F36H12.13   AATTCATGGTTTCAAGAAGCGTA TTCAAAAGCAAGAACATAAACCC IV-2B20
99  A11 IV  F36H12.14   GTGCAAGAATCGTAGCTTCCTTA TCGTCAGTGTGTGTTTTTCAATC IV-2B22
99  A12 IV  F36H12.15   GAGAGCTGCTTTAAATGTGGAAA TCATTTTCAGTGCACTTTTCCTT IV-2B24
99  B01 IV  F36H12.16   GGAAAAATGTAAATGTGTGGCAT ACTCAACACAACCAACATCTCCT IV-2D02
99  B02 IV  F36H12.17   TAAAACTATGTCTGGGCAAAGGA CAAATTGGAAAACATTCCAAAAA IV-2D04
99  B03 IV  ZK354.1 AACAGTGAATTTTTGAGAGCAGC GGATTGGATTTGATTGATTTTGA IV-2D06
99  B04 IV  ZK354.2 CGTTTTCTCTTTATTGTGATGCC GTCTTGTTGTTCTTCCCCTTCTT IV-2D08
99  B05 IV  ZK354.3 AAACCTCATTCTACGCACGG    CTCGAACTCTGGGAAAAACG    IV-2D10
99  B06 IV  ZK354.4 AAAATTGTGTTCCAAAGCAAAAA GAGCCTTGAAAAGCTTGGATATT IV-2D12
99  B07 IV  ZK354.5 AGCCTGTTGTTGTGTTGGAGTAT TTGATATATTCGCGTGATCTCCT IV-2D14
99  B09 IV  ZK354.7 CACCCGGACAGAGAGTATACAAC CTGAAGATGGCAGAGAAGAAAAA IV-2D18
99  B10 IV  ZK354.8 TCCTAAGCTTCTTTTGGGCA    ATTGCAACGAGTTTCTTGGG    IV-2D20
99  B11 IV  ZK354.9 TCGGAATATTGCGTTTTTACACT ATTTTTGTTTCCACGTTTCAATG IV-2D22
99  B12 IV  ZK354.11    AATTGAGCTTTCTATTGTGCCTG TTTTGTCATAATCTTCACTGCGA IV-2D24
99  C01 IV  Y4C6B.1 AAACACAACTTCTGGAATCGAAA ATCTTTTGAGACATCTTTGGCAG IV-2F02
99  C02 IV  Y4C6B.2 ATCAGGGCATAGTTCAAGTCAAA ATCCACTCATTGAAACAGGAAGA IV-2F04
99  C03 IV  Y4C6B.3 AGCATATTCTATGGGCAGTTTCA ATACGAATCTGAACGGAAGATGA IV-2F06
99  C04 IV  Y4C6B.4 CGATTATAACAAATGGAGCAAGC AACGTATACCTCGCATGAAGTGT IV-2F08
99  C05 IV  Y4C6B.5 TACAGGATGCTGGAACAACTTTT CATTCCATCAGACATCAACTTCA IV-2F10
99  C07 IV  F41H10.1    AGGCCGTTCATAATCTGTCG    ACGATAAGAGGCGTTTGGAA    IV-2F14
99  C08 IV  F41H10.2    CAACTTGAGGGAAACTGAAAATG TCCTGTTCCCATGAAAAGAGTTA IV-2F16
99  C09 IV  F41H10.3    AGCACTACGAAAGGACGGAA    TTTGTTCGCAATTGGTGGTA    IV-2F18
99  C10 IV  F41H10.4    TCCCAACACCAAAACTCTCC    CTTCCGCTGATTTCAGCTTC    IV-2F20
99  C11 IV  F41H10.5    CTTTAAACCGTGACCCCTCA    TTTTCGGTCAAAAATCCGTC    IV-2F22
99  C12 IV  F41H10.6    CCTCCTTCCAATACGACCAA    GCCATCACGAGGACATTTTT    IV-2F24
99  D01 IV  F41H10.7    ACGAGGAAATCCCTATCAATCAT CTGCCAAAATTTGTTAAATCTGC IV-2H02
99  D02 IV  F41H10.8    ATTGGACAAAAACCCACCAA    GGAGAGACGCAGAAAACGAG    IV-2H04
99  D03 IV  F41H10.9    GGTCTTGACACGAAAAATTTGAG CCATTTTCAAGATACTCCAGTGC IV-2H06
99  D04 IV  F41H10.10   CGTCTGGATAGGCGACATTT    CATCTACGACGAATCGCTCA    IV-2H08
99  D05 IV  Y4C6A.a GCAACTTCGATTTCTTCCATCTA TTGGAGTAGTGTTCAAAGGGAAA IV-2H10
99  D06 IV  Y4C6A.b TTACAATTGGAAAAGTTCTCGGA CTATGACTCTTGAAAACATCCGC IV-2H12
99  D07 IV  Y4C6A.c TGTACTCGATTGGGAGGTTCTTA ATGATGTAGACGTGCCTTGAAAT IV-2H14
99  D08 IV  Y4C6A.f TAATGCAAGTTTAACCATCCGAC TGAATTTCCCACCAAAGTTAATG IV-2H16
99  D09 IV  Y4C6A.g ACAGATTGGACACGAGATTTGAT GTCTCACGCTCACTCTCAATTTC IV-2H18
99  D10 IV  Y4C6A.h CATGGGGTATCAAACAATCAGTT AAACTCACCACAGGAGTATTGGA IV-2H20
99  D11 IV  Y4C6A.i CTTTAGGATCTCTTGCTCCAACA TATCAGCCTACAAAATTCTGGGA IV-2H22
99  D12 IV  Y4C6A.j CCACTTTTGTACTTGTTTCCGAG AATCGAAAGAATCAAATCATTGC IV-2H24
99  E01 IV  Y4C6A.k AACCAAACCAGTTAAGATGGGAT CCCATTGTAAACAAGTGGTCATT IV-2J02
99  E02 IV  Y4C6A.l TGTCGATAAGCAGTAGGTCCATT CACAAGCATCCAGTATCATTTCA IV-2J04
99  E04 IV  Y52D5A.b    AGAAATCTAAAGCACGCAGTCAC TTCGCTGAAAACTTTCAATTAGC IV-2J08
99  E05 IV  Y52D5A.c    TGCCATTCTTTCATTCTTTTCAT GAAAGCTTCTCAAGGTTCTCCTC IV-2J10
99  E06 IV  T11F8.1 ATAACTCACTCACGCGATTTCAT TAAAAATTGCCAAAAGTACACGG IV-2J12
99  E07 IV  T11F8.2 TCCGGGATATGTCCAATGTT    GCAGGTACCCAATCCTTCAA    IV-2J14
99  E08 IV  T11F8.3 ATCAGCTCTTGCCATCGACT    GAATGACTCCAGCGAATGGT    IV-2J16
99  E09 IV  T11F8.4 TTTTTCTTGGATGCAGGGAC    ACATTTTCAGTGCCGTTTCC    IV-2J18
99  E10 IV  B0273.1 ATTCGACTGTTTTTCCAAGTTGA CCCATTGGTGTATTTCTTCAATC IV-2J20
99  E11 IV  B0273.2 AGCCGTCTTCGAGAAGTTCA    AAAATTGCGTCGATTTTTGG    IV-2J22
99  F01 IV  B0273.4 GTAATGCAATTTCTTTGCCAATC TGAAGAATTCCTAACCAGGAACA IV-2L02
99  F02 IV  F35D6.1 TTCCTGATGGGAATCAGAGG    TATCTCCGATTTCGTGGAGC    IV-2L04
99  F03 IV  T12E12.1    GAAGACTACTACAACGAAGCGGA CTGTCATCTGCACATTTTGTCAT IV-2L06
99  F04 IV  T12E12.2    TTCCAAAGATGACAATATTCGCT GTGAATTTTGGCAAAGAAAACTG IV-2L08
99  F05 IV  T12E12.3    CGGCTCATAAGAGACTTGGC    GAACCGTTGAGTCGGATTGT    IV-2L10
99  F06 IV  T12E12.4    TAGTCGGTCGGGATTTTCTG    CTGGTACGAAAAGAGCTGGC    IV-2L12
99  F07 IV  T12E12.5    ACTTCTTCCAATTGAATCGACAA CAGAAAGAGAGTGCCATCTGAAT IV-2L14
99  F09 IV  F26D12.a    AAACTTCCCAGAACTTGGATCTC TAGGAAGGCATGATAAGTTTGGA IV-2L18
99  F10 IV  F26D12.b    CTTTTTCCCACACTTCTCTCTCA AAAGAGTCTATCATGGCAATCCA IV-2L20
99  F11 IV  C39H7.1 GCTCGAATAATTGTGAGTTCGAC GCAAGATGAAGTATCTGGTACGG IV-2L22
99  G01 IV  C39H7.4 ACACATGCAATTCCCCAAAT    TCATTTCGCCCATTCTCTTC    IV-2N02
99  G02 IV  C39H7.5 CAGACTTTTCAGCCAAAGACACT GAGTTTCAGCGTAGCTGGTAAGA IV-2N04
99  G03 IV  C39H7.6 ACGTATTTTCATGCTATCCGAGA AATTGTTCGAGAATTTGGCATTA IV-2N06
99  G04 IV  B0547.1 AATGTGCGATACGGAAGGTC    CAGAAAACAGGGGGACTTGA    IV-2N08
99  G05 IV  B0547.2 CAACCCAATGATTTCAGAACAAT ATTCTTTTGGGTCTTAAAGGCAG IV-2N10
99  G06 IV  B0547.3 AATGTCAAGAGCTGGATGATTGT ATCAACTTTCCCACTCTTTCCTC IV-2N12
99  G07 IV  B0547.4 AATAGTCGCTTATCGTATTGGCA TATTTTTCATTATGCGCGTTTTC IV-2N14
99  G08 IV  T19E7.1 CCTCAACTCAACCATGATTCTTC TGAAAACACTTGAGCAATTGAGA IV-2N16
99  G09 IV  T19E7.2 GGGTACCCACTTGCCCTATT    TCATTTCAGCCACTCACTGC    IV-2N18
99  G10 IV  T19E7.3 CAACTGCAAGAATCGACGAA    CCCATCTGATGCTCCAGTTT    IV-2N20
99  G11 IV  T19E7.4 TCCAGAAAAATGAAATCAAAACG AAGTCAATCTCCGTCTCTTTTCC IV-2N22
99  G12 IV  T19E7.5 TAATTCCTCCAGTGACACGTTTT GTTTCACCGTTACCATTGTTCAT IV-2N24
99  H01 IV  C55C3.1 AGAACACCCAATTTGCCAAG    GCGACTCATTCGGCTACTTC    IV-2P02
99  H02 IV  C55C3.2 GACAATGATAGCCAAGGGGA    ATTGTCAACAACGAAACGCA    IV-2P04
99  H03 IV  C55C3.3 CAATGAGAAAGGCAGAAGCC    TTACCGGTGGAGTAGCCAAC    IV-2P06
99  H04 IV  C55C3.4 TGGTACCTTCTTTTTCAGATCCA GCTTAATAAACCCGGTCAGTTCT IV-2P08
99  H05 IV  C55C3.5 TATTCTGAATCAGGGACGAAAAA TGCCAAAATGTTGCCTATTAGTT IV-2P10
99  H06 IV  H35B03.1    AATTACAGGAAACATCGTGGTTG CAGCCAGTTCAATTTGTGTATCA IV-2P12
99  H07 IV  H35B03.2    TCGATCTTTTGAACCGACATATT CAAGTTTGAACTCCCTCCTTTTT IV-2P14
99  H09 IV  C45E5.2 TGCCATTCACCACTCTGTTC    AAAGTTTTGTGTTGCAGGGG    IV-2P18
99  H10 IV  C45E5.3 AAGATGATTTCAATTGGCGG    GATTGTTGGCTGATGCAATG    IV-2P20
99  H11 IV  C45E5.4 AAAAATGAAAACTGGCAGATGAA CCAAGTGAAAAATCAAGTTCCTG IV-2P22
99  H12 IV  C45E5.6 TCTGAGCCCGAAGAGTTTGT    ATGTCATTGTTGCACGGTGT    IV-2P24
100 A01 IV  F44E8.1 TCTTCTCGCAACATGTCCAG    AGGTGACCGTGAGAATTTGG    IV-3A01
100 A02 IV  F44E8.2 AAGCTTCATGGTCTTTCTGGACT CTCCTTCCCAAAATCGTAGAAGT IV-3A03
100 A03 IV  C31H1.1 CTGGATATCGGGAAGGTTGA    GCCGAGTTTTGAAGAGCATC    IV-3A05
100 A04 IV  C31H1.2 AAACAAATCATTTCCGTTTTTCA TCATCATCCTGATACTCTTCCGT IV-3A07
100 A05 IV  C31H1.3 CCTCGAATATATAACATTGGCGA GTATTGAGCGAGAGACAAGGAGA IV-3A09
100 A06 IV  C31H1.5 TGTCACAGTGGTGTTTTTAGTGG ACCTCTCACCATTCTCAAACAAA IV-3A11
100 A07 IV  C31H1.6 CGAATGCTTATTTTTCATTACCG CAAATTTCAGTATGTGCGTTTCA IV-3A13
100 A08 IV  C31H1.7 ACCTATCATGTCTTGGAAGGGTT CATTTGAAAATTGTGCATCTGAA IV-3A15
100 A09 IV  C31H1.8 GGGGACTACACAAGATGCGT    GGAGAAACCGACGCTGATAA    IV-3A17
100 A10 IV  C10G6.1 TCATTTCCAGGGTCATCCAT    TTTCTCCATCAACTCCGACC    IV-3A19
100 A11 IV  C06E7.1 CGGAGATCAAGGAATTATGTTTG GCGGAAATACAGGTAAACAAGTG IV-3A21
100 A12 IV  C06E7.2 TCTTTCCAAACCCTTTTCTTTTC CGATCAGTTTCCACATAAACCAT IV-3A23
100 B01 IV  C06E7.3 GTGGGGGCTACTGATTTTGA    ATAGTGACGATGTCGGAGCC    IV-3C01
100 B02 IV  C06E7.4 AAACGCAATACTGCTTCGGT    TCACCAGCAACTTCAGCATC    IV-3C03
100 B04 IV  C06E7.6 AGAGGTAAAACGACAATGTTCCA GTAAACTTTCTGTTTCACGTGGG IV-3C07
100 B05 IV  C06E7.7 GAACTCACCAGCTTTTTACCAGA CTTGCTCAGGTAGTGCTTGTTTT IV-3C09
100 B06 IV  H04M03.1    CGAGAGGAATTTCAAAGAATGTG ACTACCTTGCGTGCAATGTTTAT IV-3C11
100 B07 IV  H04M03.2    GTCTCGGTGTAACGAGTTGAATC TACTGCTCGTGTGTCAAGAAAAA IV-3C13
100 B08 IV  H04M03.3    TGTAACATTGTAGATCACCAGCG CTTTTCTGAACAAATCAATTCCG IV-3C15
100 B09 IV  H04M03.4    CTTATTTTACAGCCACAAGACGG GTCCATCAAGTGTCTTCTTGACC IV-3C17
100 B10 IV  H04M03.5    CAAAGTTTACTTCCATGACCTGC ACAACGAAACGTACCACAGTTTT IV-3C19
100 B11 IV  H04M03.6    TTTAATCTGACCCATTTCTTCCC ATAACTTTTGCGGTTGTCACAGT IV-3C21
100 B12 IV  H04M03.7    CGTACCTGGGAATGATTTTGATA TTATCAACTGCCCAAAACAAACT IV-3C23
100 C01 IV  H04M03.8    ACATCTCTAATTGTACCCGCAGA TTTTCTTTGGGCCTTTTTATGTT IV-3E01
100 C03 IV  H04M03.10   ACTGACGATTCAATTTGTCCATT GTATCATGCCACGCTTTCTATTC IV-3E05
100 C04 IV  H04M03.11   CAGCAATAAGCCGATATGAAACT CAATCACAGTTTTGCAATCTGAA IV-3E07
100 C05 IV  H04M03.12   AAAATTCATTACCACACATTGGC AATCTTGCCGAAAATTAAATGGT IV-3E09
100 C08 IV  H32C10.3    AACTCCGTTCAAAGATTTCATCA GATGATCCATGTCCTTCATCAAT IV-3E15
100 C09 IV  K02B2.1 CAATGGAAGATATGGCCGAC    AATGGTAGGCACGTGGAGTC    IV-3E17
100 C10 IV  K02B2.2 CGAGTCATGAGATTCCATAAAGG CGATTTCTCACACGCTTCATATT IV-3E19
100 C11 IV  K02B2.3 ATAGGGATGAAATGGGGGAA    CGATTATGTCGCCGTGTATG    IV-3E21
100 C12 IV  K02B2.4 TTGGACTTGGCTTTTTGCTT    TCACAAAAGTTCGCATCTCG    IV-3E23
100 D01 IV  K02B2.5 CTCGAGCTGAAAAATTCTGAAAA CGATTTTATATGCAATCCCAAAA IV-3G01
100 D02 IV  K02B2.6 CGCTAGTTATTTGGTATCAACCG GATCCGATTGTGATATTCATGGT IV-3G03
100 D03 IV  B0350.1 TATTCTTGGTCAGCAAGGGG    CTGGTTCATCGAGTTGCTCA    IV-3G05
100 D04 IV  B0350.2 TATGCTCGATTACTGGTGGATCT GAACAATGTCGTCTCTTCCAATC IV-3G07
100 D05 IV  B0350.3 TTAATTGTTCCCATTGCAGAGTT TTGCATTGGAACCTTAGATGAGT IV-3G09
100 D06 IV  C46G7.1 ATTTTCCTGTTTTTAGCCCTCTG ACTGTAGGAAAAGGAAAAGACCG IV-3G11
100 D07 IV  C46G7.2 AAGTGCCCTGCTATCACAAGTTA GTTTGCTGATAAGATGGGTCTTG IV-3G13
100 D08 IV  C46G7.3 GTGTTTTTGGCTTCATCCGT    TGCTACTGCCGAACAAGATG    IV-3G15
100 D09 IV  C46G7.4 TTCATTGCAGAGATCACGTTAAA AGTTCCAACAACAAATTGGAGAA IV-3G17
100 D10 IV  K08B4.1 GGATGTGGAATGGAAATTGG    CTCTTCCATGCAACTCGACA    IV-3G19
100 D11 IV  K08B4.2 TTGTTTTCTCGAAGACACCTTGT TATGGCCACAGTTTCTTTCTTGT IV-3G21
100 D12 IV  K08B4.3 CTACCCCTCCGTGACGTTTA    TTCACCATTTCCCTTTCAGC    IV-3G23
100 E01 IV  K08B4.4 TTCGGATAGCCTCTCAGCAT    CTGCAAGTTACAATCCCGGT    IV-3I01
100 E02 IV  K08B4.5 TTTGCAAGCATTTTTGGTCA    AAGCACTTGCTGGAAAGCAT    IV-3I03
100 E03 IV  K08B4.6 TTTTCATCAGGTTTCACACCTCT CTCGCTCTTATCACTCACCAACT IV-3I05
100 E04 IV  M03D4.1 GGAAAATGATGGACAAGCTACTG TCTTTGAATTCTGAACGAACCAT IV-3I07
100 E05 IV  M03D4.3 GCTTTTCCATCATTTTGTTCTTG CAAGTCCTCTTGCTTGTTGTTCT IV-3I09
100 E06 IV  M03D4.4 TGCTGCTCCAAATCATGAAC    GATGATTCATTCCGGTGGAC    IV-3I11
100 E07 IV  M03D4.6 GAAAATACGCGGAGTTGGAA    AAAAAGACCGCTCACATGCT    IV-3I13
100 E09 IV  C11D2.1 ATGTGAGACAAAGCCCATTAAAA TGTTTCCGGAACTCTGAAAATTA IV-3I17
100 E10 IV  C11D2.2 AAACATGGTAAGCCTGAAGATCA TTTCTAAAGGAAATTTGTGGCAA IV-3I19
100 E11 IV  C11D2.3 AAATCCAGGGAAATCTACATGCT GTCGTCGTGCTCTTTATCAGACT IV-3I21
100 E12 IV  C11D2.4 TCGCAAACTGCAATAGATGC    AAGGAGGAGACGCAGAGACA    IV-3I23
100 F01 IV  C11D2.5 AAAAATCTGTTCATTCGGTGAAA CAAGAACAAAAACGAACAATTCC IV-3K01
100 F02 IV  C11D2.6 CAAAGTCTTCGAGAATCGGC    GAATGTCCTGCTCCAATGGT    IV-3K03
100 F03 IV  C49A9.1 CAGAACAGGCGTATCTGCAA    AATTATGCCAGTCTGCCACC    IV-3K05
100 F04 IV  C49A9.2 AAGGCTTCCCCGTATTCACT    ATTCGTCACTTCCAGACGCT    IV-3K07
100 F05 IV  C49A9.3 ACAACTCGGGCATTTCTTTG    TCCCCTCTTGCAATAGATCG    IV-3K09
100 F06 IV  C49A9.4 TGTTTGCACCGAAAATGAAA    GCGTTCAATCTTGACGGTTT    IV-3K11
100 F07 IV  C49A9.5 GAAATGAGCGGCAGAATGAT    TATTTGAGGCCGTTGGAATC    IV-3K13
100 F08 IV  C49A9.6 GCCGCGAGAAGAGACATTAC    TTGATTGATTCCCCCTTCAG    IV-3K15
100 F09 IV  C49A9.7 ATTTGAACCAACTCCGTTCG    AATGAACACAACCACTGCCA    IV-3K17
100 F10 IV  C49A9.8 GTTTCTTGCAGAAAAAGGCG    TGACAAGAAATGGGATGCAA    IV-3K19
100 F11 IV  F58F9.1 TTGACTTGATGAATCAGCCG    TTTGTAAATGCGGTGCACAT    IV-3K21
100 G01 IV  F58F9.3 TTATGTTTGATTGGAGGCATTCT GCACCTTATTGGGAAACATTACA IV-3M01
100 G02 IV  F58F9.4 CGTCGCATATCGAGGGTATT    ATGCACTGCGAAGACTTGTG    IV-3M03
100 G03 IV  F58F9.6 CGATAGGCCGTTTTGAATGT    AAGCGTGGCTCTTCCTGTAA    IV-3M05
100 G04 IV  F58F9.7 CGGGTTTTAATTCGGCTACA    CGGAATTATCGCAAAAGGAA    IV-3M07
100 G05 IV  T13A10.1    TTCCTCAAGGATAACAGCTTGAA TTGAATATTCGAGGTAAAACGGA IV-3M09
100 G06 IV  T13A10.2    GGTTACTCCAAACGCTACAACAC GTGCAAGTGAAGAGTGACAAGTG IV-3M11
100 G07 IV  T13A10.3    AGGCTTATATTAGAGACGACGCC CTTTTTCAGATTCGTCAACCATC IV-3M13
100 G08 IV  T13A10.4    GTAGAAATACGCAAAACGACTGG GCATTACACACACTCATGCATCT IV-3M15
100 G09 IV  T13A10.5    GAAGCGTCAAAAATGAAGGG    ACTGCTGCCTCGTTCTCATT    IV-3M17
100 G10 IV  T13A10.6    TGACAAAGTACCATTGGCGA    CGCTGTTCCCACGAAATAGT    IV-3M19
100 G11 IV  T13A10.7    TTTTTGCAGCGTGAAAGTTG    TTCGACCCGGAACTTATTTG    IV-3M21
100 G12 IV  T13A10.8    AAAGAAATGAGGGAGCAAAAATC TCTAGATCGTTCCAACGTGAAAT IV-3M23
100 H01 IV  T13A10.9    TCGTTTGGTTGTCATTGAGAATA TCGTTTTTGAAGGTGATTTTTGT IV-3O01
100 H03 IV  T13A10.11   TCAACGAGAGCTGGTCCTTT    GTTCTCGTCCGAAACGTCAT    IV-3O05
100 H04 IV  T13A10.12   TGGGATCACAGATACGTGGA    CCAATTCCGAGCGACTACAT    IV-3O07
100 H05 IV  T13A10.13   CGACGTTGTCACATTTCCAG    CTCGAAGTTCCCCTGTTTCA    IV-3O09
100 H06 IV  C01G5.2 GATTCGACGTTGAAGGGAAA    TACTGAGCTCGTTCTTGCGA    IV-3O11
100 H07 IV  C01G5.3 ATCTCGCTTCATCATTTCCG    CGACGTTGTTGTTTACGTGG    IV-3O13
100 H08 IV  C01G5.4 CTTCATCGCAATCTCAAGCA    ATCAGATTCGGATGGAGTCG    IV-3O15
100 H09 IV  C01G5.5 GGTCCTCGACGTATGGTGTT    CTGTCGACGAAGCACTCAAA    IV-3O17
100 H12 IV  C01G5.8 TTTTCCACGTTTCCAGTTCC    GTCGCTGATGACGATGAAGA    IV-3O23
101 A01 IV  C43G2.1 TCGAGCTGGAAGTGATGATG    TCCTGGGAAAAATCGTTCTG    IV-3A02
101 A02 IV  C43G2.2 TGCTCGTCAACAAAAAGACG    TTGCAGTGAACATTGCCCTA    IV-3A04
101 A03 IV  C43G2.3 TCAATCCAACGAATTCATTTTTC CGAATCATGTGCTTTTAGCTCTT IV-3A06
101 A05 IV  C43G2.5 TGAATTGACAGATGTGAATGGAG CCCAGAGACTCTACGTTCTGCTA IV-3A10
101 A06 IV  F38A5.1 CGTTTTCGGACGTAAAGCTC    CAACGCTTGAGACAATCGAA    IV-3A12
101 A07 IV  F38A5.2 CGGAAGGAAAAGAGCAGATG    CCAGTGGAGAAAACCTGGAA    IV-3A14
101 A08 IV  F38A5.3 TCTGAACCCATTTTCGAATAAAA CGTCCCTATCAATTTGTCATGTT IV-3A16
101 A09 IV  F38A5.5 ATCAAAGGGAGGTCGTAAAGAAG TCAAAATGTTTATTCGGTGGTTC IV-3A18
101 A10 IV  F38A5.6 GCTGGATTTGTCAACCGACT    TCGGAGGTCTCAATGCTTCT    IV-3A20
101 A11 IV  F38A5.7 GTAATTTTGCATGAATCGTCCTC ATAAACTCCACTCATCCTGCGTA IV-3A22
101 A12 IV  F38A5.8 TTTTACATTTGCGTAAAGAGCGT TGTTCTAAAAGCCGAAATGTTGT IV-3A24
101 B01 IV  F38A5.9 ACAACATTTCGGCTTTTAGAACA GAAACACATTTCATTTGGACCAT IV-3C02
101 B02 IV  F38A5.10    GCATGCTGCTTTTTGAACTCTAT TATTTGCTACTGGATGGTCGATT IV-3C04
101 B03 IV  F38A5.11    CTGCCAGAGTTGAATCTCTCATT AAAACATAATGGCAACATGGAAC IV-3C06
101 B04 IV  F38A5.12    GTTCCATGTTGCCATTATGTTTT CGCACTTTGTGCAACATTTAATA IV-3C08
101 B05 IV  F38A5.13    TGCTTAGCTTCGGCTTCTTC    CAGCTCGAAGCAGAGCTTTT    IV-3C10
101 B06 IV  F15B10.1    AGACAAGAGCCATCTGCCAT    GTGAGCGAATCAACACGAGA    IV-3C12
101 B07 IV  F15B10.2    GCCGATTCTCGAACAATCAT    AATTGTCGTATTTCGGTCGG    IV-3C14
101 B08 IV  F15B10.3    GCAGTGAAACGAGAATTGAAAGT GTCATAGATTGCCCTTTCTTCCT IV-3C16
101 B09 IV  C01B10.1    GTTCAACGAAGAGGACGAGC    TGCAATTGCGGAATGTCTTA    IV-3C18
101 B10 IV  C01B10.3    GTTCAAGGTCTTCACTCGGC    CAAGCAAATGGAAGCATGAA    IV-3C20
101 B11 IV  C01B10.4    CTGTAACAACAAAACCCCCG    TTCAAATGCATGAACTCCCA    IV-3C22
101 B12 IV  C01B10.5    ATTCTCCTTCCGTTTCTGGATAG CAAACAAACACACACCTTTTCAA IV-3C24
101 C01 IV  C01B10.6    TGTTCCACTAAATTCGCACTTTT CCGTTCAACTAGACCAACAAATC IV-3E02
101 C02 IV  C01B10.7    TTGAAATCTCTTCACTTTGGACC AAACAACTTTGCAGGAAAAACAA IV-3E04
101 C03 IV  C01B10.8    CATTGATATCCGAACGTCCC    GCTCTTCTTCCACCATCAGC    IV-3E06
101 C04 IV  C01B10.9    CCATGCTCTTTCACTGCTGA    CATTACCAAAGAGCCACCGT    IV-3E08
101 C05 IV  C01B10.10   GTCCAATTCAACATGGACCC    ATTTTGGCGGTCTGAAAATG    IV-3E10
101 C06 IV  Y73B6A.a    CGTTGTAGATCGTTTCTTTTTGC CCTCCAAAACTTAAAAATCCCAC IV-3E12
101 C07 IV  Y73B6A.b    TGAGAATCTTGAAAAGCCTCTTG TTCATTCAATTGTTGCGATCATA IV-3E14
101 C08 IV  Y73B6A.c    GAGAGTACAAATCATCCACTCGG GAAAAAGACGCCTATTCCCTTTA IV-3E16
101 C10 IV  Y73B6A.e    GAACAGAAGATGTGACGCTCTCT ACCAAAAGAACCGATTTAACCAT IV-3E20
101 C11 IV  Y73B6A.f    AAATTGAAGTGGAGTGGGAAAAT GTTTCTCAAATGATGACTCGGAC IV-3E22
101 C12 IV  Y73B6A.g    TTCATTTTTCAAACCATCAAACC TTTTCAAACCAAAAGTTTCAGGA IV-3E24
101 D01 IV  Y73B6A.h    ATGTACTTCGCTGTGTTCTCCAT GGTACCCCTAACGTTTCCATAAG IV-3G02
101 D02 IV  H34C03.1    TCAATTTTCTGAATTCGCCC    TTCAGTGTCTGCCAAAATGC    IV-3G04
101 D03 IV  H34C03.2    CTTTGCATGGACAGCTCAAA    GTGATTCGGATTGGCAACTT    IV-3G06
101 D04 IV  C17H12.1    CACCACCTCCTGGTTCTCAT    CAGATTCACATCCAGCGAGA    IV-3G08
101 D05 IV  C17H12.2    TGGGGCTACTTTGGAATCTG    CATTCGCTCCAAACGATTTT    IV-3G10
101 D06 IV  C17H12.3    TGCCATAAAACGTGCAAAAA    GATCACGAAGCGACTTCACA    IV-3G12
101 D07 IV  C17H12.4    TTTCGTAGACTTTTCCCAATTCA AAGATCAAAGTATTGCTCCCACA IV-3G14
101 D08 IV  C17H12.5    AAATGAACCAAGCCGACAAC    GCGAACCATGTTTTTGGAAT    IV-3G16
101 D09 IV  C17H12.6    TCCACAGTTTGTTACTTCCACCT GTTCACCTTTACGTGATCTTTGC IV-3G18
101 D10 IV  C17H12.8    TCGGCGGTTTTTAATTTGAC    ACCGCCAATGATTTATGCTC    IV-3G20
101 D11 IV  C17H12.9    ATGGACGTTTTGTTTCTCGG    TTATGCGACGCTCACAAATC    IV-3G22
101 D12 IV  C17H12.10   ATTTAGCTTCCCGTCGATACTTC ATTTATTCTGCCCCAAACGTAAT IV-3G24
101 E01 IV  C17H12.11   ACATTTGGTCCCCACTTTTAGTT GATGGGAACATGTCTCTAATTGC IV-3I02
101 E02 IV  C17H12.12   GGCGGAATGTCCAGTTATGT    CGATTTGCATCAAAGCTTCA    IV-3I04
101 E03 IV  C17H12.13   GATTCGAGTGAAAGTGGTTTTTG AATAATGTGAAATTGGGACAACG IV-3I06
101 E04 IV  C17H12.14   TTTACAGGGAAAACCACTAACGA CTACTTGACGGAAAGAAGGGAAT IV-3I08
101 E05 IV  H20E11.1    AGTCTAAAAGCCATTTTTCCCTG TCATTTGCTGCATTCACATAAAC IV-3I10
101 E06 IV  H20E11.2    GATTGCTCACAAATTCCAGATTC AAGCATTCTGTTCCAACAACAGT IV-3I12
101 E08 IV  C05B10.1    CAACTCACCTACCGAGCACA    TTTTGAACCCATTCGTAGGC    IV-3I16
101 E09 IV  C05B10.2    ACAGTACAAGAATTAAACGGCGA TCACGTGTTTTCAAATCATTCAC IV-3I18
101 E10 IV  R13H7.1 AACTTTCAGCAAAACGACCG    ATGCCCAAAAACTTGCATTC    IV-3I20
101 E11 IV  R13H7.2 ACTTCCCGCAGCTAACTGAA    GCAAACATTCTTCTCTCGGC    IV-3I22
101 E12 IV  T05A12.1    TGATCACCGTTGTGGTGAGT    GAAAGCCCACAAATTTGCAT    IV-3I24
101 F01 IV  T05A12.2    TGAACTGATCCATCGGACAA    TCCACGTCCGGAATCTTATC    IV-3K02
101 F02 IV  T05A12.3    GTGCATTACGTGAGCTTCCA    GGTGGAAACAACGAGCATTT    IV-3K04
101 F03 IV  T05A12.4    AATTGTGAACAGCGTCGTCA    GCAAGGTTGCAGGTATCCAT    IV-3K06
101 F04 IV  T22D1.1 ACCGTATTTTGAGCCAAACG    ATTGGAAGATTTCAATGCGG    IV-3K08
101 F05 IV  T22D1.2 GAAATGGTTAGCTCACCGGA    GCCGAAGGCACAACAGTATT    IV-3K10
101 F06 IV  T22D1.3 GCTCCAGAACTTTCACAGAAGAA GATTCCATTGTCGACTTTCTCAC IV-3K12
101 F07 IV  T22D1.4 ATTTCTGCTGGAATCGATGG    TGTGGTCTGGCACAATGTTT    IV-3K14
101 F09 IV  T22D1.6 AGTTTCGTCAGTCTTGACCAGAG GAGCTCTCAATTTATCGAAGCAA IV-3K18
101 F10 IV  T22D1.7 TGGTTCTGCTGAAGATGTGG    GGCAACAATTGAAACGAGGT    IV-3K20
101 F12 IV  T22D1.9 ATGGATCAGGAAGTGAACGG    CTTCTTTCATGTGCCCCATT    IV-3K24
101 G01 IV  T22D1.10    GTTCCACGCACTTTTTCGAT    ATTTTCCAGGTTGAACGCAC    IV-3M02
101 G02 IV  T22D1.11    TTTCTCCGGTCGTTTCATTC    GATTCACAATTTCGGAGGGA    IV-3M04
101 G05 IV  B0478.2 AAGTAGGTTGTGCGGGACAC    CGAATCCAAACCTCCACTGT    IV-3M10
101 G06 IV  B0478.3 TTATGACTTTGGCAACTTCAACC AGTTGGACTCATCGGTCAAATAA IV-3M12
101 G07 IV  ZK381.1 TCCCGTTGATCTAGAGATTGAAA ACAAGAGAAGACAAAAGCACGAC IV-3M14
101 G08 IV  ZK381.2 GGTTCTTGGATACAATTCGACAG ACAAATCCCTTGAATCATTCCTT IV-3M16
101 G09 IV  ZK381.3 ATTTGGTGAGATGCTTGTTGTTT TATTTCTCAACCTGGGTTCTTGA IV-3M18
101 G10 IV  ZK381.4 TGTTGTGAACCGTCGTCATT    TGTTGAGCTCACGGAACTTG    IV-3M20
101 G11 IV  ZK381.5 TGGAAGACTTTGCAGGAACC    CGTAAATTTGTGACCCCACC    IV-3M22
101 G12 IV  ZK381.6 ATGTATCGGAAACTCAAAGCAAA GTTGTTAATGCATTTCTTTTCGC IV-3M24
101 H01 IV  ZK381.7 TTCTCAAATTTCCGTCATTGTTT CCAAGTCAACCTCAACTTTATCG IV-3O02
101 H02 IV  C25A8.1 GGTTGTATTTGGTCCGTCATAAA AACAAAATTTCGTCGAACACAGT IV-3O04
101 H03 IV  C25A8.2 AGAAGTGAATGGTAGAGGGAAGC ATCACACGATTTCAGTGACTCCT IV-3O06
101 H04 IV  C25A8.4 CTCTTCGTGCCACTTCATCA    AAGGCAGGTGCGAAAACTTA    IV-3O08
101 H05 IV  C25A8.5 TGAGAAGTCGCATTTTCACG    CACATAACCGATCCGGAAGT    IV-3O10
101 H06 IV  C06G3.1 TCACCCATTTCAAGTCCTCC    ACCACAACCAATCTTTTCCG    IV-3O12
101 H07 IV  C06G3.2 TCCAACTTTCAAATGCCACA    TTCGATATGGAAGAAAGCGG    IV-3O14
101 H08 IV  C06G3.3 CTTTGGAAAATATTCAGCCTGTG TTATTCTTTAAGGCTCTCCGAGG IV-3O16
101 H09 IV  C06G3.4 CTTGATTTCGATTCGTTCAAAAC GCTTTCAGTCAATAATTGTTCCG IV-3O18
101 H10 IV  C06G3.5 ACCACTGGCTGGAGCTAAGA    CAGGAAGGAAACAAGAACGG    IV-3O20
101 H11 IV  C06G3.6 GGGTCGGACTGTGAATGAAT    GGTTCAAAACGATCCGAAAA    IV-3O22
102 A01 IV  C06G3.8 TGCTAGTGCTGGAGTTGTTTGTA CAGCAAAGTTTAATCCTCGAAAA IV-3B01
102 A02 IV  C06G3.9 TTGTCAATTGAACGCAGAGC    AAGACTTCGCGCTTGATTGT    IV-3B03
102 A03 IV  C06G3.10    CCCAAGTTTCACGCATTTTT    GAAAGGGAGCGCACTTACAC    IV-3B05
102 A05 IV  C06G3.12    ACTTTGTTCACCATCGTTGAGTT TTGTACGCCTATCGACTGAAAAT IV-3B09
102 A06 IV  ZC477.1 TACTTTGGTGTCGGAGGAGG    GCACCCCGAATGACAACTAT    IV-3B11
102 A07 IV  ZC477.2 GCAATTCGAGCCATTTGAGT    TCTGCTTTTGACTGCTGTGG    IV-3B13
102 A08 IV  ZC477.3 AAGATGGATGGAAGCAGGTG    GGCTTTTGCAATTCCGTCTA    IV-3B15
102 A09 IV  ZC477.4 GTGCATGTGAAACTCATTCAAAA GTGTAAAACTGCCAACAACTTCC IV-3B17
102 A10 IV  ZC477.5 TGGTTTCTTCAAAATCTCCTCAA CGACTCACGGAAAGACTAAAATG IV-3B19
102 A11 IV  ZC477.7 CATCCTTTACTGCATGTTTTCGT CTTCTCATCTTCATCGCTTCCTA IV-3B21
102 A12 IV  ZC477.8 TACTTTGGTGTCGGAGGAGG    GCACCCCGAATGACAACTAT    IV-3B23
102 B01 IV  C34D4.1 CTGCTGCTAGACGAAATTCAGAT TGTCTTCTTCTTGCTCCAGTTTC IV-3D01
102 B02 IV  C34D4.2 CATGGGCAGTACGAGGATTT    TCCGCAGAGTGAAATCACAG    IV-3D03
102 B04 IV  C34D4.4 TCCCTCCTATCGACCAACTG    AGAGGGGAGATTGCACACAC    IV-3D07
102 B05 IV  C34D4.5 GGAGGGGACACTGTAGTGGA    GCAGATTTTTGTCCAACGGT    IV-3D09
102 B06 IV  C34D4.6 ATAGACATCAGCTCTCAGTTCGC CCCGTTTTTATAGTGGGGTTAAG IV-3D11
102 B07 IV  C34D4.7 ACCAAACTCCTTCTCGCTCA    TGGGCAACCTTCTCTTGTCT    IV-3D13
102 B08 IV  C34D4.8 AATTTTCGGAACATACAAGCAAA GTTCTTCCGGTTCTTTTAGGAAA IV-3D15
102 B10 IV  C34D4.10    CTCAGCTCTTCACTTCCGCT    CGCCCTTCTTGATTCTTCTG    IV-3D19
102 B11 IV  C34D4.11    AACAACATTTGGCACTGAAAACT TCATCGTTTCTGGGTCTACAACT IV-3D21
102 B12 IV  C34D4.12    GAATTTCAATTTTTGGACGATCA TCCAAGTTTCTGTTTCCATTTGT IV-3D23
102 C02 IV  C34D4.14    AGGCGATGTGAGCACTTTTT    CTTCGCTTTTGATTGGGAAA    IV-3F03
102 C03 IV  C34D4.15    CAACCACTTCCATTTTCGGT    GTTTCGAGCAATGGCTGATT    IV-3F05
102 C04 IV  C42D4.1 CGTAGCTTCATTGCTTGCTG    TGAACTCACTCTGCTGGTGG    IV-3F07
102 C05 IV  C42D4.2 ATGGGAAAAGCTTTGGGATT    CAAGTAGGGAATGGCTTGGA    IV-3F09
102 C06 IV  C42D4.3 TTCTTGTTTGGCAGCACTTG    TGCACAACTGATTGGCAGAT    IV-3F11
102 C08 IV  C42D4.5 CGAGCTTCTCAAATCCTTCG    TGCCCTTCTGCTCCTTTTTA    IV-3F15
102 C10 IV  C42D4.8 CTCCGGATCGAACCATTAGA    TGTTTAGCCAAGCGGGATAG    IV-3F19
102 C11 IV  C42D4.9 CAATTGCAGGATACAATGCG    CGAACATTCCGTTTTCCATT    IV-3F21
102 C12 IV  C42D4.10    CTTTTGATAAATGATTCCACCCA TCGATATTTTTCTCCTTCTGTGC IV-3F23
102 D01 IV  C42D4.11    AGCCAGCTTCTTTTCCACAA    TTTGCACAGAAGGAGACGTG    IV-3H01
102 D02 IV  C42D4.12    CTCGGTTGCAGTCATCTGAA    CAATTATCCCACAACCCCTG    IV-3H03
102 D03 IV  C42D4.13    CGATAAAACATCACGGTCAATTT GCAAAGTTTATTTGCAAAACAGG IV-3H05
102 D04 IV  R13A1.1 TGCATATGTATTCCATGTTTCCA TACATTACTCATTTCGCTCGTCA IV-3H07
102 D05 IV  R13A1.2 ATGTATCTCCGTTCCGTTGC    CCATTGCATTGAGAGAAGCA    IV-3H09
102 D07 IV  R13A1.4 AATCCCTTTGGTTTGATTTTTGT GGAGGAGAGATGCTCACTGTAGA IV-3H13
102 D08 IV  R13A1.5 CAAGCAGTTTGTGAGAAGATGTG AGGATTCAAATGCTTGATTGAAA IV-3H15
102 D09 IV  R13A1.7 CTTCATAAATCACATGAGGGAGC AAAGAGCCAAATTGTGATTTCCT IV-3H17
102 D10 IV  R13A1.8 ACTTCTATCATTCACCATCCCCT GCCAAACACTTGCATTTATTTTT IV-3H19
102 D11 IV  D2024.1 GGACGAGAACCAAAATTCCA    TCATCCGTTGTTTCCTTTCC    IV-3H21
102 E01 IV  D2024.3 TCCGTTTCAGAAGCCTCCTA    GGGTAACGGGTTTTCCATTT    IV-3J01
102 E02 IV  D2024.4 AAACGTTCCCTGCAAATCAG    CAAGTTTGGAAGCTTCTCGG    IV-3J03
102 E03 IV  D2024.5 GATTCATTATACCTTAACCGCCC TGAGGTTCTCAATGCGACTTTAT IV-3J05
102 E04 IV  D2024.6 AGTAACTGGCAATTGGCGAC    GCATTGCTTCGGATTTCATT    IV-3J07
102 E06 IV  D2024.8 AAACTCCTCCGTCGATAGCA    GTATGTGTGTCGATGCCTGC    IV-3J11
102 E07 IV  D2024.9 ATTTGATACAAATTTGGTCACGG GAGAGATGAAAAATTCGGGAGAT IV-3J13
102 E08 IV  C06E4.1 ACTTTATGCATTCCTCGGGTTAT TCTTCGTGGGATTATTTTGAGAA IV-3J15
102 E09 IV  C06E4.2 TCTTCTTCAACAGTTTGGAAAGC TGCATAAAGTGGGAAAGAGAGAA IV-3J17
102 E10 IV  C06E4.3 ATGACTGGACGCTTTTCTGG    TATTTTTGGGGCAACTGAGC    IV-3J19
102 E11 IV  C06E4.4 GTTGTCTGCGTCTCACTTTCTTT TTGTCCAACGATGTATTCAGATG IV-3J21
102 E12 IV  C06E4.5 AGTCAAAGAGAACCAGCGGA    GCAAGAAATCACACGAGCAA    IV-3J23
102 F01 IV  C06E4.6 ACTCGGAGACCTTTCGATCA    GTCGAGGCGAAAATACCAAA    IV-3L01
102 F02 IV  C06E4.7 TTAGTTGATAAAAACCCGCTCAA CCATTTTTAATCGTCTGAATTGC IV-3L03
102 F03 IV  C06E4.8 GGAATTTGAACGATGTTGGG    GATCGAAATCGCCATGTTTT    IV-3L05
102 F04 IV  F42C5.1 GAAGAGATGCGAGCTGAAAAATA TTAAGATTTGCACTGGAACAGGT IV-3L07
102 F05 IV  F42C5.2 TATTTGCTCTCGCATGTTCG    TCGATGATGTATTGACCGGA    IV-3L09
102 F06 IV  F42C5.3 TGATGAATTGGTTCAACGGA    TTTGAGAAGTCAAGCTGCCA    IV-3L11
102 F07 IV  F42C5.4 AAATAAAAACTCGACCGCTTACC GAAAACCCAACGATGATAATTGA IV-3L13
102 F09 IV  F42C5.6 GAAGAACGAGACAGATTGGAAGA CTACCACAGTACCCCAACAACAT IV-3L17
102 F10 IV  F42C5.7 TGAAAGCGTAGCAAGTGACG    AGGAGGGAGAAGCTGTGTGA    IV-3L19
102 F11 IV  F42C5.8 GCGAAGGTAGAAATCAAGTTCCT AGAGCACGAAAATCATGTGAAAT IV-3L21
102 F12 IV  F42C5.9 GTGCAAGGAACTTTGGAAGC    TTTTCGTTGGAGAAGACGCT    IV-3L23
102 G01 IV  F42C5.10    ATGCACATGCTGGTGATGAT    TGAGTTGATCTACCGCAACG    IV-3N01
102 G02 IV  Y40C5A.a    TTTAACTACGATTGCCTCCAAAA TGAGTTCCGATTTCCAATTCTTA IV-3N03
102 G03 IV  Y40C5A.b    GCATACCTCAAGTTTTGGAGTTG TGTCTCATATCACCTTATCGGCT IV-3N05
102 G04 IV  Y40C5A.c    TACCATCATATCCATCTGGGAAG AGTTGGAAGAAGAGATTTTTCGG IV-3N07
102 G05 IV  Y40C5A.d    AAAGAACCAGATGAACCAGATGA ATCTCCAAATGCTGTGAAGACAT IV-3N09
102 G06 IV  Y40C5A.e    AGAAGCCAACTACAATGACCAAA ATTTCCGGTTATGAGGCATAAGT IV-3N11
102 G07 IV  Y40C5A.f    TAACCCTCCTTGTTGACTGAAAA TTGATATCTCGGCTGAAATTGAT IV-3N13
102 G08 IV  Y40C5A.g    GACGAGTTTGTTGTGATTGATGA CTTACTCCTTCGGAATTGCCTAT IV-3N15
102 G09 IV  Y40C5A.h    GTTGAGTCTGCTTTGGTTGTGAT TCAATGATAATGTCGGATCTCCT IV-3N17
102 G11 IV  T12B3.2 TGGAAGTAATTCTCCCTCAACAA AATAAATTTTCTACGGGGTTGGA IV-3N21
102 G12 IV  T12B3.3 ACTACGGATATGAAGGGACCAAT CTAGATTTGTGCATTGGCATGTA IV-3N23
102 H02 IV  C48A7.1 GATATCCTCGTCGTTGCAGTATC AAAAGTGTTCGAATTCCTTCTCC IV-3P03
102 H03 IV  C48A7.2 TTGCTCTTATCTTTGCGTTCTTC CGAAACTATATCTTGGGGATGTG IV-3P05
102 H04 IV  B0496.1 TCGTTGGAAATTCTTGGCTC    TTTGTGCGGGACTCTTCTCT    IV-3P07
102 H05 IV  B0496.2 CGAAAGTCATCCGTTGGAGT    TGTGCGGGACTCTTCTTTTT    IV-3P09
102 H06 IV  B0496.3 CTCCATCATTCGTTCCAGTTAAG ACCTCTATCAAATGCATCAAGGA IV-3P11
102 H07 IV  B0496.4 TTGTTATTGCCTCTTCAAATGCT AAATTAAGGTGGAAATCATCGGT IV-3P13
102 H08 IV  B0496.5 TTTTCCAGGCAATATCTCCG    TGCAGATGCAGGATAAATGC    IV-3P15
102 H09 IV  B0496.6 TCATTGCACCCACACTTTGT    TAATCCCGACTTTTCTCCCC    IV-3P17
102 H10 IV  B0496.7 TTGCTAGGCCAGATAATTGACAT CAGCTGTTTCATTCAAAATTTCC IV-3P19
102 H11 IV  B0496.8 ATGCCATGATTTCTCTTCGG    TGGATGAGCATGATGTCGTT    IV-3P21
102 H12 IV  F13B6.1 TTTTGCTCTTGCATTTGCTG    AATGCTGGAAGTTTTGGTGG    IV-3P23
103 A01 IV  F13B6.2 AGTGGATTTGCCTGTTCACC    CGGGTTTCATCACGAAAGAT    IV-3B02
103 A02 IV  F13B6.3 GGCTTTGACGACTGAAGGAG    CCGGACGATGATAACGAACT    IV-3B04
103 A04 IV  F55G1.2 CAGCCGTTAGTTTCACTTTTCTC TGGGTAGAGGTCACTAGGATCAA IV-3B08
103 A05 IV  F55G1.3 CCCCTGTTATCTCTAGCCTCATT ACAATCACCATCATTATTCCGAC IV-3B10
103 A07 IV  F55G1.5 TTTGAATGGAGGAATTTCGG    ATGACTGGCCAGAAATGAGC    IV-3B14
103 A08 IV  F55G1.6 TGCTAGTGAAGTTGGATGCG    TCGATTGGTGTTGATGAGGA    IV-3B16
103 A09 IV  F55G1.7 CGCGGGTTGTAAAATTGACT    GTTCCGAGTCGATTCATGGT    IV-3B18
103 A10 IV  F55G1.8 ATCTGGAGGAAGCAAGTGGA    CCTCCCGTTCATCAACAACT    IV-3B20
103 A12 IV  F55G1.10    CGACCTGAAGTTTGAAAGAAAAG AATGAGGCTAGAGATAACAGGGG IV-3B24
103 B02 IV  F55G1.12    ATCCATAGCAGGTGTTTCACTGT TGAAACAGCAGGAGTTATGGTTT IV-3D04
103 B03 IV  F55G1.13    ACATGTTCCGCCGTAGAGAC    ACGAGTTGTTCACCGAATCC    IV-3D06
103 B05 IV  F55G1.15    CAGCTCTCTCCTCTGCACCT    CCAGCATTATCATTCCCCAC    IV-3D10
103 B06 IV  R05G6.1 AGAAGCATCTGACAGCAAGTACC TTCTCTGACCAAAATGAACGATT IV-3D12
103 B07 IV  R05G6.2 GTCCCCTTTCAGAAAAGATTCAT ACCTGTCTCATTTTCATCTCCAA IV-3D14
103 B08 IV  R05G6.3 TGTTTTTGTAGATAAAAGGCCGA AAAATATTCAGATGGCAAGACGA IV-3D16
103 B09 IV  R05G6.4 AACTCAACGGCTGCTTCTGT    GGAATATCCGGTTCCTCCTC    IV-3D18
103 B10 IV  R05G6.5 TTTCAAAATTGAATGATGCACTG TGTAGATAATCTGCGAGCCATTT IV-3D20
103 B11 IV  R05G6.6 TCACGCCTGTAAACATGCTC    TCGACAACTATTCTGGCACG    IV-3D22
103 B12 IV  R05G6.7 GGAGAATGGAAGTGATCGGA    TCCTCAAGATCGACTCCACC    IV-3D24
103 C01 IV  R05G6.8 CTTCCTCCATTGCAATTCGT    TGCGTTTGAAACATCACCAT    IV-3F02
103 C03 IV  R05G6.10    TGCTGCAAATGCAGATAACC    GTTCCACCCTCTCTTGGACA    IV-3F06
103 C04 IV  F49E8.1 TCTTCGCTGCAAAGTTCTCA    TTTCCGGTTTCTTCCAACAG    IV-3F08
103 C05 IV  F49E8.2 CAAAAACGGTTGGTCCAGTT    CATGGTGATTTCGACACAGG    IV-3F10
103 C06 IV  F49E8.3 AGTTGGCACCTCCGTATTTG    GTGCTGAAGGTCTCCCAGAG    IV-3F12
103 C07 IV  F49E8.4 GAAATGTGGAAAGGAGTTTCTGA TAGTTGCAAAGTTCCCATTTTGT IV-3F14
103 C08 IV  F49E8.5 AAATGCCCAAAACATGGAAA    TGTACCGTAATCGTCGGACA    IV-3F16
103 C09 IV  F49E8.6 AACAGCCAATGAACACAGAGATT GATCTTGATTCATTTCTCACGCT IV-3F18
103 C10 IV  F49E8.7 TCGTCTCCAAGACACACTGG    CACCACACAAACTCAATGGG    IV-3F20
103 C11 IV  F32E10.1    GGATGTTGGCTGACTCCATT    CCGATTCCACTTCAACAGGT    IV-3F22
103 C12 IV  F32E10.2    GGAGAACACGGTACTCCGAA    CGCGGAAAAATTGAAAATGT    IV-3F24
103 D01 IV  F32E10.3    CATAAATTTGCTCGTCCGGT    AATGGCTTTGGTGGAGACAG    IV-3H02
103 D02 IV  F32E10.4    AAGACCTCCGCACTCTTCAA    GACTTGATTGGCAGTGGGAT    IV-3H04
103 D03 IV  F32E10.5    CGAGATCCAGTTGGCAAGAT    AAAACAGCTGGAGCGAGAAA    IV-3H06
103 D04 IV  F32E10.6    GGAACGTTACAGAATGGGGA    CCTTTCAAATGGCAGGAAAA    IV-3H08
103 D05 IV  F32E10.7    AAGCCAATTTTTCAGATGCG    GGCTCGTCTACAGTCGGAAG    IV-3H10
103 D06 IV  T23A7.b ACCATATCGCTAGGATCACTGAA TTGTTCGAATGATGATTGTTCTG IV-3H12
103 D07 IV  F45E4.1 TGATTGTCGACATAGCTTCAAGA GCAATCCTTATGTCTTCATCTGC IV-3H14
103 D09 IV  F45E4.3 TCCAACATCAGTAGCATCACATC AGATTGTTGAAGACCAGATTGGA IV-3H18
103 D10 IV  F45E4.4 TCAACGAATTCTCGGGTTTC    GAGTAGCTGTCGAAGCTGGG    IV-3H20
103 D11 IV  F45E4.5 AAACACAAATCAAAGTTGGCAGT ACGTTGACATTCAAATAAATGGG IV-3H22
103 D12 IV  F45E4.6 CGTTGCAGGAAATCCGTAAT    AATACTGGGCACTTGGTTGG    IV-3H24
103 E02 IV  F45E4.8 CCATTTTGAAAGTTTTTGACTCG AAAATGCAAGTCACTCTTCTTGC IV-3J04
103 E03 IV  F45E4.9 TATTCATCTTTCAGCTTCTTCGC AAATGATGGCATTGGCTATTTTA IV-3J06
103 E04 IV  F45E4.10    GCGAAAATGGATCGACAAAT    TTCGCGTACATAACAACCGA    IV-3J08
103 E05 IV  F45E4.11    ATTCTGGTTCGCGGTGTTAG    TTACGGGAAGAGCAGCAACT    IV-3J10
103 E06 IV  C08G9.2 TCTCGTGTAGATGACGCTGG    GAACGGATGTGGACGAGAAT    IV-3J12
103 E07 IV  F33D4.1 AATGCCATCGCAATATCCTC    GCCCTTGACTTTTGTGCAAT    IV-3J14
103 E08 IV  F33D4.2 CTTAAAGTTTTCTTCCGGCATTT TGCACATTTCAATTCAGTGTTTC IV-3J16
103 E09 IV  F33D4.3 CGTCGAAGAAGAAGATGAAGAAA TAGGAGGTCAGTTGCAAAATCAT IV-3J18
103 E10 IV  F33D4.4 CAAAACGTCGTCGAAACTCA    ATTCACATTTCGCGCTTCTT    IV-3J20
103 E11 IV  F33D4.5 TTTTGAACGTTTTCGCACAA    GGCGTAAAAGAGCGTTGAAG    IV-3J22
103 E12 IV  F33D4.6 CGACGAACCACTTGTTTAATCTC ATTCAATTGACATTCGAGCACTT IV-3J24
103 F01 IV  C50F7.1 TTTGGGGTCAATTTTTCTGC    CAGTTGATTTGAAGCCACGA    IV-3L02
103 F02 IV  C50F7.2 TTGGTACTCGTTGCTCATGC    CTCTCCAGATGGAGCTGGTC    IV-3L04
103 F04 IV  C50F7.4 CAAAGGGAATCGGAGGTGTA    TTCCTTCCAAACGAACAACC    IV-3L08
103 F06 IV  C50F7.6 AACTTTTGTGAGGGCACACC    TCCAGTCACAACCATCTCCA    IV-3L12
103 F07 IV  C50F7.9 TCACACATTTTTGGCAAGGA    TGATCAGTTTTTCGGAAGGG    IV-3L14
103 F08 IV  C50F7.10    CAGGAGAATCTGAAGCAGGTAGA GTCTTGTTCGGTTATGTCTTTGC IV-3L16
103 F09 IV  C46A5.1 AAACAAACCGTAGCCACGTC    TGTTCGCCTGCCTTATTACC    IV-3L18
103 F10 IV  C46A5.2 CGCGGTGAGAGAACACAGTA    CATTCCATCTGCATCCATTG    IV-3L20
103 F11 IV  C46A5.3 GAATTTCAAAGCATTCGGGA    TCATGTTCCAAGCAATCGAA    IV-3L22
103 F12 IV  C46A5.4 CACCATCCAGAATATGTGCG    TTCTTTCCTGGCTCTCCAAA    IV-3L24
103 G01 IV  C46A5.5 TTATTTGTGGCCATTCCGAT    TCGGATTTCCGTAGATGAGG    IV-3N02
103 G02 IV  C46A5.6 TGAAGAACCGGAAGATATCAGAA CAAGCTTTGCGTAAGCAGTATTT IV-3N04
103 G03 IV  C46A5.8 GATATATTTCTTCCCGATCCGAC GCTAAACCAGTCAATTTTCCAGA IV-3N06
103 G04 IV  C46A5.9 TTCCGATATCCATCTCTGCC    TCGGAGGAACAGGAGAAAAA    IV-3N08
103 G05 IV  C33H5.1 AATCCAATTAAACCGGCTACAGT TTGGAGCACCAAAACTACTGAAT IV-3N10
103 G07 IV  C33H5.3 CAGCATTCCAAGGATACAGAGAT TTTTCAACGTTTTCTCCACTGTT IV-3N14
103 G08 IV  C33H5.4 ATAACCCGCTCGACTTGATG    GACTTCGACGTTGCCTCTTC    IV-3N16
103 G09 IV  C33H5.6 AGGTGCCAAACTAAAATCATTCA GTAAAATCGTATTGTTGGCGAAA IV-3N18
103 G10 IV  C33H5.7 TTTGTTAATTCCGGGTTTGC    CGGAGCTTCCCACCATAATA    IV-3N20
103 G11 IV  C33H5.8 TTCCCCATTGATCTCGATTC    AACGTCTGAAAGAGCAGGGA    IV-3N22
103 G12 IV  C33H5.9 CGACATCTTCAGCGACAAAA    GAAAATGCGATTCGAGGAAG    IV-3N24
103 H01 IV  C33H5.10    TTCACTCCAACCATTTCTTCTGT ATAACTCTCGATTTTGCCAATCA IV-3P02
103 H03 IV  C33H5.12    AGGAATTAGGGTTGCAAATTGAT TTTTCAGCTCGAAGAGATTTTTG IV-3P06
103 H04 IV  C33H5.13    TGCGTGTAGTACGGTAACACTTG GTCGTCTTTGAATCGTCATTCTC IV-3P08
103 H05 IV  C33H5.14    GGTTTAGAATCGGTTCGCAG    TACAACGGCGGAAATGTGTA    IV-3P10
103 H06 IV  C33H5.15    TGCAGGAGTTGATGATGGAG    AGCTTGTCGTCAGTCTCGGT    IV-3P12
103 H07 IV  C33H5.16    ATGACTTGGTGAACGAAGAGGTA AAGTAAAGAAAAGGCGGAGAAGA IV-3P14
103 H08 IV  C33H5.17    GCCAAGCGTTTTTGATGAAT    TGAATCGTCAAAGCGTGTTC    IV-3P16
103 H09 IV  C33H5.18    CGAATCGATCCATCAGTCCT    CCGTGCTCTTTCGTGGTATT    IV-3P18
103 H10 IV  T14A8.1 CAACTGACGTTCCCCACTTT    TCTGATGTGCTTTTTGGTCG    IV-3P20
103 H11 IV  T14A8.2 AATGACAGAGGAATCAATCTGGA CACAACTTTTCATTTTTCTTCCG IV-3P22
103 H12 IV  C06A6.1 TCCTTTCTTGATCATCATTTCGT TAAGTCCGAATTCTCAACGTGAT IV-3P24
104 A03 IV  C06A6.4 ATTCTGGATGCTCCGCTAGA    TTTTCGTCGAAGAAGCCTGT    IV-4A05
104 A04 IV  C06A6.5 CACTGATGGAGGTGGTGTTG    TTGCTTTCTGTGCTGATTGG    IV-4A07
104 A06 IV  T06C10.2    CCATGAATAAGACATCAACGACA CCACTGACTTCTGTTTGTTTTCC IV-4A11
104 A07 IV  T06C10.3    GCGCGCAAATGACTGTAGTA    CCAGCTCCAACGGATAACAT    IV-4A13
104 A08 IV  T06C10.4    CGAATCATGGACACTTTTCTAGG AAACTGAAAATACTGGAATGCGA IV-4A15
104 A09 IV  T06C10.5    TTTTGAAATCGCAGTCAATTTTT TTGAATTGAAAGGAGAAGCTGAG IV-4A17
104 A10 IV  T06C10.6    TTCTTCGACATTCCCTTTGG    AATGCCACTGGGTACGGTAG    IV-4A19
104 A12 IV  C55F2.2 GATTTTCCATAGCATTTCACTCG AACTCCCAAAATGCTGATTGTTA IV-4A23
104 B01 IV  C49H3.1 CACCGGAAATGCTCAAAAAT    CATTTGACAATACGCCGCTA    IV-4C01
104 B02 IV  C49H3.2 TCGGCGAGAAGTGAGTTTTT    ACGAATTATCAGAGACGCGG    IV-4C03
104 B03 IV  C49H3.3 GTCTCGTGCTTTTCACATATTCC ATGAATCTTGTCAATGTCCTGCT IV-4C05
104 B04 IV  C49H3.4 ATTTTGAAAGTGGTACGGCG    AGGCCAATTTCCACCTTCTT    IV-4C07
104 B05 IV  C49H3.5 ACAGTTGATGACGTTGAGCG    TGCCTGTTCATATCTGCTGC    IV-4C09
104 B06 IV  C49H3.6 GATTGAGCCACACCCAAAGT    TGTCCACGAACTGTTTCTCG    IV-4C11
104 B07 IV  C49H3.7 TCCAACAATCCTCAGTTCTCAAT TGTAAACTTTATTGCTGCCGTTT IV-4C13
104 B08 IV  C49H3.8 CAATGATATCAGTCCAATCAGCA AGAATACGTCGATGATGAAGGAA IV-4C15
104 B10 IV  C49H3.10    ACGAATGCACGTTGGACATA    GCTTCAAAGTCCACGAGAGG    IV-4C19
104 B11 IV  C49H3.11    AGCAGGACATTGACAAGATTCAT ATTTTGCAGCTTGAGGTACACAT IV-4C21
104 B12 IV  C49H3.12    TTTCCATTTTGCCAGTAATTTTG AGTTTGCGTCGAAATTGATAAAA IV-4C23
104 C01 IV  F20D12.1    CAGTACGCATTTCCTCGTGA    CCAGCACGCAAGACTGTAAA    IV-4E01
104 C02 IV  F20D12.2    GTTCGTCAATCTCAACCCGT    CTCTCCAAAATTTCCCGACA    IV-4E03
104 C03 IV  F20D12.3    AATCGAGATTGCTGAATCGG    CTTCAAAAAGTCCCTCTGCG    IV-4E05
104 C04 IV  F20D12.4    TTGCAGGCAAGTGTTCAAAG    GAACGTGTTCTGTGAAGCGA    IV-4E07
104 C05 IV  F20D12.5    TTTTTGAAAGACTGGCTCTATGC ACACTTGGACGCCAATACTCTAA IV-4E09
104 C07 IV  F57H12.1    GTGTCACATGCTTTGGAGTGTTA ATATTTTAATGGGGGAAAGGGAT IV-4E13
104 C08 IV  F57H12.2    TGTTGTGATGACAATGCCCT    AATCTGACATTCGCTCCACC    IV-4E15
104 C09 IV  F57H12.3    TTGACCACACAGTCATTCAAATC GCTCAAAAATTCAAACACTTTGG IV-4E17
104 C11 IV  F57H12.5    TGCAACAAGACCACTGAAGC    TCAGTGCTCAAAGGCATCAC    IV-4E21
104 D01 IV  F57H12.7    AATAACTTCAATGTCCACATCCG CAGGGATCCAATTGTCTATGAAG IV-4G01
104 D02 IV  C18F3.2 ACTCCACCTCATATCGTGCC    CAGCCGGATAAAAATCCAGA    IV-4G03
104 D05 IV  C26B2.2 ATAAGTGCGGTTTGTGATTCTGT AGTTCAAGAGATTCGCCTTCTTT IV-4G09
104 D06 IV  C26B2.3 CGGATAGGGATCAGACAGGA    ACAAGTTTCCAAATCGGCTG    IV-4G11
104 D07 IV  C26B2.4 CGTTCCACCTGTAAGGCAAT    AATATGGGTTGCAAATCCGA    IV-4G13
104 D09 IV  C26B2.6 CATGAGCAGTGCCAAGATGT    CTTCAAGTGGTTGCGATTCA    IV-4G17
104 D11 IV  C26B2.8 CTGCTGACATGACTGGAGGA    CGTCAGATAACGCCGAGTTT    IV-4G21
104 D12 IV  F42G8.3 AAACACACGTTTTAGGCTGGTTA GAGATCAAGGAATTAGGGACACA IV-4G23
104 E01 IV  F42G8.4 CACCTGACGAGGAAAACGAT    TTCTCCAGGGATTAACGGTG    IV-4I01
104 E02 IV  F42G8.5 AAATTTCGTGGCTCGTCATC    CTTCCTGATCCTTTGCTTCG    IV-4I03
104 E03 IV  F42G8.6 CGGTTGCTGACTGCTAACAA    CGAATGCAACCTGAACATTG    IV-4I05
104 E05 IV  F42G8.8 CAGTCGTGATTCCAGCTTCA    GTATCGTGGAGCCGAGAAAA    IV-4I09
104 E06 IV  F42G8.9 AACTCAACGCACTTTTGCCT    GAGCCGTGAATGAGAAAAGC    IV-4I11
104 E08 IV  F42G8.11    GATGAATCCCGTGGAACAAC    GAGGCGGAGCATAACCAATA    IV-4I15
104 E10 IV  B0218.1 TGGAACTGCCGGAATTAAAC    TGGTGCAGCAACTTGAACTC    IV-4I19
104 F01 IV  B0218.5 TCTCGACTCTCTTTGTCGCA    CACTTCTTGGAAAGGGTGGA    IV-4K01
104 F02 IV  B0218.6 TAATTCGAGCCCAATCCAAG    TCTCAATGTTTTCCGCACTG    IV-4K03
104 F03 IV  B0218.7 GATTCCAGTGGCCACATCTT    TCACGACACGTACAATCCGT    IV-4K05
104 F04 IV  B0218.8 TGCTCTCTGGTCGTCTTGTG    TCACTGCTCCTCGTGTTTTG    IV-4K07
104 F05 IV  C07G1.1 AGAGTTGTCGGAGGCTTTGA    GAGGCACACATGGCTTGTAA    IV-4K09
104 F06 IV  C07G1.2 TCGTGGCAATTGACTGTGAT    TTACTCACCCAAATCCGAGC    IV-4K11
104 F07 IV  C07G1.3 TTCGAGGACTCGCCTACTGT    ACGAATCGGAATTGGTTGAC    IV-4K13
104 F08 IV  C07G1.4 GAGGGGAGCATCACAGAAAA    ATCTCATGGATTGGCTCCAG    IV-4K15
104 F09 IV  C07G1.5 GCCATTCGTTCTTGACGTTT    ATCTCATGAAGCTCGCTGGT    IV-4K17
104 F10 IV  C07G1.6 TCAATTTGTAGAGTGCTCGGATT CTCAAACATGATAAGTTCCAGGC IV-4K19
104 F11 IV  C07G1.7 TGATCTTTCTGAGGTTCTCGTTC GCTAATATCGATAGCTTTTCGCA IV-4K21
104 F12 IV  T09A12.1    TCGCGAGCTAATTGTGTTTG    ACTGTCCAGGAATCGAAACG    IV-4K23
104 G01 IV  T09A12.2    TTCGAAAACAGCAATTATCAGGT CATGGGAGTACTCGAACTACTGG IV-4M01
104 G02 IV  T09A12.3    GAAAATCCAATTGGCCTCAA    TTGTCTTCTTCATGCATCGG    IV-4M03
104 G03 IV  T09A12.4    CTTGGTCCTTGCTCAGCTTC    TCTCTCCGAACTCACCGACT    IV-4M05
104 G04 IV  H09I01.a    ATTTAAATCACCTGGAACGGTTT TTGGTGAGATTTCCAACTATGCT IV-4M07
104 G05 IV  H09I01.b    CTTTTTGAAATGAAAATGCCAAC TAGATCATTCCAGAATTGCCAGT IV-4M09
104 G06 IV  K07H8.1 GGAAGAGAGCGTCGAAACTG    ATGCTCATTCCCAATGGAAG    IV-4M11
104 G07 IV  K07H8.2 TCCGATCCAGTTTTCGTTTC    AGAATGCACGCTGAACACTG    IV-4M13
104 G10 IV  K07H8.5 TGAAAGGGAAAACACAAGGG    CGTAACGTTTGTACATGCCG    IV-4M19
104 H01 IV  K07H8.8 TTCCAGATGTTGAGTGCTGG    ATGACCTATGCCGAAGATCG    IV-4O01
104 H02 IV  K07H8.9 AAAACATGGAAAACAAGGCG    AGTTGCCACGTCTCTGACCT    IV-4O03
104 H03 IV  K07H8.10    TGCAGCTTGAGCGTCTTCTA    GCCTGTCGCTAAAACTCCAG    IV-4O05
104 H04 IV  F35H10.1    GAGCATTTGATTGCTTACTTGCT TTGGGTTCGGTTTGTATTATTTG IV-4O07
104 H05 IV  F35H10.2    AGAAGATGTTAGCTCCGCCTACT TGCCTACAATTGTTACTTGCCTT IV-4O09
104 H06 IV  F35H10.3    CACCCCAAACAAATACCATTCTA TCGCATTCGCATTTTATTTTACT IV-4O11
104 H07 IV  F35H10.4    GCTGGATTCCATTGAAGCAT    TTCCATGAAGTTCCTTTGCC    IV-4O13
104 H08 IV  F35H10.5    ATCATGGTAATGCACATCAAACA AGTTACCCAACTTCCGAAGAAAG IV-4O15
104 H09 IV  F35H10.6    CAAGGATCTTTTATTCCGGTTTT AGAAATCGTAGGGAAATGTGGAT IV-4O17
104 H10 IV  F35H10.7    TGCTTCTCGAAGATGTGTGG    GGCTACTCGGCAACAAAATC    IV-4O19
104 H11 IV  F35H10.10   CTCTTTTGGCTCAATGCACA    CGACTGGAAATCCACCAACT    IV-4O21
105 A01 IV  F17E9.2 GTAATTCTGGAGACACGAACCAG ATACCTATTTACGGAGGCGAAAG IV-4A02
105 A02 IV  F17E9.3 GCAAATTTCAGTTGGAAATCAAG CTGGTTCGTGTCTCCAGAATTAC IV-4A04
105 A03 IV  F17E9.4 CTGCAGTTGCACAGCATACTATC CAAACTTCCAAACGTTTTTCAAC IV-4A06
105 A04 IV  F17E9.5 TATAAGCATCGCAGAGACACTCA GCAGAATTTGCAGATTACATTCC IV-4A08
105 A05 IV  F17E9.7 TTAGTGCTACGCACGTTTGG    CCAGAATTTTGAGCCAGAGC    IV-4A10
105 A06 IV  F17E9.8 CCCCTATCATCATCAGTCCG    TCTCAATGTTGCTGCTCCAC    IV-4A12
105 A07 IV  F17E9.9 TTGTCACAAGTCCATTCTCATCA TGGCACTGCTCTTACACTAAACA IV-4A14
105 A08 IV  F17E9.10    TGAAGACTCACGAATGAGATGAA TATCCTTTGGCATGATGGTAACT IV-4A16
105 A09 IV  F17E9.11    AGAAGTGTGCCCAATGATAAGAA TTTAGGGCCACAAATGATATGAA IV-4A18
105 A10 IV  F17E9.12    TCCGTACAAAGTTCTTCCTTGAC TGCATTCTAACCGAATGACCTAT IV-4A20
105 A11 IV  F17E9.13    CAAGAGTGACGTCATATTTCGGT ACCTCACCAGTTTACGAACAAAA IV-4A22
105 A12 IV  D2096.1 ATGCGAGAAGTACGAATGAGAAG ACGAAATTTGTTCGAAAAACAGA IV-4A24
105 B01 IV  D2096.2 TCGTTTGTTTTCTGGTTTGTTTT GAAGAATATGTCAAGTTGGCTGG IV-4C02
105 B02 IV  D2096.3 GTTTGCAACACGGACAACAC    CGGAACTCGGAGCATCTATC    IV-4C04
105 B03 IV  D2096.4 TACCGGAATGAGGAAACTCG    TTGCTTGTTGCGTTCTCATC    IV-4C06
105 B04 IV  D2096.5 GGTCGATATTTGTCTGCCTGTAG TAATTCGATTTGTGCTTCACCTT IV-4C08
105 B05 IV  D2096.6 AATTTACAACTTTTGGCGTTGAA CAAGAATTCCAACATTCCAACAT IV-4C10
105 B06 IV  D2096.7 AACCACTAGACCAAGCGTGC    TGTGCGACGCTTCTATCAAC    IV-4C12
105 B07 IV  D2096.8 CTGACACATCATCACCGTCC    ATTCAGGCTTTGCCTCTCAA    IV-4C14
105 B08 IV  D2096.9 ATTTATTGTTCTCCGCTCAATCA TACAAATCCTCTTTCCACCTCAA IV-4C16
105 B09 IV  D2096.10    CAGCTCACTTTTAGACTTTCCCA TCTCAATCTTGGAAATTCGTTGT IV-4C18
105 B10 IV  D2096.11    AGCATGAATTGGACGAGCTT    TATGTCGCCAGTGGTGGTAA    IV-4C20
105 B11 IV  M116.1  CCAGTGTCCGTGTTTCTTCTATC GCAAAAGTTGCATCTAGTGTCCT IV-4C22
105 B12 IV  M116.2  TCCAACCCAGTGGTTAAAGC    TTGACAAGTTCACGCTACGC    IV-4C24
105 C01 IV  M116.3  AGATCGCAAGGTTGAATAAATGA AATGCAGCGTAGGTATCGTTTTA IV-4E02
105 C02 IV  M116.4  GAATCAACATTTCTCTTTCCACG TTTTGCCGAAGTAACCTAATTCA IV-4E04
105 C03 IV  M116.5  CGACTTGTTTCAACAAAGAATCC TGAGAAATCGATCATCACATACG IV-4E06
105 C04 IV  T26A8.1 CTGTGGAGCATGGTCGAGTA    AGGGCCTGGAAATTAGTGCT    IV-4E08
105 C05 IV  T26A8.2 CGAATATGGTCTTGCAGGGT    GGGCGATGATCTTCTGTGAT    IV-4E10
105 C07 IV  T26A8.4 CTCTTTCTGTGCCCGAAGTC    TTCCACAAAGGACAATGCAA    IV-4E14
105 C09 IV  T01B11.2    AGTTTTTGATCGGGTTCACG    GACAAACGGGTTGCAAAAAT    IV-4E18
105 C10 IV  T01B11.3    TACTCGGGACCGTCTATTCG    TTCCATTTACGGTTCTTCCG    IV-4E20
105 C11 IV  T01B11.4    AGAACGAGTGCTCCACCAGT    GGTTTTCAACCGCTTGGTTA    IV-4E22
105 C12 IV  T01B11.5    ATGGTTGAAACAGCGGAAAC    GTTCAAACGTTCGGTGTCCT    IV-4E24
105 D01 IV  T01B11.6    TTCGCTTATGCTCTGGAGGT    CGTTCAGAAGGGAAAACTCG    IV-4G02
105 D02 IV  T01B11.7    TATCCCACTACTAACCCCAAACC AAAAGTTGGTACCTTCCGATTCT IV-4G04
105 D03 IV  C28C12.1    TAAAACTTTTGGGAATGCGTAGA TACGGTAGGTGTACGGTAGCAGT IV-4G06
105 D04 IV  C28C12.2    TCGAATATTTCTTGCAGATGCTT ATTCCTGTTTGCGTATGAACACT IV-4G08
105 D05 IV  C28C12.3    TCCATTTTCTTTGGTTTTTGAGA ACATCACGACTTCTGACGTTTTT IV-4G10
105 D06 IV  C28C12.4    GAAAACACGGAAAACTCCGA    GTCAGAGGTGTCGGGGAATA    IV-4G12
105 D07 IV  C28C12.5    ACGTGTTTTCAGTTTTCCGC    TGTCATCAGCTGTTCCTTGC    IV-4G14
105 D08 IV  C28C12.6    ATTGTCGAGACAAAGTCGGTAAA CTTTTAAACGGTGTCGAATGAAG IV-4G16
105 D09 IV  C28C12.7    CTCCCACTATCTCTGCTCCG    CAAGCGATTTATGGAAGGGA    IV-4G18
105 D10 IV  C28C12.8    GTCAAGTATGCCACCTGCTATTC AAACTTTCAGACGAGAACGACAG IV-4G20
105 D11 IV  C28C12.9    AACCACCGCTTTAGTGTGCT    TTGGAAAATATTTCGACGGC    IV-4G22
105 D12 IV  C28C12.10   ATCTCTACAATGATGCCGCC    TTGGAACTTTTGCCGATTTC    IV-4G24
105 E01 IV  c28c12.11   TGTCTGAATTTTGAAGCAAGTGA TAATTTTGTGACGGAATTGAAGC IV-4I02
105 E03 IV  C09G4.2 AGAAGCCGATGTTGAATTGG    CAAGACGTTCTGTTGGCTCA    IV-4I06
105 E04 IV  C09G4.3 TTTCTATTTCCCGATGCTTGTTA TTGAAGGGTGTCCAAGATTTCTA IV-4I08
105 E05 IV  C09G4.4 TTGTCGATTTGATCGTGTATCTG TAACAAGCATCGGGAAATAGAAA IV-4I10
105 E06 IV  C09G4.5 ACGGATGTGCATTCAATCAA    GAAAGAAGCTTGCCGAACTG    IV-4I12
105 E07 IV  F42A9.1 GGAAAGAGCACATACAAAAATGC TTTCGATTCTCGACATTTTCATT IV-4I14
105 E08 IV  F42A9.2 CACAGGAAGACGTCGTCAGA    CAGAGAGTACTTCCCGACGC    IV-4I16
105 E09 IV  F42A9.3 ATTTTTCCTCAATTCCGATCATT GCACATTTTCCAAAAAGATTCAC IV-4I18
105 E10 IV  F42A9.4 GCACTATCGTTAGCACTGCTTTT AATTACAATGTCAATGTCGTCCC IV-4I20
105 E11 IV  F42A9.5 AATTTGCCACCAGGTTTTTG    CATTCCAGCAACCCAGAGAT    IV-4I22
105 E12 IV  F42A9.6 TACATTGGACTGACTGGACTGTG TCAACGAACTTACCGACGATTAT IV-4I24
105 F01 IV  F42A9.8 GAGTTGGTAAGATTTCGCTTTCA CGACATCGAACAGCTTTATATCC IV-4K02
105 F02 IV  F42A9.9 GGTCCAGAATTCACAGTTCAAAG AACAATGATCGGAGCAGTTAAAA IV-4K04
105 F03 IV  C49C8.1 ATCGACCAAAGTCAACGGAC    CCGAGCTCCAAAATCAGAAG    IV-4K06
105 F04 IV  C49C8.2 GTTGCGAAGGAATTTGGTGT    GCAGCACAAAAATGCAGAAA    IV-4K08
105 F05 IV  C49C8.3 CTGGACATATCAGGTTTATTCCG ATTTCTTCAAGTTTTCCCGTCTC IV-4K10
105 F06 IV  C49C8.4 GAGACTGTGCTAGGAGTAACCGA GGTGATAGATGGATTCAGCAAAG IV-4K12
105 F07 IV  C49C8.5 GCAGAGACCACGAAATTAAAATG AATGAGTTCACGACAATCGAAAT IV-4K14
105 F08 IV  C49C8.6 TAATTGATTTGAACACCGGAATC TTTCAAACAAATTCCAAGCAGAT IV-4K16
105 F09 IV  F08B4.1 CGTGCACATCCACAATTCTC    TGCTTGTGGATTCAAACGAG    IV-4K18
105 F10 IV  F08B4.2 TGTGTCTGAAGCAGTCCGTC    ACCATGGTTGAACCTTTCCA    IV-4K20
105 F11 IV  F08B4.3 AATTTTCATTCTGTCCGGATTTT AAAAATCTTCAGCAATCTTTCCC IV-4K22
105 F12 IV  F08B4.4 TTGCTCAGGCAATTATGAAACTT GAAATCGACTTTTCCACATTCAG IV-4K24
105 G01 IV  F08B4.5 GACACGGATTCGAAGCAAAT    TATTCGACGCATTCTCCCTC    IV-4M02
105 G02 IV  F08B4.6 GTGGGAACCACACGAACTTT    TTTTCCAACAATTCGAAGCC    IV-4M04
105 G03 IV  F08B4.7 CGAATTAGGAAACTTCAGAACGA AAATCTTAATTTTCAGCATGCCA IV-4M06
105 G04 IV  H23L24.a    ATTGATTTTTGCTCTGATTGCAT GCATCAGATTTCAACCAGATTTC IV-4M08
105 G05 IV  H23L24.b    CCAGCGATTATCTCAACATTTTC CTTGAGAATTCCCTCATTTTCCT IV-4M10
105 G06 IV  H23L24.c    TTTTCAGGATCTAAACTGGCAAA AAGGAGTACGGTAAGCAGAATCC IV-4M12
105 G07 IV  H23L24.d    GACAGTCATCACATGGCTTACAA GGTTTTCTGAAATCTAGCAAGCA IV-4M14
105 G08 IV  H23L24.e    CCTGCGTCTCGAATATTTACAAC TTTCAGGTAGGCAAAACACTCAT IV-4M16
105 G09 IV  F21D5.1 AATTCGGAATCAAACGATGC    GAAAGGGCCAATGATGTGTT    IV-4M18
105 G10 IV  F21D5.2 TCGGCGTGAAAAGAAAGAGT    CTCGAGTTCTCCACCCCATA    IV-4M20
105 G11 IV  F21D5.3 GGACTCCCCGAGGATAAGAC    TTATCGCGTAAGCGACCTCT    IV-4M22
105 G12 IV  F21D5.4 CCAATGAGGCAGGGAGATTA    CCGCATTCGATATGGGTAAG    IV-4M24
105 H01 IV  F21D5.5 TGGCTGCTACACACTTTTGC    TGGCTCGGTACATTTATCCC    IV-4O02
105 H02 IV  F21D5.6 TTGATTTGGTTCCCTTCGAG    CGAGGAAGAGGCTGTTGAAG    IV-4O04
105 H03 IV  F21D5.7 GGGAACAGGCATTTCAAAAA    CAGGTCGTCACAAGCAAGAA    IV-4O06
105 H04 IV  F21D5.8 TGGAAAGTTAAATCTCGCCAATA CAATCTCAATTTTGCATTTCACA IV-4O08
105 H05 IV  F21D5.9 TTCAACTAAGAATGGCAGATGGT TAACATTTCGATGGTACGGTTTC IV-4O10
105 H06 IV  F20C5.1 CGAATCAGCTACCTTGAGCC    CATCCCCACCATCCAGTAAC    IV-4O12
105 H07 IV  F20C5.2 GCAACCCGTGCTTGTTCTAT    ATCGGATCCAGAACAACGAG    IV-4O14
105 H08 IV  F20C5.3 ATTCATGCTCACGATGACGA    GCGGCACCATAAAACAAAGT    IV-4O16
105 H09 IV  F20C5.4 TGCTCTGCAGTTCCTAATTTTTC AATTAATCTCAACCAGCGAATGA IV-4O18
105 H10 IV  F20C5.5 CGGGTCATTTCGCATAGTTT    AAGTTTGAATCCATCGCAGC    IV-4O20
105 H11 IV  F20C5.6 CGCAAAAGTACGGGAAACAT    TGTAAGGAAGAGAGCCGCAT    IV-4O22
105 H12 IV  C33D9.1 CTTTCCCAAATCGATCCTGA    TTCTCCCGCCAAGAGACTTA    IV-4O24
106 A01 IV  C33D9.2 ACAATGCAGCTGTGAGCATC    TGCGCATCATGAAGTCAAAT    IV-4B01
106 A02 IV  C33D9.3 ATCCGACAAAGGAACTGACG    ACTGGGAGCGCTTACAGAAA    IV-4B03
106 A03 IV  C33D9.4 CGACATGAACATCGGATGAG    CTTGCGTAGACTCCCCCATA    IV-4B05
106 A04 IV  C33D9.5 GGTTATACATGGGTCCAGCG    TCCCATGGTATGCTTGAACA    IV-4B07
106 A05 IV  C33D9.6 AATTGCTGCAAATCCTCCAC    CTCTAAATGCTTGCGCTGTG    IV-4B09
106 A06 IV  C33D9.8 ATCAGTGGAATCCGATGAGC    TCTGAAAAGGAAGCTTCGGA    IV-4B11
106 A07 IV  T28C6.1 GTTTTAGCCTACGTGGCAGC    GACCTCCTTGGTTACCCCAT    IV-4B13
106 A08 IV  T28C6.2 TTGGAGTGTTTAGCAACCTTTGT CTCGCAGTTTTACAAATTTACGG IV-4B15
106 A09 IV  T28C6.3 ATCACATCTGCCACATCTTTTCT CAACTTCAGGTGACAAATCAACA IV-4B17
106 A11 IV  T28C6.5 AAAACTTTCGTGGTCGTCAGATA GCCACAAAACCCTGAAATATGTA IV-4B21
106 A12 IV  T28C6.6 ACGTTTTACGTTTACACCACCAC TTCTCATAAAATTTAACGGCGAG IV-4B23
106 B01 IV  T28C6.7 CTCAATTAAGATGGAGGATGCAC TTCGAGAGCTTCAGTGATTTTTC IV-4D01
106 B02 IV  T28C6.8 CAAATGGTGAGACGATAGGAGAC ATTCGAATGGCAATAAGTTCTGA IV-4D03
106 B03 IV  T11B7.1 GATTCAACACTCAGCCGTCA    AGAAGCGCTGCTTTCAGAAC    IV-4D05
106 B04 IV  T11B7.2 TTGAATCATTTTTGGTGGTTTTC TATTTCGAAACGATACGCTGATT IV-4D07
106 B05 IV  T11B7.3 GTCCAAATCAGACATACAGCTCC CGAAATGTGTTTCATGTCATCAT IV-4D09
106 B06 IV  T11B7.4 AGCTTTCGAAGAACAACGGA    TCTTGAAATGCTTTGGGTCC    IV-4D11
106 B07 IV  T11B7.5 TGAAACAGATCAACGTGTGAAAC TTTGGATGATTCGAAAGAGTTGT IV-4D13
106 B08 IV  C09G9.1 ATTAGATTGAGGGGCGGAGT    CGGCTAGAAGGTAGGCATTG    IV-4D15
106 B09 IV  C09G9.2 ATTCACTAGGTCGCCTTCCA    CTACGACGCTCCGCTTTAAC    IV-4D17
106 B10 IV  C09G9.3 GTTGTTTGAAATTGGAGAACAGG TCCCGTAATATTCTGGGGTAAGT IV-4D19
106 B11 IV  C09G9.4 CGAAGAACGCGGATTACATT    ACCCCCAATCATTTCACAGA    IV-4D21
106 C01 IV  C09G9.6 CCGAATGCAGAAACCAGAAT    GGCCAAGTTTCTATGGGACA    IV-4F01
106 C02 IV  C09G9.7 AATTTTTCTTCGTACATGAGGCA ATCATTTGTCACCTACTCGTCGT IV-4F03
106 C04 IV  C27B7.2 TACTAACTTGCTCATTCGCCTCT AGCCAATTTTTCTTTGAGCTTCT IV-4F07
106 C05 IV  C27B7.4 ACGACAAATCCGTGGAAAAG    GACCCATCATTCCCATTGAG    IV-4F09
106 C06 IV  C27B7.5 TCCGTACGAGGAGGGTACAG    AAAATACGCTGCAAATTGGG    IV-4F11
106 C07 IV  C27B7.6 GTGACATTTTCTGCCCGTTT    TGCTCCTGTCGTTGTTTTTG    IV-4F13
106 C08 IV  C27B7.7 CATGACGTCGGTTACACTGG    GCATGGATTCGTGTCTTCCT    IV-4F15
106 C09 IV  C27B7.8 GAAATGTCCAGATGAACCAGAAG AATCCGCACTGGTATAGATGAGA IV-4F17
106 C10 IV  D1046.1 AACGAATGGACAAAGCAAGG    TGACATGGACTGGTGGAAGA    IV-4F19
106 C11 IV  D1046.2 CGTTTGGGTGAGTAGGGTGT    AGGAGTACAACGATGGTCCG    IV-4F21
106 C12 IV  D1046.3 GGCTATCTTCCAACTCAACAATG TGTTCAGAAAGTATTGGGAGGAA IV-4F23
106 D01 IV  D1046.4 GCACCAATGATCATCTTCCC    CGAATTGGGGTTTCTCTGAA    IV-4H01
106 D02 IV  D1046.5 TCAGTGGTACCCGACACAAA    GCACATTGAGCACAACCATC    IV-4H03
106 D03 IV  C53B4.1 AAACGTTTGCGAAAAATTGG    CAGCGATGAGACATGCAAAT    IV-4H05
106 D04 IV  C53B4.2 AGGGAAAGCCCCAGAAAGTA    TTCAGTCAGGTTTGGCAGTG    IV-4H07
106 D05 IV  C53B4.3 CCCAGTACGATTCCCTGAAA    AATCCCAGGAATTCCAGTCC    IV-4H09
106 D06 IV  C53B4.4 ATCGAATTATCGGAACAGCG    TTCGGGCAGAATTGAATACC    IV-4H11
106 D07 IV  C53B4.5 AACCGGTTTTCTGATCGTTG    GTAGCCGTTCTTTCGGTCTG    IV-4H13
106 D08 IV  C53B4.6 AACGAATAACTTTCAGTGCCAAA AGATTGATATCTTAAAAGCGGGC IV-4H15
106 D09 IV  C53B4.7 CAATCCATGCTTGTCGTTTG    CCCGAAACAGAATGCTTCAT    IV-4H17
106 D10 IV  C53B4.8 GAAGTTTCACTGATTATGTGGGC TTGTGGAGAGAATACAGTCGGAT IV-4H19
106 D11 IV  C53D6.1 AGCTCCAGCATGCAGTCTTT    GGTGAGAGCACACTTGGACA    IV-4H21
106 D12 IV  C53D6.2 CTGCAAATGAAATGGTGTGG    GCGTGCGTATGCAAAAATTA    IV-4H23
106 E01 IV  C53D6.3 CCCGAATGGAACAGTAATGG    TGGGAACATGACACTGGAAA    IV-4J01
106 E02 IV  C53D6.4 GACCCGTTTGGTTGAAAGAA    CTTGCGAGAAGCGAAGAATC    IV-4J03
106 E03 IV  C53D6.5 ACTCGCCTTCTAAGTGGAGAAGT AGCTTGTTTTCATTCTGAAATGC IV-4J05
106 E05 IV  C53D6.7 CGGTGCTCAAAAGTGCAGTA    AAGGAAATTGGCAAGCAATG    IV-4J09
106 E06 IV  Y73F4A.1    GCTATAGGGGTTCAAGTTTCCAT GCAAAAACTGGCAATATCTCATC IV-4J11
106 E07 IV  Y73F4A.2    ACTTTATGGCACTCTGAAACGAA ACAAAAACCACGATGGTAAACAC IV-4J13
106 E08 IV  Y73F4A.3    CACTGTGACGCACAAACATTATT ATATTTGCCACGTCTTTTTCTCA IV-4J15
106 E09 IV  ZC410.1 CTTCGAGCCCAGAAGAAATG    GACGATGCTTTCTTCCCAAA    IV-4J17
106 E10 IV  ZC410.2 AATTGCAGCCGTCGATATTC    CGGGCATGTAATTCTGGAGT    IV-4J19
106 E12 IV  ZC410.4 CAGCTGGAAGAATTGCAACA    CTGGAACCTCGATTCCGTTA    IV-4J23
106 F02 IV  ZC410.6 AAGGTCTCAATACGAAGGGTCTC GTCCGCGATAAACTACTCAACAC IV-4L03
106 F03 IV  ZC410.7 GATTTACCTGTATTCGCAGTTCG ATGTTGTTATTGACCCGTGTTTC IV-4L05
106 F04 IV  C01F6.1 TTCCGAAAATCAATCGGAAG    AGCACCTCCAGGAACTTGAA    IV-4L07
106 F05 IV  C01F6.2 AACTTCAGAACCATGGCACC    CAAAGGAAATGATCCATCCG    IV-4L09
106 F06 IV  C01F6.3 GCGGTGAACAAGGTACAGGT    TCAGCATCTCAATCAGCCAC    IV-4L11
106 F08 IV  C01F6.5 TTGATGTCCAAGTTCCTCTTGAT TGTCTTCTTTGGTTGAGCTTCTC IV-4L15
106 F09 IV  C01F6.6 ATTTTTGGAATGTTCCCATTTCT GGTAACATAAGGGATTTTAGGCG IV-4L17
106 F10 IV  C01F6.7 AAAAAGACGGGGCAAAGAAT    CACCCGACTCCTAGATTCCA    IV-4L19
106 F11 IV  C01F6.8 GAAACACGGGTCAATAACAACAT CAACCAATGTACAGGCTTTCTTC IV-4L21
106 F12 IV  C01F6.9 GGTGCGGTACAGAAAATAAAGTG TCTAAATATGCGCCATTAGGAAA IV-4L23
106 G01 IV  F23B2.1 TCCAAACCACAAATTGCTTACTT TAACTGGGTCATGTTTCGAAGTT IV-4N01
106 G02 IV  F23B2.2 TGTTTCGTCTTTTGGTTTGAGTT GAAATTTCACGTTCTTCGTTCAC IV-4N03
106 G03 IV  F23B2.3 ATCCTCCCAAGAACATTCCC    GGACGCCAGTTTTGATTGTT    IV-4N05
106 G04 IV  F23B2.4 AGCTATTCGGAGGGCTTCTC    CATGGGATGTGTTGATGGAA    IV-4N07
106 G05 IV  F23B2.5 ATCTTCCTGAAATTCCAATCCAT GAATTAGCTGCTGTGTGAGTGTG IV-4N09
106 G06 IV  F23B2.6 AAAGTCGTCAAGAAACCAATCAA ATTTGAAGAATGGCAATGAGAAA IV-4N11
106 G07 IV  F23B2.7 GAAATCGCAACGTTCTGTGA    CGACGGCAGCTCTCTAGTCT    IV-4N13
106 G08 IV  F23B2.8 GAGGATCTCGCGTAATAAATGTG TTCCCTTTGCATTTACGAAGTTA IV-4N15
106 G09 IV  F23B2.9 AATAAAAGGTTCCAACACCGACT CGGGAAATTTCTTACGTTAGCTT IV-4N17
106 G11 IV  F23B2.11    AGACGTCCATGCACATTTGA    ATCCACCAGGTTTCGAACAG    IV-4N21
106 G12 IV  F23B2.12    TACCCCACACGACTTTCTCC    GGGGCTTACAAAGTGTGCAT    IV-4N23
106 H02 IV  C07C7.1 ATTTTTCTTCTCGAGTACCCGTC TTCACAAATTGGTTTTGATTTCC IV-4P03
106 H03 IV  C07D10.1    CAGTGGACGCTGCTACGTTA    AAAGTGTGCTCCTTGCGACT    IV-4P05
106 H04 IV  C07D10.2    ACTACACCGACGTTTCGAGC    AGATTGGTTTCCGTCATTCG    IV-4P07
106 H05 IV  C07D10.3    TATCATTCTCGTTGCCTTGTTTT AAGTCCATTGTTGCTGAAGTTGT IV-4P09
106 H06 IV  C07D10.4    GCCATTGGTGGATTAATTGG    ACTATGGCCGAACGCTAGAA    IV-4P11
106 H07 IV  C07D10.5    TCCGATTGGGAGAAGAGAGA    AAAAGCAACGGAATGTCTGG    IV-4P13
106 H08 IV  C46C2.1 CCGTCTCTCAAGCAGAATCC    ACAAACGGTTTTGCACCTTC    IV-4P15
106 H09 IV  C46C2.2 AACACCTGTGGTTTTCTCGC    ATCTCCTCCACACAAATCGG    IV-4P17
106 H11 IV  C46C2.4 CGAAGTTGTTCCCGTCGTAT    TGACGACAACGTGTTAGGGA    IV-4P21
106 H12 IV  Y11D7A.1    AAGGTTCTCCGCAATTATTTTTC TATTAGTATTGCACCCCGAGAGA IV-4P23
107 A02 IV  Y11D7A.3    TATCGGAGAATCTGTCATCCACT CATTGAAACCGAATAAATTCCAA IV-4B04
107 A03 IV  Y11D7A.4    AGAATCCAAATATGAAGGGGAAA GCTAAAATAGTTTTTGCCCGAAT IV-4B06
107 A04 IV  Y11D7A.5    CATTCCATGTCTCTCAATGTTCA TTACCTTTCGAATTGCTTATCCA IV-4B08
107 A05 IV  Y11D7A.6    CGACTTTTTCTAGTTCCGAGTGA AAGATGGGAACGGGAAATAATAA IV-4B10
107 A06 IV  Y11D7A.7    TCGTTCGTTCAAAATGTTTTTCT CTCTCGAAGCCATTAAAACTTGA IV-4B12
107 A07 IV  Y11D7A.8    CAAATGAATTTGGTGATGATGTG TCTTGCCTGTCCAATCAATAAGT IV-4B14
107 A08 IV  Y11D7A.9    TTCTGAACAACGTCTTCGATTTT ATATTTCCTCGATCTTCCTCGAC IV-4B16
107 A09 IV  Y11D7A.10   AGGAAATGATTGATGGGTAGGTT ACATGCACACTTTCATCGTTATG IV-4B18
107 A10 IV  Y11D7A.11   TTCGTCTTGCGTTGTGTTTC    GTGGCGACTGTTGTCAGGTA    IV-4B20
107 A11 IV  Y11D7A.12   TTTCTGGCAAGCTCGAAAGT    GCGGATGCTCCTGAAGTTAG    IV-4B22
107 A12 IV  Y11D7A.13   ACAGCTCGAAGCCGTACACT    GAATGGAGCACCCGATAAAA    IV-4B24
107 B01 IV  Y11D7A.14   AGGCGAAGAAAATCGATGAA    CCGATTGAGTTCTTGCCAAT    IV-4D02
107 B02 IV  Y11D7A.15   CAACTTCTCCTTCTCCCAATTCT AGCTTGCGACATCACATTTTTAT IV-4D04
107 B03 IV  H22D14.1    TGGGAAAATGAGGATCCAAG    GATACTGCATCAACTCGCCA    IV-4D06
107 B04 IV  F14A5.1 CAGTGCGAAATTGGAGTGAA    TTTCGAAAAAGGACAATCCG    IV-4D08
107 B05 IV  F49C12.1    GATGAGTCCGGGCTTTGATA    GGCATCCAGATTTCTCTTCG    IV-4D10
107 B06 IV  F49C12.2    TCCGTGCACTCTTTATCGTG    ATCGGCTTGGAGATGGTATG    IV-4D12
107 B07 IV  F49C12.3    GATACGGCAAATGCTGGAGT    AAGCAGTTTTTGCGCTTTGT    IV-4D14
107 B08 IV  F49C12.4    TTTATCAAACGGGCCATCTC    TATTGCCACATCATTTCGGA    IV-4D16
107 B09 IV  F49C12.5    AAGGGGTACATGACCATCCA    TTCTGAGATTCGACCGGAGT    IV-4D18
107 B10 IV  F49C12.6    TCCAGGAGCTTTGGAAAGAA    AATTCCTCTCGCGTTGATGT    IV-4D20
107 B11 IV  F49C12.7    AAATCAAAGGGCACTGGATG    TCGAAGGAGATGACAAGGCT    IV-4D22
107 B12 IV  F49C12.8    AGAAGTTGAAGACGCGGAGA    ACACGTTTGAAGAACTGGGC    IV-4D24
107 C01 IV  F49C12.9    TTTTAGCCCTATTGACGAATGAA TACTTCCGAATTCAAAGACCAAA IV-4F02
107 C02 IV  F49C12.10   CGCTGTTTATTTTTCAATCGTTC ATGATGATTGGCTGAAATTGAGT IV-4F04
107 C03 IV  F49C12.11   AAACTCAATTTCAGCCAATCATC TAATTTTTCGAATTTCCCCCTTA IV-4F06
107 C04 IV  F49C12.12   TAAGGGGGAAATTCGAAAAATTA AAACTTCCGTCCATTACTCAACA IV-4F08
107 C05 IV  F49C12.13   AAACTGTTGAGTAATGGACGGAA AGGAGGAAGGAAACGAATATCAC IV-4F10
107 C06 IV  F49C12.14   ACTCCTCGATATTGTGTGTCGAT TAGAGAGTTTAGAGAGACGCCGA IV-4F12
107 C07 IV  F49C12.15   TGGAAAAGAAGGAAGAGGCA    AGATCACCATCTCACTCGGG    IV-4F14
107 C08 IV  T20D3.1 CAAAAAGTGTTCCATATAAGCCG ATCGAAAGAAAACAAATGCAAAA IV-4F16
107 C10 IV  T20D3.3 TAGATCACTTTGAGGTTTTGGGA GCTGATTGTTATCATAATGGGGA IV-4F20
107 C11 IV  T20D3.5 AACGAAACAGAACAATCGAAAAA GAAAGAAAGGCACAAAATGTGAG IV-4F22
107 C12 IV  T20D3.6 AAATCTTATCCCGCTCACTCTTC CCGTTTGTTTTGTTTCTCAAAAG IV-4F24
107 D01 IV  T20D3.7 ATCCAGCCAGGAACAATCTG    TTCGGCTCTCAAATGAGGAT    IV-4H02
107 D02 IV  T20D3.8 AATTGAAAGTCGATTTTTGAGCA CATTTCCAGACAATTATTCAGGC IV-4H04
107 D03 IV  T20D3.9 ACAAGTGTTACCGGAATACGAGA GAACACCGATATGTTGGATTTGT IV-4H06
107 D04 IV  T20D3.11    CAAAAAGTGACGTTCCAGCA    CACAAATCGACCGAGGAGTT    IV-4H08
107 D05 IV  C10C5.1 GAGTGGTGAACGATCGGAAT    ATGCGGTAAATCTGAATCGG    IV-4H10
107 D06 IV  C10C5.2 GTATGCGGTAGGGAACGAGA    CTTGGACGCCATTTTCATTT    IV-4H12
107 D07 IV  C10C5.3 TGCCTGCCGAGATTTTCTAT    CCCATTGATCCAGCTTGTTT    IV-4H14
107 D08 IV  C10C5.4 GTGGCCTGTCGTGACTTTTT    CTTCAAATGCAGCCCAAAAT    IV-4H16
107 D09 IV  C10C5.5 GAGTACCGGCAGAGCAGTAGTAA TGATCATTGGGGAAAAGTTAATG IV-4H18
107 D10 IV  C10C5.6 GAAGCAATGTGTTCCCGTTT    ATCGAATACCCTGCCATCTG    IV-4H20
107 D11 IV  F56D5.1 CTCCAATTCCACCCTGTTGT    AAGTTTCCGTCATGATTCGC    IV-4H22
107 D12 IV  F56D5.2 ACCATTTTTGTGAACCGGAA    GCTCGATTGGGAGATGAAAA    IV-4H24
107 E01 IV  F56D5.3 AACCGATTGCATTGACAACA    AATTGCGCAGCTTTTTCAGT    IV-4J02
107 E02 IV  F56D5.4 TTCTTTCGCACACACTACGC    TGGCGAAAACTGAAAATTCC    IV-4J04
107 E03 IV  F56D5.5 GTGATCCCTGACTTCGGAAA    CTCCCTTGGACGCTCAATAG    IV-4J06
107 E04 IV  F56D5.6 GCATTGACTTCAAGCTTCACTTT TCGTATACCATGGAAGGAGAAAA IV-4J08
107 E05 IV  F56D5.7 AACTCCATCCAAACCAGTCG    CCTAGTGAAGCTGGTGGAGG    IV-4J10
107 E06 IV  F56D5.9 ACCAATCCATGAAAAGTCGC    TAATTTGCCCACATTCACGA    IV-4J12
107 E07 IV  F56D5.10    TGCTCGACTGATCACCTCAC    TCAATGAACTGATTGCCAGC    IV-4J14
107 E09 IV  F59B8.2 CGGTACGAGTGACAGCTGAA    ATACAAGGCCACCGACTTTG    IV-4J18
107 E10 IV  F38E11.1    TCTGCATTTAACCGTGAAAATCT TCGAACTTATTCGTTCGTTCATT IV-4J20
107 E11 IV  F38E11.2    CAGAAAAGAGTGCCAATATACCG AAAAACTTTTGCCAAGATGATGA IV-4J22
107 E12 IV  F38E11.3    ACCTTCAACATCCTTGTGCC    TTCCTATCCACTCCGGACAC    IV-4J24
107 F01 IV  F38E11.4    TCGATTGCGAACCTTCTCTT    ACCAGAAACCCCTCCAGAAT    IV-4L02
107 F02 IV  F38E11.5    CGGGGACTGCTTTATTTTCA    ATGCTGGGACTGGAATCTTG    IV-4L04
107 F03 IV  F38E11.6    CGCCAACGGTTGTATTACCT    ATTTCAGACATTGTTCCGGC    IV-4L06
107 F04 IV  F38E11.7    TCTAATCATCGACCCGAAGG    GGGAGGATCATCTTGTGGAA    IV-4L08
107 F05 IV  F38E11.9    AAGGTGGAGTAGCGCCAGTA    GGTCGTTTTCTGCCGATTTA    IV-4L10
107 F06 IV  C33A12.1    GAGCACAAATGAGCTCTGAAGAT TTGCCCAGTTTAATTTTTAACCA IV-4L12
107 F07 IV  C33A12.2    TAAGTAAAACGGGGGAAGTAAGC ATTTTCCACTGAACTCGAATGAA IV-4L14
107 F08 IV  C33A12.3    ATAAAAGCCAAAATGGAATTGGT CTTCTTTTGCAGCTTTCAGTCAT IV-4L16
107 F09 IV  C33A12.4    TTCAGCTGTTTCAGGTACCAAAT TTGGACAACAATGAGTGATCAAG IV-4L18
107 F10 IV  C33A12.5    TCGAGACGTTAGATTGCTTCTTC AGACAAGAACAAATGGTAGTCGG IV-4L20
107 F11 IV  C33A12.6    CGTGCTCATGTTGCGATACT    CTTGCTGCAAATTCCACGTA    IV-4L22
107 F12 IV  C33A12.7    TCATAAATCAGGGGAGAAAGTGA TAGGTACCTTTAAGGCATGCAAA IV-4L24
107 G01 IV  C33A12.8    TTTCTTTTTCACAACTCACCGTT AATTGGAGGCCATGTTTTATTTT IV-4N02
107 G02 IV  C33A12.10   ACGTATCACTTTTGGCTGGC    TTTGATGCTCCACTTTGTGC    IV-4N04
107 G03 IV  C33A12.11   ATTGCACCGGTTTCTATTGC    AGAACCATGCAACGCCTAGT    IV-4N06
107 G04 IV  C33A12.12   GGAAAATTTCGAATGAGCGA    TGTCGAGGCCACTATTTTCC    IV-4N08
107 G05 IV  C33A12.13   GAACCGAAACACAAATGCCT    ATCATTTCCGAATGGTCGAA    IV-4N10
107 G06 IV  C33A12.14   GATACTGTTGAACCGGGGAA    TTACGGGTCTGTTCTCGGTC    IV-4N12
107 G07 IV  C33A12.15   TGTCGACGAAGCATAAAGAATTT CAAAAATGTCGAAATCACACAGA IV-4N14
107 G08 IV  C33A12.16   CTTGATGGAGTTGATTGGCA    AAAACCCCCAGTTGGGATAG    IV-4N16
107 G09 IV  F56H11.1    TGAATGAATGCCAACAAGGA    CTGCATGATTTGGAGCAGAA    IV-4N18
107 G10 IV  F56H11.2    TCCAAACTTCGAAAGATCACAAT CGTTTCATCTCAATCTATTTCCG IV-4N20
107 G11 IV  F56H11.3    AATCTTCCATCGTAGTGCGG    TTCGGATGTTCTCGTTTTCC    IV-4N22
107 G12 IV  F56H11.4    CCGAAGAATCCGAAATTGAA    GGGAAGAAAGTGGGATGGTT    IV-4N24
107 H01 IV  F56H11.6    ACTTTCTTCCCCAGTTTTCTTTG GTTTAAACTCTGGCGGGAATAGT IV-4P02
107 H02 IV  T05A1.1 ACTTACCGCGTTAATGCTAACAA TCTCAGAGGCTCTTGATAATTGC IV-4P04
107 H03 IV  T05A1.2 ATGAGTGATAATGGGAAATGTGG TATGAAAAATGGGAGAGACGAAA IV-4P06
107 H05 IV  T05A1.4 GGAACAGAGAGTGAGCAACTCAT CTTCCATATCACTCCGCTATCAC IV-4P10
107 H06 IV  T05A1.5 CATCATCCCACATATACCGTCTT ACTGTTATTCCCTCTACATCGCA IV-4P12
107 H07 IV  T05A1.6 CAATGTCCACCTGGATACAAAAT ATCTTGATGGGCTATACGAAACA IV-4P14
107 H08 IV  T05A1.7 TCAACTGGGTGATGTGCTGT    CGGGGAAGAATATGTCCTGA    IV-4P16
107 H09 IV  F27C8.1 CAAGAGCGATACATCCAGCA    TTGCAAAGGTTGTTGCTCTG    IV-4P18
107 H10 IV  F27C8.2 TTGGAAAATGCTATAGGCTGAAA TGGAGCAATTAATAAGTCAGGGA IV-4P20
107 H11 IV  F27C8.3 GAGAATCTTGGTAGTTGTGTCGG GATCTTAAAATCCTTCCCCTGTG IV-4P22
107 H12 IV  F27C8.4 TCATGCATTTCTGTGATTTCAAC TGTCCTGCGTAATAATACAGCCT IV-4P24
108 A01 IV  F27C8.5 CCCCAGTCATCTTCGGTTTA    TTTGTAAACAGCCGGAAAGG    IV-5A01
108 A02 IV  F27C8.6 TCCATCAAATCTTGGGCTTC    TTCGCCTCGTCCATTATTTC    IV-5A03
108 A03 IV  W09C2.1 TTCTGCTATTCGGGTTCCTG    ATGGAAGGTGTAGGTGACGC    IV-5A05
108 A04 IV  W09C2.3 CCGGAACCTTCCATAGCATA    ACCGGCTGACCAACTGATAC    IV-5A07
108 A05 IV  W09C2.4 AAGAATGTTTCCGTGTTCCG    TGACAAATGTGTTTGCGGAT    IV-5A09
108 A06 IV  F58G6.1 GAGCATCACTCGATGCAAGA    AGCAACGAATCGTACCAAGG    IV-5A11
108 A07 IV  F58G6.2 GACACGGCTTTCTTGATTGTTAC ATGCAAGTAGAAGTTGCCAGAAG IV-5A13
108 A08 IV  F58G6.3 CAATCCTGACTTGAATGTCTTCC AGAAATATCCGGTGGTATGACCT IV-5A15
108 A09 IV  F58G6.4 AACGATTATGGTTGCCGAAC    TCCGTAATGAATTCACCCGT    IV-5A17
108 A11 IV  F58G6.6 TGGAAGAAAGCAAGAAAGAACAC TCTCCTCCTCTTCTCGCTAAAAT IV-5A21
108 A12 IV  ZK1251.1    ATTTGTATCGTTCTCTCCGTCAA ACAAAGACCAAATCGAATTCTCA IV-5A23
108 B01 IV  ZK1251.2    ACTGCACCAATTCTAGTTCAAGC AAATGTTTTCATTGACGGAGAGA IV-5C01
108 B02 IV  ZK1251.3    ATTCCTCATTGTCAACATGCTCT AAGCGAAATTCTTTTTCAGGATT IV-5C03
108 B03 IV  ZK1251.4    TCCGTCGACTATTTGGAAAGTAA TTCACCACAGTGTTCACAAAATC IV-5C05
108 B04 IV  ZK1251.5    ATATCTTTTTGGCCAGCACTGTA TCTTGCGTGAACTAATAAACCGT IV-5C07
108 B05 IV  ZK1251.6    GTATTGTGTGTGGAGAGAGGGAG TATCAAGCCTTCTTTGGGTTGTA IV-5C09
108 B06 IV  ZK1251.7    CTCATTTTGGAAGCATAGTTTGG GATGGATAATTATGAAGAGGGGC IV-5C11
108 B07 IV  ZK1251.8    AGTCCCATTCACTTTACTGACGA ATGTTGAATTGATCTCCCAAATG IV-5C13
108 B08 IV  ZK1251.9    CGACTGACCGTACTCCACCT    TTGGATGAAGGACACACCAA    IV-5C15
108 B09 IV  K01H12.1    CGGATATCATCATCATTGTTCCT CATATCACGGAAGATTTACTCGC IV-5C17
108 B10 IV  K01H12.2    TGTTTGCAAAATGATGCGAT    TGTCTCCAAGACTGCTGTGG    IV-5C19
108 B11 IV  K01H12.3    GTGGAATGATGCCTCAAGGT    AGATTGCATCTTTGAACGCC    IV-5C21
108 B12 IV  K01H12.4    CCCAATGTGGTGAAATTAACAAT TTGGTAGAAAACTTTGTGCGATT IV-5C23
108 C01 IV  C28D4.1 CGGTGTCTAATTCCCCTCAA    AATCTCGCCTACGTGGAATG    IV-5E01
108 C02 IV  C28D4.2 GCAATCGAGGATTCTTCAGC    TTTTTCCTGGTGGACGATTC    IV-5E03
108 C04 IV  C28D4.4 GATGGACGGCGAGATTTTTA    ATGAAGTCATTTGAAGGCCG    IV-5E07
108 C05 IV  C28D4.5 ATTGACGGTTGGAGGATGAG    TTGAATGCTCTCCAAATCCC    IV-5E09
108 C06 IV  H27C11.1    ACGTTGGAAGTTCACTTTTGTGT ACAATGACGATTCCACTCTGTTT IV-5E11
108 C07 IV  T13F2.1 GCGTATCAATGGCTGACAGA    AGAGCAGGAAACCTCCAACA    IV-5E13
108 C08 IV  T13F2.2 TTCGGAGGAGCAAAATGTAATAA TGATTTACGCAAGAAATGGTTTT IV-5E15
108 C09 IV  T13F2.3 GTGGCTGTGGATTTGTTCCT    TTCTCCTCCCTTGGGTCTTT    IV-5E17
108 C10 IV  T13F2.4 AGATTTCAATGATGTGTGTGCAG TGACATTTGAAACAGCTTGAAGA IV-5E19
108 C11 IV  T13F2.5 TAAACAACTGAAAGCGTCAGGAT TCAGATCCGATAAAGCCTACAAA IV-5E21
108 C12 IV  T13F2.6 ATTCCGTATGAAGCGGTGTC    TGGGCAAATTGAGGAAAATC    IV-5E23
108 D01 IV  T13F2.7 CCTTCCAAATGTTCTCGCAT    AAATGATCGAACTGAACCCG    IV-5G01
108 D02 IV  T13F2.8 CCTTCCTCAATCATCCCAAA    TATCCCTGCCAAACATCCTC    IV-5G03
108 D03 IV  T13F2.9 ATTGCGAATTTCATCGCTCT    AATTGACCAAAAATGCCTCG    IV-5G05
108 D04 IV  T13F2.10    AAACAGTAGAGTTCGTGAGCCTG GCATCTCACAGAAAACGAATAGG IV-5G07
108 D05 IV  T13F2.11    CAACTGTGGTCAAAACAAAACAA ATTTTTAAACCTTCCGTTCAAGC IV-5G09
108 D07 IV  W08D2.1 CGACCAGACGTTCCCAGTAT    AACATTGGCATTTGTGGGTT    IV-5G13
108 D08 IV  W08D2.3 AAGAAGCGAGAAACGAAGAGATT AATCCATCACTCCGTCAAGACTA IV-5G15
108 D09 IV  W08D2.4 ATCACGCTGCCACAAATGTA    GGGGGAAGCTCTTTTCAAAC    IV-5G17
108 D10 IV  W08D2.5 AACGAACCGAATTTCCTGTG    CCACCGAATGACTCTCGAAT    IV-5G19
108 D12 IV  W08D2.7 TGCACAATGATGTCGGAGTT    TCATCGCGTCTCTGAATTTG    IV-5G23
108 E01 IV  W08D2.8 CTCAATGTTGAGAAGCATGATGA GACTCTTTGATCCATTTTTGCAC IV-5I01
108 E02 IV  K07F5.1 GAAGAACGGATAGAGCAAGAACA TCATCTCGATGTCAGGGATAGTT IV-5I03
108 E03 IV  K07F5.2 TTATCTCGATGTCAGGGACAGTT ATTATTCGGACAAAAATGCTTCA IV-5I05
108 E04 IV  K07F5.3 GGGACAAAGATAAGAAGGTTGCT ATATTTCCAATAGTCACGAGGCA IV-5I07
108 E05 IV  K07F5.4 GGAGTTCTCTTGCCACTTCG    CGAAAAATTCGGACAAGGAA    IV-5I09
108 E06 IV  K07F5.5 AGTGTATTCGAGGCGAATTGATA AAGAGCTGGGAAGGATAAACAAC IV-5I11
108 E07 IV  K07F5.6 TCAATTGCCTCGTCTGTCTG    TGGAGCAACTCTACGGGTCT    IV-5I13
108 E08 IV  K07F5.7 CAACTTTCAAAGGCCAATATCAC GTGGTCAACTTTACCTCAAAACG IV-5I15
108 E09 IV  K07F5.8 TGAAATCCTTGTGAATGGCA    AAGGAAAGCCGGAGAAATGT    IV-5I17
108 E10 IV  K07F5.9 AATATGCCGTGCTCCATTAAATA CGAAAACGGTAATCAAATCAGTC IV-5I19
108 E11 IV  K07F5.11    GGGAGTAATACTGGTGCACAATC CGCTGCAGTATTGTATTCTGTTG IV-5I21
108 E12 IV  K07F5.12    TTATTTTCGGAATTTTGGCG    GAAGCCTGAGCAGTTGAACC    IV-5I23
108 F01 IV  K07F5.13    CTGTCGGAGATCCAAAGCTC    TATGACGATTCATTTGGGCA    IV-5K01
108 F02 IV  K07F5.14    ATGGGGATGATCAGGATGAA    TCGATGAGGTGCCCATTTAT    IV-5K03
108 F03 IV  F32B6.1 GACTGAGACCGGAAACCGTA    TACATTTATTTGCACGCCCA    IV-5K05
108 F04 IV  F32B6.2 AAAGGAGCATTCATGCCAAC    ATGCCTATGCGAATTGAACC    IV-5K07
108 F05 IV  F32B6.3 GCCAATTTACCGAGTTTTCTCTT ACTTCAAGAATCATCCAGTCGAA IV-5K09
108 F06 IV  F32B6.4 TTTCGGCCAAGTTTGTATCC    ACCCATAACCTCAGCACAGC    IV-5K11
108 F07 IV  F32B6.5 GCAGACACAGGATTCTGCAA    ATTGCGAATTTCATCGCTCT    IV-5K13
108 F08 IV  F32B6.6 GCATCTCACAGAAAACGAATAGG AGCTCAAGTGAGGCTACATTTTG IV-5K15
108 F09 IV  F32B6.7 GGGTACATTCGAATTTCAAAACA AGCATAAACGGAAAATCGTGTAA IV-5K17
108 F10 IV  F32B6.8 CTTCCCTCATCAGTTTCATCAAC GGATTCCAAGTGCTTGTGTAGAG IV-5K19
108 F11 IV  F32B6.9 TGATTTGATTGATGATGACGAAG GTGCCAAAGTTTATCGTCGTTAC IV-5K21
108 F12 IV  F32B6.10    AAGGCTCTACACTCAAGCAGATG GGGGAAAGAAGAAGCAATTAAAA IV-5K23
108 G01 IV  F32B6.11    GTGTATGTGGCATATCCCTTGTT CATTGTCCGAACTTGTTCTCTCT IV-5M01
108 G02 IV  F25H8.1 GGCTTTCTGGCTTTTCTTCC    TCATTGGAGCATGTTTGCAT    IV-5M03
108 G03 IV  F25H8.2 TCGATCAACTTTTGGATCTTGTT CATATGGATTTGATTCGGTTGAT IV-5M05
108 G04 IV  F25H8.3 TCTTTCAAAATCGTCCGACC    CATGCTCAATGTTTGGATGC    IV-5M07
108 G05 IV  F25H8.5 CGGAAACTTTGTTGGATGCT    CGTGAACGTTGTCGTAATCG    IV-5M09
108 G07 IV  T13H10.1    GCAACTTTCATTCCCGGATA    AGTGGGAGAGCCAAGGAAAT    IV-5M13
108 G08 IV  C47E12.1    TCAAGGATCCGAAGTTGGTC    CGCGTGTATCTCTACCGTGA    IV-5M15
108 G09 IV  C47E12.2    TCCTTTTACCATCATTCGCC    GAGTGCATCCCTTTCTCCAG    IV-5M17
108 G10 IV  C47E12.3    AGTAAAGGGCATGATGGCAC    CAGTAGGGAAAAACCGCTTG    IV-5M19
108 G11 IV  C47E12.4    CTTCTGTTTATCGAGTTCGTGCT GCCAACAAGGACAAGAGAGTTTA IV-5M21
108 G12 IV  C47E12.5    ACGGTGATTTTGAGTGGCTC    AGTTGTTTCTTTGCCTGCGT    IV-5M23
108 H01 IV  C47E12.6    ACAGTAGGACCACGTGGAGG    GATCAGGCATATCCGCAGTT    IV-5O01
108 H02 IV  C47E12.7    GAGCTCGCTTTTTGATTTGG    GTTTTCGCTCAGAAACTCGC    IV-5O03
108 H03 IV  C47E12.8    TTGAATTTCAGGGAAATCGC    AGCCGAAAAAGCTCCAAAAT    IV-5O05
108 H04 IV  C47E12.9    TGGAACGAACTCTGAAAAGGTAA TGTGAAAACGCATAAAAATGTTG IV-5O07
108 H05 IV  C47E12.10   CACTTCTTTTGGTTGGAATCTTG CCTTTACAAATGCAATTTTCCTG IV-5O09
108 H06 IV  C47E12.11   GGAGGATGACGTGGAAGAGA    GCACGAATCACTGTCTCGAA    IV-5O11
108 H07 IV  F44D12.1    AAGACGGTGGAGATCGATTG    AAGTTAAGTGCGGCACGAAT    IV-5O13
108 H08 IV  F44D12.2    AATTAGAAAAACGATGGGAATGG TCTAACAGCAATAGTACCGGGAA IV-5O15
108 H10 IV  F44D12.4    TGAGTTGCCAAAGTGTCTCG    CATTTCATGAGCCCGAGTCT    IV-5O19
108 H11 IV  F44D12.5    TCAAGTAATTCCGAACCTTTGAA CAGCTTGTATCACACAGCATAGC IV-5O21
108 H12 IV  F44D12.6    TGGACATTCCTGTCTGTTTTTCT ATTTTTCCCCTTTCTTCACTTTG IV-5O23
109 A01 IV  F44D12.7    AATCAAAAGTTCACGAAAGGTCA AACTTTTCCAAGTTAGCTACGGG IV-5A02
109 A02 IV  F44D12.8    AAACATGTGCAGTCGCAGAG    CTCCCAACCCAATATCCCTT    IV-5A04
109 A03 IV  F44D12.9    CAAATGAAAATCCAATCCAAAAA AATGTCGTTAGGCGATACTGAAA IV-5A06
109 A04 IV  F44D12.10   ACTCAATATTCAGGTGAAAGCCA TGATGAACACACCATCTCGTTAG IV-5A08
109 A05 IV  F44D12.11   AGTTTGGAATCCCCTGATCC    TCCAGAGCCCTAGTTCCTGA    IV-5A10
109 A06 IV  T04B2.1 GAAGAATTAAAATGGCATTGCAG ATGGAAACAAAAGTTGATGCAGT IV-5A12
109 A07 IV  T04B2.2 AATCAATCATCACAAATGGGAAC CTCCGAATGTCCAGATATCAGTC IV-5A14
109 A08 IV  T04B2.3 TCCATTTTCACCACAGTCCA    ATCCGGCTCCTTTACGAGAT    IV-5A16
109 A09 IV  T04B2.4 ACGAGCCATAAGAAGAGCCA    ATGTTGAGCAACCATCACCA    IV-5A18
109 A10 IV  T04B2.5 GCTGGTTCACCAGTTCCAAT    CAACTTCAAATCCTGGGCAT    IV-5A20
109 A11 IV  T04B2.6 TGTTACAGTGACATTTTCGCAAC AAGACTGTTTTCATCACTGGAGC IV-5A22
109 A12 IV  W01B6.1 TAACGGCTGATGACCATGAA    CTAAATCCGTTGGCAATGCT    IV-5A24
109 B01 IV  W01B6.2 ATTCTCCCAAGATGCAGGTG    AAACCACGTCAACTTTTCCG    IV-5C02
109 B02 IV  W01B6.3 CACTTTGGCGGTTTCAGAAT    GAAACTGCCACGGTTGACTT    IV-5C04
109 B03 IV  W01B6.4 TTTCGAATTGATTTGATCGAGTT CCGCGAAGAGAATATAAAAGGTT IV-5C06
109 B04 IV  W01B6.5 TTACTCCAATTCCGCTGTCC    AGAAGCATCATTTCATCCCG    IV-5C08
109 B05 IV  W01B6.6 TCAGTTCAACCGAACCATGA    TCGGAGGAGCCAACTGTACT    IV-5C10
109 B06 IV  W01B6.7 AATGAAAAATGCTTTATTTGGCA TTGGAATTCTTCAGTCCATCACT IV-5C12
109 B07 IV  W01B6.8 CACTGGCTTATTTAACAACTCGG ACAACTCATCATTGGAACGACTT IV-5C14
109 B08 IV  W01B6.9 CGAAAAGCAGCAGAAAATCC    AACGGCGCTTAATTCGAGTA    IV-5C16
109 B09 IV  C04G2.1 TTCCAGCAAAGCGAACTTTAATA CTTTTGACATTCTCCAATGCTTC IV-5C18
109 B10 IV  C04G2.2 GAACAAACGACCCAAGGAGA    ATCGGACAATTGGAACAAGC    IV-5C20
109 B11 IV  C04G2.4 CTGGGACAGTGATAAGAAGGTTG GAGAGATGGGCTGGGTTAGTAGT IV-5C22
109 B12 IV  C04G2.5 TACTCAACTACGCACCAGAAACA CAAAAATGGATAATCACGACGAT IV-5C24
109 C01 IV  C04G2.6 TGATGACGAGAACGATGAGC    AACGTCAATGCTCCATTTCC    IV-5E02
109 C02 IV  C04G2.7 CGAGGAGAAAAATCACAGAGAAA ACTTTGATAACCCCATTAGCCAT IV-5E04
109 C03 IV  C04G2.8 GGTAAGGAATCGGTGGTAAAAAC TTTGCGAGAAAAATGAAACAAAT IV-5E06
109 C04 IV  C04G2.9 TTCCCAATCTTCTGGAAACG    AACCGACGACCACTACCAAC    IV-5E08
109 C05 IV  C04G2.10    GTATTCACCTCGCTGTGGGT    AAGCTTTCGACTACGCCTCA    IV-5E10
109 C06 IV  C04G2.11    TAGTTTTGAAATCCCCGCAG    CGGGGTTCGAAATTGATATG    IV-5E12
109 C07 IV  C04G6.1 GACGGTCGGTTTTGGTTAGA    ATGAAACCATGTTTCTCGCC    IV-5E14
109 C08 IV  C04G6.2 GTTGTTGACTTTGGTGTGTTCAA TTTCGGTTCCTGCTACAAAATAA IV-5E16
109 C09 IV  C04G6.3 ACAGCTTGCTGCATGTGAAC    AGCAACCTTAATGTCCGACG    IV-5E18
109 C10 IV  C04G6.4 ATTCGTTTTTCGTGCAGCTT    TCTTTCGAAATGCCAAAACC    IV-5E20
109 C11 IV  C04G6.5 AAATCTGACCATTACTCTTGGCA TGAGCATGTTATCATTGGATCAG IV-5E22
109 C12 IV  C04G6.6 AAGACCAGAATTGACGAAGAACA GCCGATCAGAGAAGTCTGACTAA IV-5E24
109 D01 IV  C04G6.7 AAAATTAGCACTTGTCTCCTCCC ATGGGTCAAAGGAATTTGTAGGT IV-5G02
109 D02 IV  C04H5.1 AAATCCTGTACTGATTCGTTCCA ATAAACGGCGAAATGATGATCTA IV-5G04
109 D03 IV  C04H5.2 TCCTGGATTTCATTTCATTTTTG TTTTAATCGTTCTCCGGTAGTGA IV-5G06
109 D04 IV  C04H5.3 ACTGCATGCGTATTAACCCC    TTAACCCGCCAAAATTGTTC    IV-5G08
109 D05 IV  C04H5.4 CAGTCCTGAGAATAAATAGGGGG CTGAACTTTTGCTTCTCTGGAAA IV-5G10
109 D07 IV  C04H5.6 CAGTCTTCTCCGATGTGCAA    CTTGGCAGCACGAATTAACA    IV-5G14
109 D08 IV  K08F4.1 TAAGCATGCGTGAAAACTCG    TTTACAAGCCCCCGTTATTG    IV-5G16
109 D09 IV  K08F4.2 TCCTTTTCCACAGATTTCGG    AAACGGAGGATGCAGAGAAA    IV-5G18
109 D10 IV  K08F4.3 CACGTATTTCCAGCTTAATTTGC CAACCGGGTGCTAATAAATACAA IV-5G20
109 D11 IV  K08F4.4 GCACAAGCTCTTGCCATGTA    GTAGACATGGGGAGCCTGAA    IV-5G22
109 D12 IV  K08F4.5 CCCTATTAATCGGTCAATGTCAA AAAAATTACAACAGTCGAACGGA IV-5G24
109 E01 IV  K08F4.6 GAAAAACAAAATGAAATGGCTCA GTGAATGGGTTGGTCGATATAAA IV-5I02
109 E02 IV  K08F4.7 CATTTGGTTTATCGCTTTGCTAC TTAGATAGTTCGGTGCTTCAGGA IV-5I04
109 E03 IV  K08F4.8 CAAAACTTGTTCGCTTGAGTCTT TGTACTCGATTGGGAGGTTCTTA IV-5I06
109 E04 IV  K08F4.9 CCTTGGTTGCAAAAGACGTT    GGTGACCACCATTCAGCTTT    IV-5I08
109 E05 IV  K08F4.11    TGTTATCATGCGGAGTATCACTG TTCGAATTTCTTCATTTCATCGT IV-5I10
109 E07 IV  T14G10.2    TTGTGTTGCAGGTGTTGGTT    ATTACGATTGCGTGTCGTGA    IV-5I14
109 E08 IV  T14G10.3    TTCTGAATCCATTCTGTCCAACT TCGTACTTGAAGTCTTCCTGGAG IV-5I16
109 E09 IV  T14G10.4    TTTAACGTTGTCGTGAAATTGTG TGATTCCAATGTAGAATTTTGGG IV-5I18
109 E10 IV  T14G10.5    CTCCAAAAACTCCAAACCCA    GGAACACTGTGTGTTGCGTC    IV-5I20
109 E11 IV  T14G10.6    CCATGTGGCTTTCTGGTTTT    AGGAAGCTGAAGGGGAACAT    IV-5I22
109 E12 IV  T14G10.7    GCTCAACAGTTTCCAGCACA    AAATGCCACAGGAAAGTTCG    IV-5I24
109 F01 IV  T14G10.8    CCAATGCGGTTAAATGTCAGTAT TGTCTTTGCAAAATGAACAAATG IV-5K02
109 F02 IV  K04D7.1 CGTTCGCTCACTGGACATAA    CTTGAGACCAGGCCAAAGAG    IV-5K04
109 F03 IV  K04D7.2 ACGAAATTAGAATCGCCACG    TATTACGACCATTTCGGGGA    IV-5K06
109 F04 IV  K04D7.3 GGGATTTGAAGGAGCTTTCC    AGCTAGATGGTCAGCGAAGC    IV-5K08
109 F05 IV  K04D7.4 TCGATTTGACACCATTTGGA    GGTTTAAATGGGCAGGTGAA    IV-5K10
109 F06 IV  K04D7.5 AAATTGTTGCGGAACACACA    TTATCTTCCGTCCATCAGGC    IV-5K12
109 F07 IV  T17B5.1 AAAAACCGGGAGTTTGCTTT    ACAAGGGTGCATCTGGAAAC    IV-5K14
109 F08 IV  C24F3.1 AAACTTGAGCTCAGAAAATGCAG TTGCTCCTCAATACAACGGTACT IV-5K16
109 F09 IV  C24F3.2 TTTGGCACAACTTCCAATGA    CATCATGTTGCGATTTCCAC    IV-5K18
109 F10 IV  C24F3.3 CTCCTTTTTCATTTTGTGTGCTC TTCATCAATCATCCTTGTGTACG IV-5K20
109 F11 IV  C24F3.4 AATTGCTCCGCACACTTTCT    TGGACTTCCAACTCGATTCC    IV-5K22
109 F12 IV  C24F3.5 AGAAATGGGGTGGAATACAGTTT CATGTTTCTATCTCTTCATGCCC IV-5K24
109 G01 IV  F01G10.1    AGGGAAAAGGAATCGAAGGA    CGTCCTCCAACTTTCAGAGC    IV-5M02
109 G02 IV  F01G10.2    TTTCTTATAGCCGGAGCGAA    GGCTGTAATTGGAGGTGGAA    IV-5M04
109 G03 IV  F01G10.3    TCATCGGTCCACCACTATGA    GCTCGGGAAAAATCATTCAA    IV-5M06
109 G04 IV  F01G10.4    TTAAGAATTTTCTCGACCGATCA CCTTTCACTTGACTTGATTCACC IV-5M08
109 G05 IV  F01G10.5    GGAATTCGATCGTTGCATTT    TCGAAATTTGACGGAAAAGG    IV-5M10
109 G06 IV  F01G10.6    TCGTGAGCTGAACAAAATGC    TATTGCCAGACCACACGAAA    IV-5M12
109 G07 IV  F01G10.7    AAATATTACAGATGCGCGGTCTA TTGGGACACTCACAAGGAACTAT IV-5M14
109 G08 IV  F01G10.8    ACCGGCAAGCATCAATAATC    CGAAAGAATCCAGGTGGCTA    IV-5M16
109 G09 IV  F01G10.9    CTGTTGTAACACCAACAACAGGA TCGACGCAGAAAGAAGAAACTAC IV-5M18
109 G10 IV  F01G10.10   GCTGTCAACCCGGGTATCTA    CATTTGGTGGAAAGAAGGGA    IV-5M20
109 G11 IV  Y43C5A.1    AGACGAATTGCAACATAGGAAAA ACAGAAATCGCCAGTTTATCAGA IV-5M22
109 G12 IV  Y43C5A.2    TGGTTGTGCTTGATGCAAAT    GCTCCCAAATCGGTATCTGA    IV-5M24
109 H01 IV  Y43C5A.3    AACGAGATGAAGAGACGAGACTG CAGATACATCCTGTCAAATGCAA IV-5O02
109 H02 IV  Y43C5A.4    ACCGATATTTTTAATTTTGGCGT TTTATTCTCTTCATTCGGTTCCA IV-5O04
109 H03 IV  Y43C5A.5    TCCGATTTTCTTTCGTGGAG    ACATTTTCGTCTCAATCGGC    IV-5O06
109 H04 IV  Y43C5A.6    AGCCATCAAATGTTCTGAGTTGT TTAAAAATGCCGATTTTAGGGAT IV-5O08
109 H06 IV  R09E10.2    ATCATCCAAGTTTGATTCACAGC TTTTACTTCTCAGGTGGAATGGA IV-5O12
109 H07 IV  R09E10.3    TGTTCCACCAACACCAGAAA    CTGGATCTGGGACAACGATT    IV-5O14
109 H09 IV  R09E10.5    GCTGCTTATCGCCACTTTTC    CCTCCCGTTTTATTTGAGCA    IV-5O18
109 H11 IV  R09E10.7    TTCCAGCATCTGCTTCATTG    ATAGCCGACGCAATCAATTC    IV-5O22
109 H12 IV  K11E8.1 TATCTGCAAAGCGAACATACCTT TCGTATTCTGAAAATGGGAAAGA IV-5O24
110 A01 IV  Y43C5B.1    AAATAAGCGGTTTTATTGGGAAA TTCAGCTCTCTTCACTTTCAACC IV-5B01
110 A02 IV  Y43C5B.2    TGTTCGAAAACACAACGAGG    AAAATGGCAAGTGGAACAGC    IV-5B03
110 A03 IV  Y43C5B.3    GGTGTTGCTCACTGCTCAAA    ACTATTGCGGGCACAATTTC    IV-5B05
110 A04 IV  R11A8.1 CGAGATCTGCGTTTTCACAA    CAGTCTGGTGTGACGACGTT    IV-5B07
110 A06 IV  R11A8.3 TGATTCTTGCGGGTAACACA    TGCATGGACAACTCTTCGTC    IV-5B11
110 A07 IV  R11A8.4 TGTTCTGCAGCTTTACATTTTCA ATATGATGGGAATGAGATTCGTG IV-5B13
110 A08 IV  R11A8.5 GCCACCATTCAGCAATTTTT    TGCTTCTTTGGCTGGATTCT    IV-5B15
110 A09 IV  R11A8.6 GTCGGATGGAGCAAAAATGT    TTGCATCCGAGTGAGTTTTG    IV-5B17
110 A10 IV  R11A8.7 ACTACGAAAAGAATCCGCCA    ATGAAGACCCATTTGCTTGC    IV-5B19
110 A11 IV  R10H10.1    TTCTTCGCTTTATGTTGATCCAT ACGTGATTCGATGATTTCAGAGT IV-5B21
110 A12 IV  R10H10.2    GCTTCTGCTGGGACACTTTC    TCCAATAAATACAAGCCCGC    IV-5B23
110 B01 IV  R10H10.3    ACGCGGGCTTGTATTTATTG    TTGACCCCGTGATTTTCTTC    IV-5D01
110 B02 IV  R10H10.4    TACTTTGTTCCGCTGTTCAGATT ACCCTCCCTCTGTAGCTGTATTC IV-5D03
110 B03 IV  R10H10.5    AAGGATGGATTCTCACAACAAGA TTCTGTTTGATTCTGTTGTCCCT IV-5D05
110 B04 IV  R10H10.6    TGTTGGAAAAAGAAACGAAAGAA TCGATTAAAATTCGGTAACAACG IV-5D07
110 B05 IV  R10H10.7    ATCGTCCTTCGCAGTTGTTT    TCATTCGACAATGTCCTCCA    IV-5D09
110 B06 IV  F13B12.1    GGAACACGTGCTCTTGGAAT    CAGGAAACTTCAAAGCCTGC    IV-5D11
110 B07 IV  F13B12.2    ATTCGGAGCAATTGATGGTC    TGCCCCACTTTATCTCCAAC    IV-5D13
110 B08 IV  F13B12.3    GAAAGCAGAGAATCAAGAAACGA AAACCAACGCAGAACATAGTGAT IV-5D15
110 B09 IV  F13B12.4    TTCCAACATTCCATTCCCAT    CTCATTCAACTCAACGCCAA    IV-5D17
110 B10 IV  F01D4.1 CCGGGGTAGGTTTTCAAAGT    GTTGTATTCGTGATGCACCG    IV-5D19
110 B11 IV  F01D4.2 TTGGAGGAATCTCATCTGGG    AAGGATGCAAATGCGAAACT    IV-5D21
110 B12 IV  F01D4.3 ATCACTTGCTCCGGTTTCAC    TGGATCATGCTCAAATGGAA    IV-5D23
110 C02 IV  F01D4.5 ATTGGTAAAACATGGGACATGAG AATTCCAGAAAACCAATGGAAAT IV-5F03
110 C03 IV  F01D4.6 TCGCCACGAAAGAAGGTAGT    GCCGAAAAGTGTTTTTGGAA    IV-5F05
110 C04 IV  F01D4.7 TAATCAGTTGGGCACACGAA    TTTCCTGGAGCATTTCATCC    IV-5F07
110 C05 IV  F01D4.8 CATTCCATTGCAGTCACACC    GGCTGGGAATTCAAGTTTCA    IV-5F09
110 C06 IV  C02F4.1 CGGCCGTTACATTCAAGTTT    ATCTGGACGAGGTGGAAGTG    IV-5F11
110 C07 IV  C02F4.2 AATCACAGCATGCAGCGTAG    TTTTCAGCCGTTCAATTTCC    IV-5F13
110 C08 IV  C02F4.3 CCCCTTTGTTTCAAGATTTTTCT TCGGTACGTCATGTTTTCTTTTT IV-5F15
110 C10 IV  C02F4.5 TCATCCTCAAGGCATAGACATTT CACCGATTCTTGAGAAAATTACG IV-5F19
110 C11 IV  T07G12.1    CCTTTCCTTCCGACCTAGAATAA AAAAAGTAATGGTCCACAGGGTT IV-5F21
110 C12 IV  T07G12.2    CCGATGCCAGCATTCTCTAT    TGGAATTGTGCATCCAAGAA    IV-5F23
110 D01 IV  T07G12.3    TTTTCTGGAATTGGTGGCTC    CGGAATCTTTTGGGAATTGA    IV-5H01
110 D02 IV  T07G12.4    TACAACAAATGCCCGATTCA    TGGTTTTCAACAGATGCTCG    IV-5H03
110 D03 IV  T07G12.5    TCCGAGTCCTTGTGGAAATC    TTTGCAGCAATGATCGAAAG    IV-5H05
110 D04 IV  T07G12.6    AAGGACTTCAGCAGCAAGGA    TTGTGTGTCGAATTGGGAAA    IV-5H07
110 D05 IV  T07G12.7    CAAATGGTTTGGTATCTCGTCAT CTCAGAAAATTTTGAAAACACGC IV-5H09
110 D06 IV  T07G12.8    CTTTCTGTGCAGAGTACGGAGAT TATACTAAATCAACGGTCGGCAT IV-5H11
110 D07 IV  T07G12.9    AAGGACTTCAGCAGCAAGGA    AGAAAGCTCGCAACGAAAAA    IV-5H13
110 D08 IV  T07G12.10   ATAACGGTTGTCGATACGCC    TGAGCCGTCTTCTTTTCGTT    IV-5H15
110 D09 IV  T07G12.11   ACTCCGAACCAATTCCACTG    CCCAATATTTCCGATGATGG    IV-5H17
110 D10 IV  T07G12.12   TTTTTGTTGCTCGACCCTATTTA CTTGCAAAGTTCTAGATGCCACT IV-5H19
110 D11 IV  C43F9.4 ATAACATGCGGAAAGCAAGC    CCTACAACGCGACCTTTCAT    IV-5H21
110 D12 IV  C43F9.5 TAATTGAGAGACGGATATTCGGA ACAATGCAACATTTTCCCATAAC IV-5H23
110 E01 IV  C43F9.6 GAAATTTCAGTGTTGGCCGT    TTCCACTTGCGAGTGTGTTC    IV-5J01
110 E04 IV  R09H10.2    AAATCCACAATGCGGAAAAG    CGTTGGCGTAGTTGAGCATA    IV-5J07
110 E05 IV  R09H10.3    AAAAAGCGAGATTGGAAAATAGC GGGTACAGGTGTAATTTGGCATA IV-5J09
110 E07 IV  R09H10.5    GGAAGGACTCGTCCATTTGA    TCAGTGCTGGATCTTCGTTG    IV-5J13
110 E08 IV  F56C4.1 TGAACTTTCGATTCTTGGACAAT TTGGGCTCTTGATGATAGTGTTT IV-5J15
110 E09 IV  F56C4.2 TGGGTCAAAGTAAAAACGAAAAA TTCATTGGAGTATGCTCATGTTG IV-5J17
110 E10 IV  K08C7.1 CGCTTTGCCTGTGTCTCATA    TGCTGCTTTCAATCGTTTTG    IV-5J19
110 E11 IV  K08C7.2 TCCGAGGACAGGATGATTTC    TGTAAGCTAGCCATGGGTCC    IV-5J21
110 E12 IV  K08C7.3 ATGGTCCAATTCGAAGATGC    TGCGATCCTTCTTTAATCCG    IV-5J23
110 F01 IV  K08C7.4 TGGATGAGAAGGTACCGAAGATA GACACTGGGTACGTAGACACCTC IV-5L01
110 F02 IV  K08C7.5 TCTTATGCAGAGCATCACGG    TACGAACTGCTGAGCCATTG    IV-5L03
110 F03 IV  K08C7.6 CGGTAAAACGACCATTCTCAATA CTAGGAAAACTTATGCAGCCAGA IV-5L05
110 F04 IV  K08C7.7 TTGGAACTACCACCTGAACTCAT ATGTCTTCAACTCGATGATCGTT IV-5L07
110 F05 IV  R102.1  GAAGCTCCATATTTTGACAAACG CCATGAAAAACTAGGCTCTTGAA IV-5L09
110 F06 IV  R102.2  AAACTTCAGTAGCTGCAAACAGG CTTTCTTGTTGTAGAAGTGCGGT IV-5L11
110 F07 IV  R102.3  TCAATCAGGCATTGAGTCCA    TCAAAAATGGAAGGAGGACG    IV-5L13
110 F08 IV  R102.4  CGCTCACATTCCAGTTGAGA    CAACGTGGCGAGGAGATAAT    IV-5L15
110 F09 IV  R102.5  TGAGCCAATTGCACTTTGAG    CCCAAGCTAACCCAATGAGA    IV-5L17
110 F10 IV  R102.6  GGAACGTATTGAGGAACCATACA CATAAAATATCGAGCGTTTTTCG IV-5L19
110 F11 IV  R102.7  ATTTCGTGGAAATCAGCCAG    CAGCCAGAACGCAGTATTCA    IV-5L21
110 G01 IV  ZC168.2 AATTCTCTTCCTGAACACCTTCC GAAAGTGAGCAAGAATCCTGAGA IV-5N01
110 G02 IV  ZC168.3 GTTACTGACACGAGCCCCAT    GGATGGATCGCTGAAATTGT    IV-5N03
110 G03 IV  ZC168.4 AGTCGAAACTGCGCAAAAGT    AAGGAGCCGAAAAGAAAAGC    IV-5N05
110 G05 IV  ZC168.6 AACACCAGCGGAAAATACAATAA AAACTGGGAAGCCTTTCATAGAC IV-5N09
110 G07 IV  T25B9.2 TTTCAAATCCACGTTTCTTGTCT GGACAGTTTGATGATTTACTCGC IV-5N13
110 G09 IV  T25B9.4 CGAAAGTCCAAAATCGGAAA    GTTCCCAGCGCTTAGTGTTC    IV-5N17
110 G10 IV  T25B9.5 TTCCAGATTTCAGCGATTCC    AGCAACTCATTGGTTGGGAC    IV-5N19
110 G11 IV  T25B9.6 CCAACAGCAATTTGGGAAGT    AGAATGATGAGATGCCTGGG    IV-5N21
110 G12 IV  T25B9.7 TATATCGGTGGAATGGGGAA    TGACCCGAAAATTGAAAAGG    IV-5N23
110 H01 IV  T25B9.8 ATTGACTGAACGGACCTTGG    TGCCTTTGTCTCGTTGTCTG    IV-5P01
110 H03 IV  T25B9.10    ATTCCGAGTTTCTTACCCAAAAG CTCAGAAAATAGCAGAACGAGGA IV-5P05
110 H04 IV  C06G8.1 GGATGAATCCTCATCTCCGA    TGCCATCTAGCACAATCGAC    IV-5P07
110 H05 IV  C06G8.2 GACGACTTTTTCCAACCCAA    ACATTTGTACGGCCTGGAAG    IV-5P09
110 H06 IV  C06G8.3 TAATGTGCTTGTGGGCTCTATTT TAAAGCTATAGCCGGAAAGGTTC IV-5P11
110 H07 IV  C06G8.4 GCCTTTGGTGTTGAATGCTT    ATTCCCAGTTGGAAAGGTCC    IV-5P13
110 H08 IV  R13.1   AAACAAGCGACAAGCTGGAT    GAATCATCCGGGAGTGAAGA    IV-5P15
110 H09 IV  R13.2   GACACCGGATAATCATAACCTGA TCCGAAGTTTGGCAATTATTCTA IV-5P17
110 H10 IV  R13.3   TGCGTCTTTCTCCACTGATG    ATATGGGACAATTTCGCTGC    IV-5P19
110 H11 IV  R13.4   ATTTTCAGGGTCCTTAACTCAGC ATCACATGCTTTCGGAACTAAAA IV-5P21
110 H12 IV  T11G6.1 CGAGCTTCGTGATGTTCTGA    ACCAAAAGAAACACCGCAAC    IV-5P23
111 A01 IV  T11G6.2 GACACGCATAAGCCAGTGAA    TGGTCATATGCCGAGAATCA    IV-5B02
111 A04 IV  T11G6.5 ATTTTGATGCTCACCTTGGG    TATCAAAAACGGTGCCATCA    IV-5B08
111 A05 IV  T11G6.7 ACTAGCAGGTTGATGGTTCAAAA AAGTTCCAACCGTGAGTTTAACA IV-5B10
111 A07 IV  F13E9.1 TTATTTCTCCCATTCAGCCG    CAGGACGTCTTCCATCCAAT    IV-5B14
111 A09 IV  F13E9.3 TCAGAGAAAATGGTGCAACG    CAGAACTTTGTGGGCAACCT    IV-5B18
111 A10 IV  F13E9.4 TTCTTGCATATTGCGTTTGC    GGTTTCCTCACAAACATGGG    IV-5B20
111 A11 IV  F13E9.5 TGCGTTCGGTCTCATTGTAG    ACGTTGCAATTCGTTTGACA    IV-5B22
111 A12 IV  F13E9.6 GAATGAGTCGAATGAGGGGA    CGCCTTTCTTGGTACATCGT    IV-5B24
111 B01 IV  F13E9.7 AAAATTCAGAAACCTTCAAAGCC ATAAGAAAGACCCGTCAGAGTCC IV-5D02
111 B03 IV  F13E9.9 AACCAAATCCATCCCAATCA    CAATTTCAAAAATTCCCCGA    IV-5D06
111 B04 IV  F13E9.10    TTAGCTCCCTACGACTCTTCCTT TTCTCGTTCTTCTTCAAAAATGC IV-5D08
111 B05 IV  ZK596.1 CCTATAAAAGGCGAATTGGAAGT CGTTTTCTCCATCAAGCAATTAG IV-5D10
111 B07 IV  ZK596.3 CATCAAAATTCTGGGTTCCATTA CCGTACCGTTCAATGTGTTTATT IV-5D14
111 B08 IV  ZK593.1 ATTTCAAATTTTGGCAACCG    TGCTCTAGTCGGACGAGGTT    IV-5D16
111 B09 IV  ZK593.2 CTTCTTTAAAAATGCATCTCCCC CCTTTTTAATTCAGCTCAACCCT IV-5D18
111 B10 IV  ZK593.3 TTATCGCACCAACTGATCTTTTT ATACACACCAGAGAATGTTGGCT IV-5D20
111 B11 IV  ZK593.4 GGTCACCGTTCCTTGAAAAA    ATCGGTGGAAACACTCGAAG    IV-5D22
111 B12 IV  ZK593.5 TCATCGAATCCTTCCGTTTC    GAAGCACGCGGTTGATTTAT    IV-5D24
111 C01 IV  ZK593.6 GGAAAATGCGGAGAAAGAGTTAT AAGAGACATACAGCAAAAGAGCG IV-5F02
111 C02 IV  ZK593.7 CGGAATTATTTCAGACTCACCAC GGAGAATGTTCATTCACAAGGAG IV-5F04
111 C03 IV  ZK593.8 GCAATTGATAGAAAAATGCTTCG ACTAGTAGGCGGAAGAATTGGAC IV-5F06
111 C04 IV  ZK593.9 GGAAAGATTTGGATGCAGGA    TCGGAGATGGCTTCAACTCT    IV-5F08
111 C05 IV  Y69E1A.1    ATCATCAATTGGAGAAGACGAAA TTATTTTCGTAACGTGCACACAG IV-5F10
111 C06 IV  Y69E1A.2    GAGTCCTGTGAAATGTATGGGAG AAAATTTGCTTTCCTCCAGAAAC IV-5F12
111 C07 IV  Y69E1A.3    AAGCTGAGAAGTTGTTGACTTGG TCAATGAGAACCATCAGTTCCTT IV-5F14
111 C08 IV  Y69E1A.4    GGACAGTTTGATGATTTACTCGC AGATCGAACTCATTCGAAGTTTG IV-5F16
111 C09 IV  Y69E1A.5    ATGGCTATTTCGTTGTTATCCAA ATAATGGTAGGTAGGCATTCGGT IV-5F18
111 C10 IV  Y69E1A.6    ATGAAGTGCAAAAAGAAGCAAAG TTGATATAATTGGGTGTTGAGCC IV-5F20
111 C11 IV  Y69E1A.7    ACAAGCCATCCAATTTTACAAAG TTCACAAGGAAAGAACAACGAAT IV-5F22
111 C12 IV  Y69E1A.8    CCACGTCAATTCTTTGAGAAATC CGATGTTGAATTTCTTTCCACTC IV-5F24
111 D01 IV  Y43E12A.1   AGACGCTTCACCTGACGATT    AAGTGCAATGGGGAAACAAG    IV-5H02
111 D03 IV  Y43E12A.3   GGTATCAATGGTGGAGGCAC    TTTCCAATTCGAAGAATCCG    IV-5H06
111 D04 IV  F13H10.1    ACATATCGGTGAGTCTCCAAGAA CGATTTCCAAAGTAATGAGTTGC IV-5H08
111 D05 IV  F13H10.2    TATGGTTTTCGAGTTTCCCG    TCAATTTCCAGCGAATTTCC    IV-5H10
111 D06 IV  F13H10.3    CCAATGAAAACATAGCAAAAAGC GGAATACAATGATGGGAACTTCA IV-5H12
111 D07 IV  F13H10.4    GAGTGGTTGGTTTGGAGCAT    TCCTAGTGTTGTGTCAGCGG    IV-5H14
111 D08 IV  F13H10.5    AATGGAGCAAGGCAAAACTG    AACTACGTAACAGGGCGTGG    IV-5H16
111 D09 IV  F36H1.1 TGTTTAAAACTCGGGAAAACTCA CAAGGTGATAAAGAGAAGCGAGA IV-5H18
111 D10 IV  F36H1.2 GAACAATGGCCTTCACGAAT    TGACATCACCTTCGGTTTCA    IV-5H20
111 D11 IV  F36H1.3 CACGGAATCAACAACACCTG    CCCGCTGGAGGTGTATAAAA    IV-5H22
111 D12 IV  F36H1.4 CTGAACGACTTCTAGTCGCATTT GAATATGTCGTCCATTTGGTGTT IV-5H24
111 E01 IV  F36H1.5 GACTTCAACATCGTCATCATCAA CAAAAGCTTTAAAGAAATCGCAA IV-5J02
111 E02 IV  F36H1.6 TTTTGAACCCAATTCTCTACGAA ATTGAACTTGATCTCCTCCACAA IV-5J04
111 E03 IV  Y5F2A.1 TGCATCGTTTTTGTAATTTCCTT AAACTTCCGTATGTGCACAAGAT IV-5J06
111 E04 IV  Y5F2A.2 AACTGGAGGGTTTCTTCGTTTAG TCTCACAAGTCCCATTCTTGATT IV-5J08
111 E05 IV  Y5F2A.3 AATTCTATTTGGAAACGAGCACA TTTCCTTTGGTCACCTTATCTGA IV-5J10
111 E06 IV  Y5F2A.4 CTAGCCATTTTCGCATTTCC    CTTCCACCCAACAAAATGCT    IV-5J12
111 E07 IV  M7.1    GGTGTGGATTGAATAAGATGGAA TATTTCATGCGAAAATCCTCACT IV-5J14
111 E08 IV  M7.2    TGGATGTTGCTACGATGCTC    TGCGACATGGAAAACGTAAA    IV-5J16
111 E10 IV  M7.4    TCATGGAGAGCTAATGGAACTGT ATTTGGAAAAAGAAATCGAAAGC IV-5J20
111 E11 IV  M7.5    CAGAAAACCGCGAATTTGAT    GCGTATTCTGCAGGATGGAT    IV-5J22
111 E12 IV  M7.6    AGAATTGGCCGAATTAAAAACAT TAATTTTGGCAATTTTGAACACC IV-5J24
111 F01 IV  M7.7    AACAATTTGCCTGGAGCATC    CGACGACTCAAAACAGCGTA    IV-5L02
111 F02 IV  M7.8    AGATTTCATCGCAATCACACTTT TTCAGTCGTCCAAAATCTTTCAT IV-5L04
111 F03 IV  M7.9    TGTTTTTCATCCTCGATTCAGAT GGCCTCATAAACTTTTTCAACCT IV-5L06
111 F04 IV  M7.10   AATAAAAACCCCGAAACTTGAAA CAATTTCTCAGCACTCTCTCGTT IV-5L08
111 F05 IV  M7.12   CGTTATGGACAAAATTGGGC    CGTGACTCTCCCTCTTTTCG    IV-5L10
111 F07 IV  T05E11.1    CAATACTTTATCAGTTGCCGGAC TCGAACTTTCAGCAGACACATTA IV-5L14
111 F08 IV  T05E11.2    AATGTTGTCTTTTCTTCCGATCA GAAAAGAAATTGGTCGAAATGTG IV-5L16
111 F09 IV  T05E11.3    TGGTGCACAAGTATTCCCAA    GAGTGCAGTTTCCTTGAGCC    IV-5L18
111 F10 IV  T05E11.4    TACCCGATCCATTCAATCGT    AAATATCGATCATGAGCCCG    IV-5L20
111 F11 IV  T05E11.5    AAACTGGCCAAATGAAGACG    TTGGGAATTCAAACCTTTCG    IV-5L22
111 F12 IV  T05E11.6    ATCGTCCTGTGAACTTTCGG    TTGCAACCGAAGCTCTTCTT    IV-5L24
111 G01 IV  T05E11.7    TACTCTTTCACGGTAGCCCATAA AATGAAAAGTCGAAAAAGGGAAG IV-5N02
111 G02 IV  T05E11.8    CAAAATGCTTTTCTGGCTTTAGA CAGAATTTCAGATGGCTCAAAAC IV-5N04
111 G03 IV  F01G4.1 TCGTAAAGAACTGCCGGACT    TCCTGCAAACGTGTAGCTTG    IV-5N06
111 G04 IV  F01G4.2 TTCCGTCTTAGTTCGAGATTTTG TTCTGTTGAGCTCGGTTTCTAAG IV-5N08
111 G05 IV  F01G4.3 TCACCTCGTTCCATGCATAA    GCCGACAATTTGGACTCACT    IV-5N10
111 G06 IV  F01G4.4 ACATTTGCAACCCAGAGACC    TAAATGGCGGATATCGAAGC    IV-5N12
111 G07 IV  F01G4.5 ACGGTTTGAAGTGCCGATAC    CGCTCGTTTTACCGTTGAAT    IV-5N14
111 G08 IV  F01G4.6 ACTAAAACCGAGCATGGTGC    GCTTACTGTGCTCTCGGAGG    IV-5N16
111 G09 IV  C08F8.1 TTCTTTGCTTTTCTCGTGATTTC GAAAACGTTTATACGTACGCCAG IV-5N18
111 G10 IV  C08F8.2 ATTCATTTGTGCGGAGAACC    AACGCATTGACAGCCACATA    IV-5N20
111 G11 IV  C08F8.3 TTGCAGGTTAGCACAAGACG    ATGGGCATAGCCAAGTCATC    IV-5N22
111 G12 IV  C08F8.4 GCCGACAAAGTGAAAAGAGC    TCATGGTTTCAGTTCCACCA    IV-5N24
111 H01 IV  C08F8.5 CATCGCAATTTGTACCATCG    TTAGGATGAGGTCACCTGGG    IV-5P02
111 H02 IV  C08F8.6 TGTCCCTTATCGATCGCTTC    GGCGACTTGATCCAGCTAAG    IV-5P04
111 H03 IV  C08F8.7 AAGCGCATTGGTAACTAATCTCA GAATTGTTCACATTTTCAGGAGC IV-5P06
111 H04 IV  C08F8.8 GTGGGGACAACATAGTGTCAAAT ACGGAGTGAAAAAGACAATGAAA IV-5P08
111 H05 IV  R07H5.1 GACCCATCTAGTTCCCCGAT    TCACAGAAAAAGGGAATGGC    IV-5P10
111 H06 IV  R07H5.2 GATGGTGGACTTTTCGCAAT    GAGTTGGTTGGCTCAATCGT    IV-5P12
111 H07 IV  R07H5.3 TCAAACCTGCAGTCACGAAG    TTTGAGCTTTCGGTCATCCT    IV-5P14
111 H08 IV  R07H5.4 GGGGTTGTAAACAGTTGACCATA ATTAAAACATGCCATCATTGTCC IV-5P16
111 H09 IV  R07H5.5 CGAAAATTGAAGAAAAAGTCGAA TGAAGAAGACCTAGTGAAGCTGG IV-5P18
111 H10 IV  R07H5.6 TCTGCCAAGCAGCCTCTAAT    ACGCATGGGAGCATTTTTAC    IV-5P20
111 H11 IV  R07H5.7 TCGAATATTTCGAACCACAAGTT TGGATTTTATTCATTTGGGTCAG IV-5P22
111 H12 IV  R07H5.8 GGACTGGGAAATTGAAAGCA    AGGCATTCCTTGACAAATGG    IV-5P24
112 A01 IV  R07H5.9 ACTGAACAATTGGATCGAGAAAA TCGAAATTTTTCTTTTGGTGTTG IV-6A01
112 A02 IV  R07H5.10    TCCAACATTTGTGCATTTGG    CGGATGCTGTGCTTGACTTA    IV-6A03
112 A04 IV  C29F4.2 TTTTCAGGAAGGCAACCATC    CGAAGCGAGAAGAGAAGGAA    IV-6A07
112 A05 IV  C29F4.3 CTCCAGTTTACGGCAATGGT    CATTCCATTGCCAGTGTGTC    IV-6A09
112 A06 IV  C05C12.1    GGACGAGAACCAAAATTCCA    TTGTTTCCTTCCCATGCTTC    IV-6A11
112 A07 IV  C05C12.3    GCAATGTCAGCTCTGTTCCA    TTCAATTGGACGTCCTCCTC    IV-6A13
112 A08 IV  C05C12.4    TAATGACAATGCCGATGATGTAG ATTTGCGGTTTAACGGAATAAAT IV-6A15
112 A09 IV  C05C12.5    TTCAGTTGAATTTCGTCAATGTG CATGCTTGTTGTCTAAACCTTCC IV-6A17
112 A11 IV  F54D1.1 GACTTCCGCAAGCCTGTAAG    CTTTCAGTGTGGAGCCCAAT    IV-6A21
112 B01 IV  F54D1.3 TTTCCACTTTGCTACAATTCGAT TGTGGCTTCTTCCTTTTAATGAG IV-6C01
112 B02 IV  F54D1.4 ATTTTCGGAAATGATGAGAGTGA GCCTATAGACCATTGCAAAAATG IV-6C03
112 B03 IV  F54D1.5 GTGATGTGCTGGAAAAAGCA    AAACACCAACTCGCCAAAAC    IV-6C05
112 B04 IV  F54D1.6 CCAGACAATCCATCCTCGAT    AATCTTGTGCACTGCATTCG    IV-6C07
112 B05 IV  B0035.1 CATAATTCGTGCGGGACTCT    TGATCAAATCGGCTACCTCC    IV-6C09
112 B06 IV  B0035.2 TTTCCACGTTGCACAGTTTC    TTGTTTTTCAGCAGAATGCG    IV-6C11
112 B07 IV  B0035.3 GGATCAAAACCGATCTGATAGTG AAATTCTAGTCCATGTTGCGTGT IV-6C13
112 B08 IV  B0035.4 ATAATTTAGAATGCCGGAACACA ACGTTGTGAAAAAGGTGAGAAAA IV-6C15
112 B09 IV  B0035.5 GCCGTGCTGGATATTTTGAT    ACCTTCAGTTGGACCACGAC    IV-6C17
112 B10 IV  B0035.6 GAAATTCCACCCGAAACTGA    TCCCGAAGTCTTTGAAATGG    IV-6C19
112 B11 IV  B0035.7 GACTTCGGGATTAATTGTTTTCC ATAGGGGGACAAAGAGAAGTGAG IV-6C21
112 B12 IV  B0035.8 CCCCTATTAACCTCGGTACATTC GGAAATATTCGAAGAATCCCATC IV-6C23
112 C01 IV  B0035.9 CGAGGCTTATAAAAACTTTCGGT TCTCACTTGTGAGTCTTCAACGA IV-6E01
112 C03 IV  B0035.11    TTCTGGATGACGTTGGCATA    GGAGGTGAAAAGAGTTCCCC    IV-6E05
112 C04 IV  B0035.12    GTTGCCTGGAAGTGGACATT    CAGTTCTGCCGAAGAAGGAC    IV-6E07
112 C05 IV  B0035.13    TAACGTTCCTCGAAAATGGC    TTTAAGCTTCGTCGCCAAGT    IV-6E09
112 C06 IV  B0035.14    ATTACAACCCACTTGGTGAGAGA GCGATAAGTGGCAATAATTGAAG IV-6E11
112 C07 IV  B0035.15    GTTCTTCTTGGCGTAGCTGG    GGAAAAAGGTTGGGTCTGGT    IV-6E13
112 C08 IV  B0035.16    TGGGATACGAAAAATCCCAA    TTGCTGAAAAAGCGAGGATT    IV-6E15
112 C09 IV  F54E12.1    GTTTCGTATCTGAATCCTGCAAC CAAAGTCAGTCGTTGGTTTCTCT IV-6E17
112 C10 IV  F54E12.2    ATCATCCGCAAGAATTCCAC    GATAGTTCGCCAACGAGAGC    IV-6E19
112 C12 IV  F54E12.4    GGAAATATTCGAAGAATCCCATC CCCCTATTAACCTCGGTACATTC IV-6E23
112 D01 IV  F54E12.5    ATAGGGGGACAAAGAGAAGTGAG TAGACGACACTGACAAAGACGAA IV-6G01
112 D02 IV  T01G1.1 TTTTCCGTTCGAAGGATGTC    CCACGTGCAATCCAACATAC    IV-6G03
112 D03 IV  T01G1.2 TCATATGATCAATCCCATCAACA GGGGAACAAATGATACAAACAAA IV-6G05
112 D04 IV  T01G1.3 GGTGGCTGTTGAGCTCTAGG    CTACAGGAAGGAGCTGGACG    IV-6G07
112 D05 IV  H02I12.1    AGAAATTGTGCAGGATTGGG    GGGCTCGCACGATTTATTTA    IV-6G09
112 D06 IV  H02I12.2    TCGTTCCATTTGGATGTCTCTAT CCTCTGCTCAATCTACCTGAGAA IV-6G11
112 D07 IV  H02I12.3    CAATTCTGGGAAATGGCCTA    TCGACTGATGATCGAATTGC    IV-6G13
112 D08 IV  H02I12.4    TTATGAATTGATCCACCGCA    CCCGCATATTGAAAATTGCT    IV-6G15
112 D09 IV  H02I12.5    ACGTGATTGATGCAGTCGAG    AATGCATCGCCTATTTGACC    IV-6G17
112 D10 IV  H02I12.6    ATAATCGCAAAATTTCGTCTGAA CCCCTATTAACCTCGGTACATTC IV-6G19
112 D11 IV  H02I12.7    ATAGGGGGACAAAGAGAAGTGAG TTTTTATACAGCCGGGTACAATG IV-6G21
112 D12 IV  H02I12.8    GTCATCATCCCCGCTGTACT    TTCCCAGAAGATGAATTGCC    IV-6G23
112 E01 IV  F22B3.1 CACCACAGTTGTGTACAAAAGGA AGTAGGGCTAGGGCTTTTACTGA IV-6I01
112 E02 IV  F22B3.2 CACAAGAACCGATTTTCAAGTTC GTTCTACTTGCCACAAGGACAGT IV-6I03
112 E03 IV  F22B3.3 CCAGCCATTCCCTCAAATTA    GGACGACGAGACGAGTTAGC    IV-6I05
112 E04 IV  F22B3.4 TTGTTCATCTCGCAGAGTGG    TTGAGCAAGGATGTGGTTGA    IV-6I07
112 E06 IV  F22B3.6 GATGGAGTCGGTGGTGTTCT    AGGTGACCGTGAGAATTTGG    IV-6I11
112 E07 IV  F22B3.7 AGAGCACAATGCTACATGCG    TTTTCAGATGGCTTGGAAGG    IV-6I13
112 E08 IV  F22B3.8 CCGGCAGTCTCAAGGTAGTC    ACGGTGAAAAACGACGATTC    IV-6I15
112 E09 IV  C10C6.1 TCGAGGTTACGGAAAACCTG    GTGTTCGACCGGAACTTTGT    IV-6I17
112 E10 IV  C10C6.2 CTTGGACAATCAAGGACTTCAAC GGCAAATGACAATTTTCAGAGAC IV-6I19
112 E11 IV  C10C6.3 TTGCTGCACACCTCTAATGC    TGTTTTTGGTGAATTTGGCA    IV-6I21
112 E12 IV  C10C6.5 TCTCACACAAATCGGTGCTC    TTGCTGACTCGCAAAGCTAA    IV-6I23
112 F01 IV  C10C6.6 TTCCCATATTCCGGATTTCA    TCCCAACGTTTCCATATCGT    IV-6K01
112 F02 IV  H21P03.1    AAAAACCATGATAAGGTACGGGT AGAGCAATTACGTGTTCAATCGT IV-6K03
112 F03 IV  H21P03.2    TTTTCGAGAAAGTTCCACGG    AATGAGGAGGACCATCATCG    IV-6K05
112 F04 IV  H21P03.3    GATTGTCGAATAAGTTGAGACCG GAAAAAGTAGAAAAGCAGCACGA IV-6K07
112 F05 IV  M04B2.1 CCTCTTCTGGAACGCTTGTC    CTGGTTCTCTTGTGCGTTCA    IV-6K09
112 F06 IV  M04B2.2 GATCTGGAACGTGTAAACGAGAC AAAAAGGCACAGTTTTATCCCTC IV-6K11
112 F07 IV  M04B2.3 TGTTTTTAACTGAATCCATCGCT ACACACTCAGCACATTTCAGAGA IV-6K13
112 F08 IV  M04B2.4 TTTCAGATTCGGAACAACCC    CTTTCTCCAAATCCGCACAT    IV-6K15
112 F09 IV  M04B2.5 AGTTTGCTGATTTCGGCTGT    CAGCAACTTCCTGCATTCAA    IV-6K17
112 F10 IV  F12F6.1 TGTCAATGGAATTGTGAAGACTG AAGAGAAGCACGTGGAGTTGTAG IV-6K19
112 F11 IV  F12F6.3 TGAGAATGATGATGAAAACGATG TTTACAGTGATGTTGTGACCCTG IV-6K21
112 F12 IV  F12F6.5 AGAAGAGCACGAAGCCAAAA    TTGCCAATATTGCGACACAT    IV-6K23
112 G01 IV  F12F6.6 CGACTGCATGGCAAGAGTAA    AAGATTTGCTTTGGCGTGAT    IV-6M01
112 G02 IV  F12F6.7 TTTATCACTCATTCCACAACGTG GACAAATTTGCCTTCTTGAATTG IV-6M03
112 G03 IV  F12F6.8 AACCCGGCGATCTTCTAAAT    GTCCAAAGAAGACCCCACAA    IV-6M05
112 G04 IV  F12F6.9 TCAAATGGTCGAGATGGACA    TTGAGGGCTTTCCACATAGG    IV-6M07
112 G05 IV  F40F11.1    TCTGATGATGTTCGATTCAAATG CACAACGAATTCAATTTGGGTAT IV-6M09
112 G06 IV  F40F11.2    TGGTACCTTCCCTGTCGAAC    AATGATGGGTCCATCGACAT    IV-6M11
112 G07 IV  F40F11.3    TCCCTTTTTACACTCTGATCCAA CCATACATCGATGAGGACAAAAT IV-6M13
112 G08 IV  F40F11.4    AACAGGTGCAGAAAACTTGAGAG GAGTAATTTCGAGTTCAGCCAGA IV-6M15
112 G09 IV  Y24F12A.a   TCGGCAACTCTGAATTTTATGAT ATTTTCTTTCCGTTTCCTCTTGA IV-6M17
112 G10 IV  Y24F12A.b   TCATTCCGGCTTAATCTTAACAA GAATGAGAGAGAAACGCGATCTA IV-6M19
112 G12 IV  F58B3.1 ACTGACCCATTTGTTGTCAGTTT ATTAGAATCTCCGGTATTTGGGA IV-6M23
112 H01 IV  F58B3.2 TATTTGATTGCACGTGATTTCTG ATGTCTGGAGAAACATGAAGCAT IV-6O01
112 H03 IV  F58B3.4 AGATCCTCGGGTTTCTTCGT    CGGATTTTGGAAAAGGACAA    IV-6O05
112 H04 IV  F58B3.5 CTCTTGTGATGCAACGAGGA    GTGCAAGTGTGCTCTACGGA    IV-6O07
112 H05 IV  F58B3.6 CCTTATATCGGACCAGCGAA    AGAAAATTTTGATGGCGCAC    IV-6O09
112 H07 IV  F58B3.8 CCGATTTGCTAATCTCTGCC    TGATGACGTCACTTGGGGTA    IV-6O13
112 H08 IV  F58B3.9 TTCCAAGAAATAAAATTGCAGGA TTATTATCTTCGAGAGGCCATCA IV-6O15
112 H09 IV  ZK809.1 ATTTCGCGTTGTATTCTGTCATT AAGCAATGACAGTTGGTGAGTTT IV-6O17
112 H10 IV  ZK809.2 AATGGTGAAGGAGAACAGAATGA ATGTTCCTTGGAGGTTTGTCTTT IV-6O19
112 H11 IV  ZK809.3 GGGCTTTTTAATAAATGGCAGAT CTGATTGTCACTCGTTTCCTTTC IV-6O21
112 H12 IV  ZK809.4 ATTGCTAATGATGAGGTTGATGG GTCGAAACCTCCACATGTAAGTC IV-6O23
113 A01 IV  ZK809.5 ATGGTTGGACGAAGTTCAGC    ACTTGGATGGTTGGTTGAGC    IV-6A02
113 A02 IV  ZK809.7 TACCCTCCCCCACTATCACTATT TTTGCTCTCCTTCATTTCTCATC IV-6A04
113 A03 IV  ZK792.1 ATCAGATGAAGGATGCTGGC    TGGAAGTTCCTTCCGTTGAC    IV-6A06
113 A04 IV  ZK792.2 CCAATTGTTCAAAATGTGCG    GTACATCTCCACGGCAACCT    IV-6A08
113 A05 IV  ZK792.3 ATACCACACAGTTGGGAGGC    ATGTAGGGCTTCGCGATATG    IV-6A10
113 A06 IV  ZK792.4 GAATGCTCTTCTTTCAGCCG    AACTGCTCGTGGTGACACTG    IV-6A12
113 A07 IV  ZK792.5 TGGGCACATCGAGAATATCA    ATATTTTGACCTCGCCATCG    IV-6A14
113 A08 IV  ZK792.6 AAGAGGATCGATCACAAGTTTCA AAATCCTTCTCCACTTCGTTTTC IV-6A16
113 A09 IV  ZK792.7 TACAGCTATGCAAAATGGCG    GCCACGAAGACTCTTTCCAG    IV-6A18
113 A10 IV  T22B3.1 AAAACATTTCGTGGGAGTGC    CCAGTTCGACTTCGGATGTT    IV-6A20
113 A11 IV  T22B3.2 TCCGAAAATGGTTGTAGTTCAGT TGGATACTTGAGTGGTCCGTACT IV-6A22
113 A12 IV  T22B3.3 ATGTCCGACAACACATAAAAACC TTGAATTGCGACTTCTAACCATT IV-6A24
113 B01 IV  K01A6.1 TGCTCCGCTTCCTGTAAGAT    CCATTCATTGTGAAATTGCG    IV-6C02
113 B02 IV  K01A6.2 GAAGACATTCCAACTCGACATTC TGAAGCGGTGGAAATAAGAAATA IV-6C04
113 B03 IV  K01A6.3 TCCAAAACATCTCCGCCTAC    TGGCAGAGAGAAGGGACACT    IV-6C06
113 B04 IV  K01A6.4 AGCAGTGGAACACATTACCAGTT AGGTCAGAGACAGACTGGACAAG IV-6C08
113 B05 IV  K01A6.5 TGAATGTGGGGGAGGTTTTA    AAAGGTTCACCGCAAAACAC    IV-6C10
113 B06 IV  K01A6.6 CTCAATTATGCATCTGACCACAA CGTTAAACAGGACTACGCAATTC IV-6C12
113 B07 IV  T12A7.1 TGGACAGTCCTCCTGATTCC    TCTTCTGAACGCACTTGTCG    IV-6C14
113 B08 IV  T12A7.2 CCCATGATCCACCACACATA    GGGACAAGCACAAGTGGATT    IV-6C16
113 B11 IV  T12A7.5 TCTACGTTTGGTCAGATGAGGAT AAAGAATCATGAAAGTGGCGTTA IV-6C22
113 B12 IV  H01G02.1    TTCATCGAAAATTAAATCCATCG TCAATCTCTCACAACACATCACC IV-6C24
113 C01 IV  H01G02.2    CTCTTTCAACAGTTCACTGGCTT GCGCAAAGCTTGACTAGAAAATA IV-6E02
113 C02 IV  M117.1  CCCGTCTTGTCCTCACATTT    GGCGCCCTTATAGAATCCTC    IV-6E04
113 C03 IV  M117.2  AAAATGGAAGATGGGGGTTC    GGAATACCGCGTCAAGGTAA    IV-6E06
113 C04 IV  M117.3  TGATGAAACTAAGGCTCTCTTCG CCTCAGGTTTTTGACTGAAATTG IV-6E08
113 C06 IV  M117.5  ATCGTGCTCAGCCTGACTTT    TGCAGCAGTTCCCTCCTTAT    IV-6E12
113 C07 IV  F38H4.1 GAAATGCCACAATTGGGTAGATA CGATTGCAACTAGTATTTTTCCG IV-6E14
113 C09 IV  F38H4.3 ACCACCTCAAAAACCGAGTG    TCGATCTGTTTCCAACGTCA    IV-6E18
113 C10 IV  F38H4.4 CCGACGTTATTTGCCTTGAT    TTGGGTTCTCGTTAACTGGC    IV-6E20
113 C11 IV  F38H4.5 AGTGCTATGATGGGAGTGGC    AAGCACTGAACGGAGAAGGA    IV-6E22
113 C12 IV  F38H4.6 ATGAACGATTTACAAGGGGTTTT GAGTTTGGGAGTGTACATTCGAG IV-6E24
113 D01 IV  F38H4.7 TCCTTCTCCGTTCAGTGCTT    ATTGCTTCATCGGTTTTTCG    IV-6G02
113 D02 IV  F38H4.8 TCGTTTGTGTGCTCGAAGTC    TTTTCAGGGAAACTCGGTTG    IV-6G04
113 D03 IV  F38H4.9 ATTCCACGATCTGATGGAGC    ATGAAAACGGCGATTTGAAC    IV-6G06
113 D05 IV  C29E6.1 GAGGAGCTTTCTCTTCCGCT    CCGAACAGTTCTTGCTGACA    IV-6G10
113 D06 IV  C29E6.2 TCAGCAACATCAGGAGTTCG    CGAGATCTTCAGTAAGGCCG    IV-6G12
113 D08 IV  C29E6.4 TGAGCAAAGGAATTGTCGTG    TTGCTTCGCTCCACCTACTT    IV-6G16
113 D09 IV  C29E6.5 ATATCAGTGGATGTGTGATGCTG AATACTTGTCGATTTTCAAGCCA IV-6G18
113 D10 IV  C29E6.6 TTGGTCATTCAGCAATGGAA    CGATGGGTCCAGAATCAAGT    IV-6G20
113 D11 IV  VZK822L.1   TTGGACGTCTGAGTCGAGTG    GGAGCTCATCGTCTCTGGTC    IV-6G22
113 E01 IV  ZK822.2 AAGTATGGAAGAAACGGGAAAAG TTTAAGAGCCAATATGCCCAGTA IV-6I02
113 E04 IV  ZK822.5 AACTTCCCCCACTTCCAGTT    CGAAGAATATCCCTGGCAAA    IV-6I08
113 E05 IV  ZK829.1 CCATTCAAGCTTTTGCCATT    TGGAAGATCTGCTGATGACG    IV-6I10
113 E07 IV  ZK829.3 ATGGCGTCCAAGAAAACAAC    CAGCTAACAACATGCCGAGA    IV-6I14
113 E09 IV  ZK829.5 CCGCTCGACATGGTTTTTAT    ATAATGGACTGTGGGCGAAG    IV-6I18
113 E10 IV  ZK829.6 TGCTGTTCCAAATCTTGCAG    GTGCCAGGCAGATATGAGGT    IV-6I20
113 E11 IV  ZK829.7 CAACACTGCAGACGCTTGAT    CAGAAAATGCCAGCAACAAA    IV-6I22
113 E12 IV  ZK829.8 AACCCCAATGTCTTCAATGC    CACAAAACACATCCCATTGC    IV-6I24
113 F01 IV  ZK829.9 GTGCTGTTGTTTGTGCCAGT    CGATCCATCTCAAGTGCTCA    IV-6K02
113 F03 IV  ZK617.1 AATGATCTCCCTTGTTGAGTGAA CACTCTTACTGCTACCAACGCTT IV-6K06
113 F06 IV  T12G3.1 GCTGGAGAAGTTGCAAAAGG    CAGCAATGTTTTCCTCGGAT    IV-6K12
113 F07 IV  T12G3.2 GTAGAAAGGCAGGCAGGTTG    TGTCTTGGCAGTTCTTGGTG    IV-6K14
113 F09 IV  T12G3.5 AGTTTTCAGGTGATGAATTCCAA GAGATGAACATGTGGTGATGCTA IV-6K18
113 F10 IV  T12G3.6 CAATGTCGACAAACAAACAGAAA AAAAGAAAACAAAAACGAACACG IV-6K20
113 F11 IV  T12G3.7 ACCAGCTTCCAGTGTCTGCT    GATTTTTACGAGCGAAAGCG    IV-6K22
113 F12 IV  K08E4.1 CAGCCTATCCAGAATCCGAA    TTTCGCTATGCATTTTGCAG    IV-6K24
113 G01 IV  K08E4.2 ATGATTGCTGCTTTTCTTTTTCA TGTTTGTTCTGATACATGGCAAG IV-6M02
113 G02 IV  K08E4.3 TCGAGAAATAATCCGACCATCTA GAAAAATGATAACAGAGGAGGGG IV-6M04
113 G03 IV  K08E4.4 TGGCAAAACTTAAGATAACCGAA GTGAAAAATTGTCTACCAAAGCG IV-6M06
113 G04 IV  K08E4.5 CGGAATCTGCCATGGTTAGT    TGAAACCGTCGAGACAATGA    IV-6M08
113 G06 IV  F11A10.1    TTGATGGAATGGCTGAACAA    GCATTCAAATCAGGAAGGGA    IV-6M12
113 G07 IV  F11A10.2    TGGACGATGTGGAACAAAGA    CAATTCTGACAGCCTCGACA    IV-6M14
113 G08 IV  F11A10.3    AGCTCCTTTGTGGCATCTGT    CAACTTTGATGCTTGGCTGA    IV-6M16
113 G09 IV  F11A10.4    TTGCTGTACGAAAATCAGCG    AGAGCTTCCTGTGTCGGTGT    IV-6M18
113 G10 IV  F11A10.5    TTTATCCGCTCAGGACCATC    TTCGGAAAAACGGACTGTTC    IV-6M20
113 G12 IV  M18.2   TATCTGACGCGAACTTTGGTTAT GATCGATTCGCTGATCATTTTAC IV-6M24
113 H01 IV  M18.3   TGGATGGCTACTTTTCTGGG    ACGTGGCAATGATAGATCCC    IV-6O02
113 H02 IV  M18.5   ATGTCGAGAGCACCCATTTC    TCAGCCCTTTTTGTTGCTCT    IV-6O04
113 H03 IV  M18.6   GCAACAACTCCCGATGAAAT    CCAATTGGCAACGAAAAATC    IV-6O06
113 H04 IV  M18.7   TTTCTCAGTTTCCTCATTTGCTC CAAAAAGATCACGAGAAAGGAAA IV-6O08
113 H05 IV  M18.8   TCAATTCAGATGACGGGTGA    TAGCCGTATCCTGGGATGTC    IV-6O10
113 H07 IV  B0001.2 GAGCGAAAATGTGGGTCAAT    GGTGATTGGGTTGAAATTCG    IV-6O14
113 H08 IV  B0001.3 GGAATCGCTGATTAAACCGA    GGGAACCAGCGACAGTAGAA    IV-6O16
113 H09 IV  B0001.4 AGTTATATATTGCCGCCACACAG CTCTAAACGAGCTCCAATTCAAA IV-6O18
113 H12 IV  B0001.7 CTCTGCGAATTTTCCACCAT    GACGTGAACTGTTTCGCTCA    IV-6O24
114 A01 IV  F20B10.1    GCTCCGGGCTTATTATCTCC    CGAGTTCCGGATAGTTCCAA    IV-6B01
114 A02 IV  F20B10.2    AGTCTCAATCCCTTGCGAGA    ATCCGTCGCATCGAAATTAG    IV-6B03
114 A03 IV  F20B10.3    ATTGTCAGTGCCTTGTCTCTCTC GTTCCCATCTTGATAACTGCTTG IV-6B05
114 A05 IV  F35G2.2 TCTACTGTGTGAGCCACTTGAAA TTGATTTCTGTTCCTCAGGTGAT IV-6B09
114 A07 IV  F35G2.4 TTGGAGCAAGCTTCAGGAAT    TTTGTGACGAACCCAATCAA    IV-6B13
114 A09 IV  Y39C12A.a   ACTTATCCTGACCGGATCCTAAG AGCATAAATTGTTTTCGCAATGT IV-6B17
114 A12 IV  Y39C12A.d   GATAGAAAGGCGAGTAAAAAGGC CCAAGGTGTTGGTAATTTGGATA IV-6B23
114 B01 IV  Y39C12A.e   AGAATATAATGACGCAGGCACAT TTTCTTCTAGGTAACACCAGCCA IV-6D01
114 B04 IV  Y39C12A.h   ACTCGAAAAATGAGGTGACAAAA TTGAAAATTATCCCACCTGTCAC IV-6D07
114 B05 IV  C42C1.1 CCTCGAGTAGACGGAAGTGC    TAATTTGGCCTCGGATTCTG    IV-6D09
114 B06 IV  C42C1.2 GTGGATGTGCAGTTATATCCGTT CGCGTGGTAGGTTCAGTTTATAG IV-6D11
114 B07 IV  C42C1.3 ATTTTGTTATGCAGCGTTTTGTT AGAAGGACTAAGCTCGTTCGTTT IV-6D13
114 B08 IV  C42C1.4 GGCTCACGATGGTCTCAAAT    CTCGCTCGGAGAGTTGTACC    IV-6D15
114 B09 IV  C42C1.5 TTTCATTTTCCCCCATTTCA    TCTCGATACGAACCCAGCTT    IV-6D17
114 B10 IV  C42C1.6 AGGGATAGTTCTGAATTTCGAGG ATTTATGGGCTTTGCGTGTAGTA IV-6D19
114 B11 IV  C42C1.7 TCGTGTCAAATCGACCAAAA    TTCAGGCATTTGAAGGTTCC    IV-6D21
114 B12 IV  C42C1.8 TTCCACATCCGATCATGAGA    GATTGCGTATGCACCAGTTG    IV-6D23
114 C01 IV  C42C1.9 GACAGGTATGTGTGTACCCGATT AAAAATCTGTTTTCAGGGAGGAG IV-6F01
114 C02 IV  C42C1.10    AAAGCACATCCTGAATTGGC    TCGACGATGGTTGGTTATCA    IV-6F03
114 C03 IV  C42C1.11    CCGATCCTTTTTCGTATGGA    CCAGGTCACTGTTTCCCACT    IV-6F05
114 C04 IV  C42C1.12    TCGTTTTAGAGAGTGTGGGGATA CATCGCATAATTTTTCATCGTTT IV-6F07
114 C05 IV  K09E10.1    CATGGCGAATGTGAAAGAGA    TCCAAATATGGCGATGTTGA    IV-6F09
114 C07 IV  K09E10.3    GTTCAGTTTTGAGATGCTCTTCG GTCCCCTTTCAGAAAAGATTCAT IV-6F13
114 C09 IV  F19B6.2 ACCACTGGTGGAATAGCTGG    CAACAAGGACTTCACGGGAT    IV-6F17
114 C10 IV  F19B6.3 CAGTCATTATTGGGGAGCGT    GCCTACAATGGCTGGATGTT    IV-6F19
114 C11 IV  F19B6.4 ACGAAAGTCGGAACCATGAC    CCAACTGAGCAAGCATTCAA    IV-6F21
114 C12 IV  ZC518.1 TTTTGTGACGTGGAACCGTA    GATCGGAAGCCATAGGTCAA    IV-6F23
114 D01 IV  ZC518.2 ATTTGACAGCATCCCCTCAC    AACACTTCATCCGTTCCGAG    IV-6H01
114 D02 IV  ZC518.3 CGGAACAATTCCGAACACTT    GCGTAAATCGACACGAGACA    IV-6H03
114 D04 IV  F28D1.1 AAGATCCAAGCCAGATGGTG    GAGCAGAAAATGATGGGGAA    IV-6H07
114 D05 IV  F28D1.2 TGGAAATTTATGAAACGAAGGAA ATGACGTGTCTACCTCTTGGAAA IV-6H09
114 D06 IV  F28D1.3 GGCGCTCATCAAGCTTACTC    CCGTGTTCCTTTTGAAGCTC    IV-6H11
114 D07 IV  F28D1.4 AACTCTTTGATCCATGAACCTGA TTTCACCGGAAGTTTTATGAAGA IV-6H13
114 D08 IV  F28D1.5 TCGCAAGCATGGTATCAGTC    AACCTTTGCCCATCCTTTCT    IV-6H15
114 D09 IV  F28D1.6 TGGAAAAGCTTAATGAATGTTCG GGTGCTGGTGTTTGTTACTTTTC IV-6H17
114 D10 IV  F28D1.7 ATCTAACACGACTCCCAATCTCA GGTAACACTCGTTTCAGCTGTTC IV-6H19
114 D11 IV  F28D1.8 TCTTTTTCGTTGGCTTCGAT    CTATCTTCGCAGTTGCCACA    IV-6H21
114 D12 IV  F28D1.9 CCTGGATTCCTCTTCCACAA    CGATGATTGACATCGAGACG    IV-6H23
114 E01 IV  F28D1.10    TCATGCCCGATCATTATTCA    AGCATCAGCCTCGTAGCATT    IV-6J01
114 E02 IV  F28D1.11    GAACAGCTGAAACGAGTGTTACC GGTTTTCTCTTCGTCTTTCCATT IV-6J03
114 E03 IV  F08G5.1 TCATTTGAATCGCTCATCCA    ATTTTTGATGACGAGCTGGG    IV-6J05
114 E04 IV  F08G5.2 CTGCTGCTGATTCATTTGGA    GTTACTTGCGGGTTTTGGAA    IV-6J07
114 E05 IV  F08G5.3 TTACCCTTGAGCGAACAAACTAC GGATATTCGGAAGAACAATTTCC IV-6J09
114 E06 IV  F08G5.4 TGGACAGTAGGCAGCATCAG    TGTCTTACGCAATCAACCCA    IV-6J11
114 E07 IV  F08G5.5 TCCACATTTCGTCGGTTACA    CACCCTTGGTCACCATAACC    IV-6J13
114 E08 IV  F08G5.6 GGAAGAGCAGAAAAACGGTG    GTGGAGAGCGTATTTGGAGC    IV-6J15
114 E09 IV  C25G4.1 CGAGCTCTACATCCTCAGGC    TCTTCAAATTTCACGAGCCC    IV-6J17
114 E10 IV  C25G4.2 CAAAAACAACCAAAGCCAATTTA CAGTACTCTTAAAGGCGCACACT IV-6J19
114 E11 IV  C25G4.3 GCAGTTTTCGCGTCTAGGTAATA TGAAAACATTTTTGATTTTTCGG IV-6J21
114 E12 IV  C25G4.4 TGTAAATTCTCGAGCAGTGTGAA TGAGCATCAAGACAATAATCCCT IV-6J23
114 F01 IV  C25G4.5 AACCGAACAGAATCAACTTTCAA ATTCATTAGACAAAAAGCCACGA IV-6L01
114 F02 IV  C25G4.6 AAAGCAGCCAAGAAGCAAAG    TTTTGTGGGCGTTTCACATA    IV-6L03
114 F03 IV  C25G4.7 GAAGCCGAAACGTTTTACCA    GTAGCCGGTCGAAAACAAAA    IV-6L05
114 F05 IV  C25G4.10    AATGCCTTCCACTGTGCTCT    AGAAAATGAACATCGACCCG    IV-6L09
114 F07 IV  T04A11.2    TGTGACAGAAGGTCCGTTCA    GCTGCCGAATTCAATCTCTC    IV-6L13
114 F08 IV  T04A11.3    AATGCCTTCCACTGTGCTCT    AGAAAATGAACATCGACCCG    IV-6L15
114 F09 IV  T04A11.4    AGCCATGTGCCCAGATAAAC    ATACGGGCCCCTTTGAATAG    IV-6L17
114 F10 IV  T04A11.5    TGTGACAGAAGGTCCGTTCA    GCTGCCGAATTCAATCTCTC    IV-6L19
114 F11 IV  T04A11.6    CCAGTTTGCAAAAGTCCGAT    AGAGAGACCTGCCTTGGTGA    IV-6L21
114 F12 IV  T04A11.7    ATTTTTGAACGGGGGCTAAC    ACCTACATCGTGCCAAGACC    IV-6L23
114 G01 IV  T04A11.8    ATCACTCTCAAATTTTCGTTGGA GGAAAAATCTGAAAATCTGGGTT IV-6N01
114 G02 IV  T04A11.9    GCGATGCTCTTCACAACTCA    TCATTGCGGGCTTATTTTTC    IV-6N03
114 G03 IV  T04A11.10   CCAAAACGCAAAATCCAAGT    TTTCAGCGTTCTCATTGTCG    IV-6N05
114 G04 IV  T04A11.11   CACACATATAGAGGCTGGAAAGC GGATGATCTCAAACAGTCTGTCC IV-6N07
114 G05 IV  F53B2.1 TGACGGTTTAGGATTGACTGTTT AATGCCTCAATTTTCGACTGTAA IV-6N09
114 G07 IV  F53B2.3 TCGTCCTCCACAAACTCTGTAAT TGCTTCCCCTTTTCCTAATTTAC IV-6N13
114 G08 IV  F53B2.4 ATCCACGGACCAACACAAAT    GGTTGGAAAACAGGAAGCAA    IV-6N15
114 G09 IV  F53B2.5 CGGCAACAACGTTTGATATG    ATGGCGTTCTCAATGCTCTT    IV-6N17
114 G10 IV  F53B2.6 AAAAAGCTACAAAAACCACACCA AACATGGAGTAGAAGAGACGCAG IV-6N19
114 G11 IV  ZK795.1 TGCAGTTTGTAGTGGGAGATTTT TACAGTATTCCCTGACCTCCTGA IV-6N21
114 G12 IV  ZK795.2 GATCAGTTGGTCCATGGATTTTA ATCAAATCGATTCGTTGTTCAGT IV-6N23
114 H01 IV  ZK795.3 AATTTCAGAATGATTCGCCG    TCGAGAGTTCCCAGCTTGAT    IV-6P01
114 H02 IV  K08E7.1 CCAAATCGTCGTCCTTTCAT    TATTTCGCATCCGGATTTTC    IV-6P03
114 H03 IV  K08E7.2 CAAAGTCGACATCAAAAACAACA CGTTTACACCATCTGTCCTTCTC IV-6P05
114 H04 IV  K08E7.3 TGTCTGCCGACTACTCATCG    AATCGTCCAAGCAGCTCTGT    IV-6P07
114 H05 IV  K08E7.4 AATTCTCGATGTTCGTTTTGTTC TAAAAAGTCCCTCCAAAACTTCC IV-6P09
114 H07 IV  K08E7.6 CCTCCAAAAACTTCCGACAA    CAAAACGAATGCTTCCAGGT    IV-6P13
114 H08 IV  K08E7.7 TCGCTTTTCGAGATACACCC    AATTATTCGATTGCCGAACG    IV-6P15
114 H09 IV  K08E7.8 TGCAGAGATAACCTGTGAGATGA TGATCCTTCATTTCTCCCACTAA IV-6P17
114 H10 IV  K08E7.9 CCGTAGCATCCCGAAGATAA    CGAGATTTTGTATCACGCCA    IV-6P19
114 H11 IV  Y55D9A.1    CCGTCTTGATGTTGAAGCAA    GGACACTCCGTCGAAACATT    IV-6P21
114 H12 IV  Y55D9A.2    ATCTGTGGATATCGTTCCCTTTT GTATCGAATCAATTGTTACCGGA IV-6P23
115 A03 IV  VT23B5.2    GCGCTGGAAAGTGATTATGTATC GTAGAACAGGCAGTGGCAATATC IV-6B06
115 A04 IV  C26H9A.1    TGATAATGGACTAAAAAGCCCAA ATGCTTTAATTTCAACGCCTACA IV-6B08
115 A05 IV  C26H9A.2    CTGAGCCGTTCGAGAAGATAATA ATTCCAATTGAAAATTTGGAGGT IV-6B10
115 A07 IV  T23B5.3 AACAAGCATGCATCAAGCAC    TTTCGTCGATCCTCCAAAAC    IV-6B14
115 A08 IV  C27D8.1 TACCTGCCCACCTTCAAGAC    ATCTTTTCGGCATTCCTCCT    IV-6B16
115 A09 IV  C27D8.2 CATCATTGAACGCATGAACC    CCAGTGGCTCTTCAGACTCC    IV-6B18
115 A12 IV  C27D8.5 CCAATTGCCACACGTAACAG    TGAACAATGCAAAACGGGTA    IV-6B24
115 B02 IV  T23F6.2 AAGTTTATGAATGAGCCGCATAA AGTGTACGGAGCTCTCTCATTTG IV-6D04
115 B03 IV  T23F6.3 TTGAACCCAACTATGATCGGATA TGAGGAACAGAGGTGAGAAAGAG IV-6D06
115 B04 IV  T23F6.4 AGAAGCAAATCCGGGAAAAT    AATTTCCAATTTCCGCACTG    IV-6D08
115 B05 IV  T23F6.5 AGCGCTTCAACTCTACCTTTTCT TAAGCCTGATAAATCCGAACAAA IV-6D10
115 B06 IV  C36H8.1 AGGATGAAGATTGCATTGGG    CCCTACTCGGATTCGTCAAA    IV-6D12
115 B07 IV  C36H8.2 AGTACCGAAACACCAAACGG    GACCAACCAGAACCAGAGGA    IV-6D14
115 B08 IV  C36H8.3 CAGCTGTGTGTGAGAGAGAGAGA GATGACATCATTCAAAGTCACGA IV-6D16
115 B11 IV  F07C6.2 TTCAATTCCGGTTTTCTAAGTCA ATTAATTTGCAGGCATTTCAAGA IV-6D22
115 B12 IV  F07C6.3 TGGCTCGATCTCTTCTCTATTTG GATCAACTGGGAGCACATTTAAG IV-6D24
115 C01 IV  F07C6.4 GAGTTTGGCCCTATTTTAATGCT ACCAAATGATTTTTGAATTCCCT IV-6F02
115 C02 IV  F07C6.5 ATAATGGAGCAACAGGAAGAACA TCATATCACATGTTGGTGTGGTT IV-6F04
115 C04 IV  M02B1.2 AATTAAATTTTTCCAAACGGGAA ATGCTCGGAAAATATTGGGTAAT IV-6F08
115 C05 IV  M02B1.3 AATTTTGAACCGGCATAATTTTT AATGTTTTCCAGCTCATTTTTCA IV-6F10
115 C07 IV  ZK896.1 TCAAAGGATACAAATGCCCC    TGGTCCAGTTGTTCCACAAA    IV-6F14
115 C08 IV  ZK896.2 CCGGTCAAATCCAAAAGAGA    TTTCCTGTCTACCCACCTCG    IV-6F16
115 C09 IV  ZK896.3 CAAATTGTCAAGATGATTGGGAT AATAAAAACCTGGTCTCTAGCGG IV-6F18
115 C10 IV  ZK896.4 AGTCACCGAAGGCATAAACG    CTTGCAACTTATCCTTCCGC    IV-6F20
115 C11 IV  ZK896.5 GCCAGCTTATTGGAATTGGA    TATGCATGGGTAAGCGTGAA    IV-6F22
115 C12 IV  ZK896.6 TCCAAGACACTTTTGTTATGCAA GCACCTATTTAAACTGGGCTCTT IV-6F24
115 D01 IV  ZK896.7 CCCGTCACAATGCTCCTATT    AAGAACGGAGCATCATCCTG    IV-6H02
115 D02 IV  ZK896.8 AGGGATTGCTGGAGTGAGAA    CAGGTAGGATGGTCGGAAAA    IV-6H04
115 D03 IV  ZK896.9 TACTGGGAAAAACGTTTGAAAAA GATGGAAAACGTTAGAATTGCTG IV-6H06
115 D04 IV  K08D8.1 AAAATTGTTAGCCTTGAACCCTC AATGGAAGCATTTTGAAACTTGA IV-6H08
115 D05 IV  K08D8.2 GGTTTTCACAAAATACAACGAGC ACAACGTTAGCTTCCAAATTTCA IV-6H10
115 D08 IV  K08D8.5 ACAACTCGATTCAAAAGGATCAA GGTTCCGAGAACACTAACTCTCA IV-6H16
115 D09 IV  K08D8.6 AAGTTTATGAGAAAGGTGCCACA AATACGTTCTCAATGCGTCAGAT IV-6H18
115 D10 IV  C32H11.1    TATTCGAAAGCTTGCAAGAAAAG ATCAATCAAGTTATGATCGTGGG IV-6H20
115 D11 IV  C32H11.2    TACTGTGCTTTGAATTGGGTTCT CACAAGCAAAAATGCAACAAATA IV-6H22
115 D12 IV  C32H11.3    CAGGTTTTGTAACAGATTCTCCG CTTACATTGTGCATCTTGGATCA IV-6H24
115 E01 IV  C32H11.4    TCAATTTCACGCCCTTCTAAATA GACACGCCGTAACAGTTAAGTTC IV-6J02
115 E02 IV  C32H11.5    TTGTGCCTTCCAAACAGTATTTT AGCTAAAAATGGGCTTTTCAAAC IV-6J04
115 E03 IV  C32H11.6    GTTTGGTTTTTCGACATTTTCTG CATCCCAAGCTAAAAATCGACTA IV-6J06
115 E04 IV  C32H11.7    TTCAAAACGATGGAATAGGAAAA CGCTAAAGAGAACAACAAAAAGC IV-6J08
115 E05 IV  C32H11.8    CCTGGAATCATGAGATCTTTCAC CATCCCAAGCTAAAAATCGACTA IV-6J10
115 E06 IV  C32H11.9    TACAGTCCAAGAACGTCCAGAAT AAACTACGTTGGTTGCACGTTAT IV-6J12
115 E07 IV  C32H11.10   CCGAACCAATTATCATTAAGCAA TCCCTTCAACTCGTAGAATTTCA IV-6J14
115 E08 IV  C32H11.11   CATCCCAAGCTAAAAATCGACTA CCTGGAATCATGAGATCTTTCAC IV-6J16
115 E09 IV  C32H11.12   CAACCATATTGTAGACTCCTCCG CAGTTGTCATAAATGCTCCATCA IV-6J18
115 E10 IV  C32H11.13   GAAGGACTGGAGCCGTATTACTT CTTTTCCATTGCTAACCACAAAC IV-6J20
115 E11 IV  F55G11.1    ATGCAGCATTTTGTAGAGCATTT ACTTCAACGGGTTTTCTTTTCTC IV-6J22
115 E12 IV  F55G11.2    AACGTGAATACAGCCTTGCC    CCGAATCTTCAACAATCGCT    IV-6J24
115 F03 IV  F55G11.5    GACTGGAAATTTGATCAACAAGC ATCAATGTTCATTTCCATCCATC IV-6L06
115 F06 IV  F55G11.8    AACAACCCACGAGAAAATGG    TGAAAACAGCTTTGCCACTG    IV-6L12
115 F07 IV  F55G11.9    ACAACCATTATGCCCCAAAA    TGAACGAACGAGCAAAACTG    IV-6L14
115 F09 IV  K10D11.1    GGCAGTCTTGCAGTTGGATT    TAAACGTAAAAACCGCCTGG    IV-6L18
115 F11 IV  K10D11.3    CAAACCCGTAAAGTGTCGGT    CTTTCGATGACTCCCAGCTC    IV-6L22
115 F12 IV  K10D11.4    CACTTGAGGCATCCTGAACA    AGCTGTCGCGATAGACTGGT    IV-6L24
115 G01 IV  K10D11.5    CGCAAGCTTCAATACGATCA    ACTTCAATGCCCCAGTTGAC    IV-6N02
115 G02 IV  K10D11.6    CATCACCCCAGTCTAGGGAA    TGTCCAGTCACTCTGAACGC    IV-6N04
115 G03 IV  F49E11.1    AGGATTCCGATGGAACACAC    ATTCTGCAGCGACGAAAACT    IV-6N06
115 G04 IV  F49E11.2    ATTTGAAAAACTTGTGCATTCGT CATTTCATTTAAAGCCTACGTGC IV-6N08
115 G05 IV  F49E11.3    AGTGATCCGACAAAAGCGAT    TGTCGATAATCAGGTTGGCA    IV-6N10
115 G06 IV  F49E11.4    ATTGCCAGTCAACAGTTCATTCT ACGCAAAACAATTAAAACAATGC IV-6N12
115 G07 IV  F49E11.5    CCCGAAAAAGATTGGATAATAGC TCTCTTGCTTCGAGAAATAAACG IV-6N14
115 G08 IV  F49E11.6    TCTCATGATCCTCGAGAGAAAAG TCGGCTATTTACAAATTCAGCAT IV-6N16
115 G09 IV  F49E11.7    ATTGTTTCCAGTTCCAGCTATCA TTGTCGGAAGTGAAGAAAATAGC IV-6N18
115 G10 IV  F49E11.8    AACGTGCGGTATAATTGTTTCTG AAACGTGCTGCTTTTTATGAGAG IV-6N20
115 G11 IV  F49E11.9    CTCTCATAAAAAGCAGCACGTTT GAATGTTTTACTTTTGCCTGCAC IV-6N22
115 H01 IV  F49E11.11   CATGACTTTTAGTTTCCCTCACG GGTAACGAGCAGGTGTACAAAAC IV-6P02
115 H02 IV  C39E9.1 TCAAACTAAGCCAGTTTTCTTCG TAGAAGGTTCGCTATGACGGATA IV-6P04
115 H03 IV  C39E9.2 TTTTTCAGACCAAGCCAATAAAA ACTTGTTTTGCCAACTTCAATGT IV-6P06
115 H04 IV  C39E9.3 TGAAAACCCAAAAGTTTGCC    CAAGGGAGTGGCTATACGGA    IV-6P08
115 H05 IV  C39E9.4 AGTTTAGCCTTCCTGTTTCATCC GAAAACCTTTTCAATGCTTGTTG IV-6P10
115 H06 IV  C39E9.5 ATTTCAGAACCATCATGCAAACT TATGTGAGATAGGGCCGTAGAAA IV-6P12
115 H07 IV  C39E9.6 CATCACAAAAACCAATGAAACAA ACATATCAAAAATCTTAGGCGCA IV-6P14
115 H08 IV  C39E9.7 CGGAGCAATAATTGTGAAGTAGG GTATCTTGACCCAGATTTTGTCG IV-6P16
115 H09 IV  C39E9.8 CAGTTCCATGCTTTCAAAAATTC TCACTGATTTTTCTAGGCCACAT IV-6P18
115 H10 IV  C39E9.9 TCCTCCTTGATTTCATTGCTTTA CATTAGCCGGCAGAGTACATAAG IV-6P20
115 H11 IV  C39E9.10    ACGGTGGCTGGTGTTCTTAC    AGCATCGATCCGAAAATGAC    IV-6P22
115 H12 IV  C39E9.11    GTCCAATATCATGAGAGAATCGC ATTACGCAGGAAGTGAATCAGAA IV-6P24
116 A01 IV  C39E9.12    GTTTCTCGCTGGCCAAAATA    TCATTTTACGCTTGAGTGCG    IV-7A01
116 A02 IV  C39E9.13    GCCGTCTGATGTTGGAATCT    TCGCCGGTCATTTTATTCTC    IV-7A03
116 A03 IV  C39E9.14    GAGCTGCACTGGTAAAAGCC    TTCTTCGAGAAAATGCCACC    IV-7A05
116 A04 IV  B0564.1 CAGAACAAGCACCAAAAGCA    GCCTAGAATCGGAGCACAAG    IV-7A07
116 A05 IV  B0564.2 ATTGCTCGTATTTCACATCCAGT ATCGTTGATTTTGGTCATCAAGT IV-7A09
116 A06 IV  B0564.3 TTGACAGCGAGGCATACAAG    AATGGCCGATCTCTGAATTG    IV-7A11
116 A07 IV  B0564.4 TCCTTTAGAAGTTCCGGGGT    GGAATTCGTCCTTGGGTTCT    IV-7A13
116 A08 IV  B0564.5 TTCAGACCCAGGCATAGCTT    TTGGTCATTCAGCAATGGAA    IV-7A15
116 A10 IV  B0564.7 GTTGCACAGGATTTCGGACT    GTGGAGCAGTGGGTTGAAAT    IV-7A19
116 A11 IV  B0564.9 GTCTATTTTTAGGCGCGCTG    AAACGCCAAGCTATTGATGG    IV-7A21
116 A12 IV  B0564.10    CAAATTTTCGCTACCATGAGAAC TGGAATCGTTTGAAACTGAAACT IV-7A23
116 B01 IV  F09E8.1 CTAACAGGTTCGAGGCGAAG    CCACGATTTAATCCATGCCT    IV-7C01
116 B03 IV  F09E8.3 CAAAACGGATGGAATTGTCC    TCAGGGGTTCAGAATTTTCG    IV-7C05
116 B04 IV  F09E8.4 AATCCAAATGGGTGAAGCTG    AATTCGGCCAATTCCTTTTT    IV-7C07
116 B05 IV  F09E8.5 GAGGCGTACTAGCAAAGATTGAA CGTTCTCTTCTGAAGTGCAAAAT IV-7C09
116 B06 IV  F09E8.6 GAGTCAGTTTTGTCCCAGATACG TGTGATGTACTGAGTTTGCATCC IV-7C11
116 B07 IV  F09E8.7 AACAAAAACCGATCCACGAC    GCTCGACTTTCTCACTTCGG    IV-7C13
116 B08 IV  F58D2.1 TCAGGTTTATTCGGGAATCG    CAATCCAGCATGGATGACAG    IV-7C15
116 B09 IV  F58D2.2 CAAAAGCTCCGAAACCAGAG    ATCAATTGGAGAGGTGCGAC    IV-7C17
116 B10 IV  C48D1.1 GACGGCATTCCAGTAGGAAA    AACATTGCCGGTATTTCGAG    IV-7C19
116 B12 IV  C48D1.3 AAACGTCCCGATTTGAACAG    TGGATTGGAGAGATTGGAGG    IV-7C23
116 C02 IV  JC8.3   ATAACAAATGAATCCCAACACCA GATCGGTAAGTTGCTCATTTTTG IV-7E03
116 C03 IV  JC8.4   ATTCACAAGTTGCCTTCTTTCAA ATGGCGCATTTAGTAACCATAGA IV-7E05
116 C04 IV  JC8.5   TCAGGGGAAAATTTGGAGTTATT GTGAAACTTCAGAAAATCGAACG IV-7E07
116 C05 IV  JC8.6   CAGTGTTGACAATGAATCAAGGA TTTTGAACTGCCAAACAAAACTT IV-7E09
116 C07 IV  JC8.8   TCTCATCTTCCCGATCTACAAAC CCCATTCTATCAATTCGAGACAG IV-7E13
116 C09 IV  JC8.11  AAAATTGTGGAAAACACCAAATG AATCCTTTAATCCGTGACCAGTT IV-7E17
116 C10 IV  Y67H2A.a    CTCATTTCTGTCTCGAATCTCGT AGACACTTATCCCAACTCCAACA IV-7E19
116 C11 IV  Y67H2B.a    ATAATTTCAGGTATGGTCGCTCA TTCAACAATTTCGATCACCTTCT IV-7E21
116 D01 IV  Y67H2B.c    GCAATCATCTCCAAACGTATTCT AATTTTGCTGTCACGATTGAACT IV-7G01
116 D02 IV  W02A2.1 GTGATGTGATGCTGGGAAGTTAT GTTTCAGAAATTTTTCAAGCCCT IV-7G03
116 D03 IV  W02A2.2 CAATATTCTATTCGCTTTCCGTG AAAAAGCTACAGCAGCTGACATC IV-7G05
116 D04 IV  W02A2.3 ACTGGTAGTTTTGGTTGCATGAT AACCCGTTATGTTGAATGTGTTC IV-7G07
116 D05 IV  W02A2.4 TTATGCTGGTTATGGAGCTGATT TTTTGCATCCAAAGCATTTATTT IV-7G09
116 D06 IV  W02A2.5 CCCGACTCTTGATGTCATTTTAC CTGAACATTCAATTCAACCACAA IV-7G11
116 D07 IV  W02A2.6 TGGACTTCCAACAGCTTGATTAT GAGAAAAAGAAATCACCATGCAC IV-7G13
116 D08 IV  W02A2.7 CGATCAACAGGTATTCACAATCA AAAATGATGAGCAAAAGTGGAAA IV-7G15
116 D09 IV  W02A2.8 AACTCCAATAAATGGTGCAAAGA ACAGATGATAGAGTGGATCCGAA IV-7G17
116 D10 IV  Y62E10A.a   TTCAATTTTCACCGCATAATCTT ATCACGCTTTGTACGTGATTTTT IV-7G19
116 D11 IV  Y62E10A.b   TGTACATGTTGACTTCAACCCAG AGCATCAATCGAGGTATTTTCAA IV-7G21
116 D12 IV  Y62E10A.c   TGAACAGGAATCACACAGATGAC ATTTCTGAACTGGCTTTTGACAG IV-7G23
116 E01 IV  Y62E10A.d   GTGAAGATGACCGGAAAACAATA GCAGGTAATATGCGTTACGTTTC IV-7I01
116 E02 IV  Y62E10A.e   AGGAAAATCTGGCGATAAAAATC CAGTGGAATGAAGATTTACGAGG IV-7I03
116 E03 IV  Y62E10A.f   CTCCAATTCCTTTCAGGTTTCTT TGGCATTTTCTAATTGCATTTCT IV-7I05
116 E07 IV  Y62E10A.j   GTTGTTGCAAATCTTGTGTGCTA ATGTGCTCTCATTTGTCTCCACT IV-7I13
116 E08 IV  Y62E10A.l   ACTGCTGGAATGAAAAAGTGTGT GGAGACACGAGAATGACAGAATC IV-7I15
116 E09 IV  Y62E10A.m   AGAAAATGATGCTCAAAATGCTC GCTTTTGCTCATTCTGAAAGAAA IV-7I17
116 E11 IV  Y62E10A.o   TTAAAACGCTTTTGATGCTTTGT TACCTAAATGAAGGTGAAACCCC IV-7I21
116 E12 IV  Y62E10B.a   CTTCTTCTTCCTCATCGTCTTCA ATGGACAGAGTCGAATAGTGGAA IV-7I23
116 F01 IV  Y62E10B.b   AATTCCTCTGGCTTTGATTCAGT AGTGCGGAAATTCAAATTATTCA IV-7K01
116 F02 IV  K09B11.1    TACATCACAGAATGGATCACGAG AAAAAGCCCCTGCTACAGTAATC IV-7K03
116 F03 IV  K09B11.2    AAGATTTTCGGCTTCAAATTTTC ATCGAGCTTCAGTTTGATCTCTG IV-7K05
116 F04 IV  K09B11.3    CTTCCTGTTCTGTTGCCATTTAC TCGCACCAAAAACTTGGTAGTAT IV-7K07
116 F05 IV  K09B11.4    AATTACACAATTGTATCGGTGCC GTAAATGGCAACAGAACAGGAAG IV-7K09
116 F06 IV  K09B11.5    TCTTTTCGAAGAACTGAGACCAC TTCCACGTCGACAATTAGTTCTT IV-7K11
116 F07 IV  K09B11.9    TTTTCGATTTTTCGATTTTCTGA GCAACTTCTTCGAGTAAACCTCA IV-7K13
116 F08 IV  K09B11.10   CAAGGACCAAACTTTCAAACAAC CCAATGCCTCACTCTTCATAATC IV-7K15
116 F09 IV  Y38H8A.1    TGTGTGTATCTCATCGTCTCCAC CCGATTTACGAATGAAGAACTTG IV-7K17
116 F11 IV  Y38H8A.3    CCGTTCTCAACAAGCTCTCC    ATACAGAAGGCAGGCAGGTG    IV-7K21
116 F12 IV  Y38H8A.4    ATTCCGATTCACAAATTGCC    CAGACGCTCTGTCTTTTCCC    IV-7K23
116 G01 IV  Y38H8A.5    AAATCTGGATATAAACCGCCAAT AAAAATTTGGGGATTTGCTACAT IV-7M01
116 G02 IV  Y38H8A.6    TTTTGTGAGAGCATTTTCCATTT GGAACACCCTCTCTCTCTCTCTC IV-7M03
116 G03 IV  Y45F10A.1   TCCAACCACATAATCAATGTCAA ATCAAGTGGAGCCATTTATAGCA IV-7M05
116 G04 IV  Y45F10A.2   GGCCGGGGTCTTCATATAAT    TTCTTACGGAGCACTTGGCT    IV-7M07
116 G06 IV  Y45F10A.4   TCCAGACATTGGTCTCGATAGTT TAATTTCAAAAAGTGAGCCCGTA IV-7M11
116 G07 IV  Y45F10A.5   TGAAGGCACCCTTAAAGAATACA AATTCTCTTCTGCCTTTTGGTTT IV-7M13
116 G08 IV  Y45F10A.6   GCGGTTTCTTTGTGATTTTTCTA AATTCGGTTGTTTGAATTTTTGA IV-7M15
116 G10 IV  Y45F10A.8   GAATGAGCTTTGCTTTGATGACT TCGATAGAATACTCTCCCGTGAA IV-7M19
116 G11 IV  F52G2.1a    GTCTGTGGCTGAAAATTGAAATC AAAGCCGAAAAAGAATGAAAAAC IV-7M21
116 H01 IV  F52G2.3 GGGACCTAGTACCTGAGAAAGGA TTTGCCAAAACTTTGACTGAAAT IV-7O01
116 H02 IV  F52G2.4 ACGTATTCAGAATTTGCTGTGGT TATACTCAAATTTCTTTGCGCGT IV-7O03
116 H03 IV  Y45F10B.1   TCAGGAAATATTTGAGAGGCAAC TAATGATTGGGGGATGTATGGTA IV-7O05
116 H04 IV  Y45F10B.2   ACCCACAGCATCTGATGACA    TGGTTGAAGGAAACTGGTCC    IV-7O07
116 H05 IV  Y45F10B.3   TTTTTAAACATGCTTGATGGTCA ACGAGAAATGTCAAGAATGGAAA IV-7O09
116 H06 IV  Y45F10B.4   TCTCTGTTTCTTCATCGGTGATT TTTTCTGAGGCTTCAAAAGATTG IV-7O11
116 H07 IV  Y45F10B.5   TTGGTTGGAAAACAGGAAGC    AAACATTAGTCGCTCCACCG    IV-7O13
116 H08 IV  Y45F10B.6   CAAATCCCGAGAAGTACAACATC CAATTCGGACTTGTAGACGTAGG IV-7O15
116 H09 IV  Y45F10B.8   AATCACACCTGGTCTGGAGG    ACAAGGTCTCAAGTGTGGGG    IV-7O17
116 H10 IV  Y45F10B.9   GTCGATTTGGCGGTAGGTTA    TTCCAATATTTACCTCGGCG    IV-7O19
116 H11 IV  Y45F10B.10  TTTGTGATTGCAAAACCTGC    GAGAGAGCTCTTTGAGCCGA    IV-7O21
116 H12 IV  Y45F10B.11  TGTTTCTTGCACTTGTTCCG    ATCATTTCCATATGGCCGAA    IV-7O23
117 A01 IV  Y45F10B.12  CCTTTCAACTCAATTGGACAAAC CGTTTACGATTATGAAAGTTCGG IV-7A02
117 A02 IV  Y45F10B.13  CCTCCCTTAACCTCTTTCCG    ATCAGAACTGAGACCCGGTG    IV-7A04
117 A04 IV  C08F11.2    CCAGCTTAACAGAATGCATTAGC TCCCTGACAGGTTTTACAAAAGA IV-7A08
117 A05 IV  C08F11.3    CCATGCTCCAAAACATTAACTTC CGTAATAACAGTGAACCTTTGCC IV-7A10
117 A06 IV  C08F11.4    AATTGACAAATATGGCTCGAAAA ATTTATTCGAAACGGTGGAAAAT IV-7A12
117 A07 IV  C08F11.5    ATTCCGAGTCTCATTCAACACAT TCTCTAACTTTTGCAGCATCCTC IV-7A14
117 A08 IV  C08F11.7    ACAGCAGCACAGATGCTATTACA TTTTATCTTCGAAAAATGCTGGA IV-7A16
117 A09 IV  C08F11.8    TTCGAAGCCATTAAAATCCG    TGATCAGCGAATAGGGGAAC    IV-7A18
117 A10 IV  C08F11.9    ACCAATAAAAATACGATTTGGCA ATTTTCAAGGGGTGTGTAATGTG IV-7A20
117 A11 IV  C08F11.10   TGAAAATGTGCGATCTCGTC    ACAGGACATTCCTGCCAATC    IV-7A22
117 A12 IV  C08F11.11   TTCTTGCTGTTTCTTGTTCTTCC ACAACTTGTGCGCACTGTACTTA IV-7A24
117 B01 IV  C08F11.12   ATTTCGCTATTAAAACTGCTCCC AGAATGTTCAGAAGTGGTTGCAT IV-7C02
117 B02 IV  C08F11.13   TAACCGAGAGCCGTTGAAGT    TCTCGGCGTCTATTTCGTCT    IV-7C04
117 B04 IV  Y45F10C.2   ACTGCCGAAGATTTGACAAAATA AGAATGTTCAGAAGTGGTTGCAT IV-7C08
117 B05 IV  Y45F10C.3   TGACTGTCCGATGGTGAAGA    TTGATGAATTGCCAATCGAA    IV-7C10
117 B06 IV  Y45F10C.4   AAAATTGCAAGAAATCGCCTTAT AAAATGAAAGCGAGTGTGGAGTA IV-7C12
117 B07 IV  Y45F10C.5   ACGTTGGAAATTTTTCTGTTTCA TCCAATTGGGCACAATAGTAATC IV-7C14
117 B08 IV  T23G4.1 TTTGTTGCATTGTTGGTGGT    CAAAAGAGCCGACACTCACA    IV-7C16
117 B09 IV  T23G4.2 TAGATATTCGGAATCAGGAGCAA AAATTGTCTGAAAAAGACACCGA IV-7C18
117 B10 IV  T23G4.3 AAGGACAGGCCTCAGCATAA    CGGAATAACGGAGTGTCGTT    IV-7C20
117 B11 IV  T23G4.4 GCATCGGATCTCTTCACTCATAC AGAGGTCTTGCCACAATTTACAA IV-7C22
117 B12 IV  T23G4.5 CACCTTGATTTCTCTTCAAATCG TTTATTGAGCAGCAGTCTTCCTC IV-7C24
117 C01 IV  C47A4.1 CAGACAACCCATGCTTTTTACTC CTTTTTCATAATCGGACTGAACG IV-7E02
117 C03 IV  C47A4.3 GATCCAAATTTTCCCCAGTTTAC GGTGTATTTAAAGCCCAAAAACC IV-7E06
117 C04 IV  C47A4.5 TGTTTTTCTTCATCACGGAATCT TTCACACTCCCAGATTCAAACTT IV-7E08
117 C06 IV  Y45F10D.1   CACACATATAGAGGCTGGAAAGC GGATGATCTCAAACAGTCTGTCC IV-7E12
117 C07 IV  Y45F10D.2   AAATGAGATGCAATGTGTGTGAG CATAAAATGTTGGGATTCATCGT IV-7E14
117 C08 IV  Y45F10D.3   TTCAGAAAACGCGAAGGTCT    TCGACACTCGTTGAGCAATC    IV-7E16
117 C09 IV  Y45F10D.4   CAGTAAAGCATCAAAAACCTTGG GACGTCAAAATCACAATGAGACA IV-7E18
117 C10 IV  Y45F10D.6   ATTTGATTTTCCGAATTTTCGTT TCAGATCATTTCAAAATAGCCGT IV-7E20
117 C12 IV  Y45F10D.8   CCAGCTTCTAATGTTTCCTTCCT AGAAATCATGCTCCAAGATGGTA IV-7E24
117 D01 IV  Y45F10D.9   TCGAATCTTTTTCCTTCAAATCA TTTTTCAGATTTTCTCCCACAAA IV-7G02
117 D02 IV  Y45F10D.10  GAAGCAACAAATGGTTCTAGGTG GGTTTTTATCAGTTGGGAGTCCT IV-7G04
117 D04 IV  Y45F10D.12  ACCAAAGAGTGAGAACCCTTACC GACACATTTTTATTCGGCATGAT IV-7G08
117 D06 IV  H08M01.1    TTTCGCAGCAATGACTTTTG    AGTCCCGCTCCAAGGTTAGT    IV-7G12
117 D07 IV  H08M01.2    AACAGAAGTAGACGGCCCAA    CGCTTTTCTATCGGTTCTCG    IV-7G14
117 D09 IV  B0513.2 ATGTTGCGTGAACAAGTTGTATG TGTCTACTTTCGGACATCATCCT IV-7G18
117 D10 IV  B0513.3 CGTCTCCTCTTTTCACACACTCT CATACAACTTGTTCACGCAACAT IV-7G20
117 D12 IV  B0513.5 ATGCACATAACACGTTCCGA    AAACCGACACAGAATCCGTC    IV-7G24
117 E01 IV  B0513.6 ACAGTAAAAGGAGCAGGCGA    CCGCACATTCATGTACCAAC    IV-7I02
117 E02 IV  B0513.7 GAGCTGGCTCCGTAGATTTG    TTGGTCATTCAGCAATGGAA    IV-7I04
117 E03 IV  B0513.9 CGGAAAATCGAAAATGGAAA    CCATGTCCAAGTTATGCACG    IV-7I06
117 E04 IV  Y37A1A.1    CTCTATTAGTAAGGCGTGCGAAA GTCCCCTTTCAGAAAAGATTCAT IV-7I08
117 E05 IV  Y37A1A.2    AATTCATTGGAAAGTAAACCCGT CAACAGTTGCTGAAATGAGTCAG IV-7I10
117 E06 IV  Y37A1A.3    CATAACTACAAAAACGGGACGAG GTGTCATCCCTTATCAATGGTGT IV-7I12
117 E08 IV  C27H2.2 ATGATGTGACGTTGAAATGAGTG TTGTCACAAAAGAGAATTCCGAT IV-7I16
117 E09 IV  C27H2.3 GCAATTGAAACGGCAAAAAT    ACGTTTTCCCATGAGAGTCG    IV-7I18
117 E10 IV  Y37A1B.1    AACGTGAGGCTCTGGAGAAA    CAGCATGTCGTTTGCAGTCT    IV-7I20
117 E11 IV  Y37A1B.2a   TGGACTTTTCGTTTGGTCTTTTA TCGCTACCAAACTTAATGAGGTC IV-7I22
117 E12 IV  Y37A1B.3    CAGAGTTTCCCAACCCTCAA    CAAAGCTGAAAGGGCTGAAG    IV-7I24
117 F01 IV  Y37A1B.4    GTTGATCACTCGAACTAAATGCC CCAAGTCGTGTGATTTTAAGAGG IV-7K02
117 F02 IV  Y37A1B.5    ATTCCCCTTTTTAGAGCTGTGAC TAAAAATTCCTGATCCAAGAGCA IV-7K04
117 F03 IV  Y37A1B.6    TTGTCCTGTTTCACTTTGGAGTT AAATACATGAAACACGCACCTCT IV-7K06
117 F04 IV  Y37A1B.7    TCACTACCTCCAAGTTTATCCGA AAGAAATCGCACAATGACCTAAA IV-7K08
117 F05 IV  Y37A1B.8    TTAGTTGTTTTGGGTTGGATGAC GCATGTTTCGTTTGTGTTGTAAA IV-7K10
117 F07 IV  Y37A1B.10   GAATCTGGCATCTCCCAAAA    TTGGTCATTCAGCAATGGAA    IV-7K14
117 F08 IV  Y37A1B.11   AATTGGTCTTGCTCTTACCACAA CGCTGCTAGAAACACTGAAAAAT IV-7K16
117 F10 IV  Y37A1B.13   TGAATTCTCCATCCTTTGCC    TACACTTGCTGCGGTGAAAC    IV-7K20
117 F11 IV  Y37A1B.14   GAGTTCCGTCTACAGCCTGG    CCCCACTTCTTTCGTTCAAA    IV-7K22
117 F12 IV  Y37A1B.15   TTGCAGAGCCATCATTCAAG    TCGTCAAGCAGAATGACCTG    IV-7K24
117 G01 IV  F52B11.1    AACATCCTCGTCAATGTCTCAAT ATCATAATCGACAGAGCATTCGT IV-7M02
117 G02 IV  F52B11.2    AAAAACCCCAACATTTTCAGACT AATATCAGCCAAGATCGCTGTAA IV-7M04
117 G03 IV  F52B11.3    CTTCCTGCTTCATCTACGCC    TGAAAGAGCAAAGCAGAGCA    IV-7M06
117 G04 IV  F52B11.4    CAAATGACAGAATTGCCACG    CGAGGTAAACCACATCCGTT    IV-7M08
117 G05 IV  F52B11.5    CTAATATTTTGCGTCGGTTTCAG CAATAAACTGTGTCTCCCTTTGC IV-7M10
117 G07 IV  F52B11.7    CAGCAGCATAAGCCTTAAGAAGA ATACCGAAAAGCTATCTGGAAGG IV-7M14
117 G08 IV  Y37A1C.1    TCGATGATGAACATGACAAAGAC CAATCCAACTTTATGCCACATTT IV-7M16
117 G09 IV  H12I19.1    TTGAAGCCGATCTCCAGAAT    TGAACTCGCAGTTGTTCGAC    IV-7M18
117 G10 IV  H12I19.2    GCTACAAAAACAATCAAAAACGC TCAGGACCGATAAAACAGTTCAT IV-7M20
117 G11 IV  H12I19.3    TCAAATGTTCCGTGAGTTTTTCT TCCGATTTCTTTCTTGTCATTGT IV-7M22
117 G12 IV  H12I19.4    TTACGGAACTTTGACCGTCC    AAAAGTTTTTGCCAAACCCC    IV-7M24
117 H01 IV  H12I19.5    GAACTGTTGCATTTTGAGGAATC AATTACCAGCGGGAACTATTAGG IV-7O02
117 H02 IV  H12I19.6    AAATGGTAGTCGGTTGGTGC    AATCCCAAATCTACGGACCC    IV-7O04
117 H03 IV  R05A10.1    CAGTAATGATTCTCCACTCCCTG CAGAAATTGCTGCTCTCCACTAT IV-7O06
117 H04 IV  R05A10.2    GAAAATGGCTGAACAATTTGAAG TTTTGATTCTGCGGTCATTAACT IV-7O08
117 H05 IV  R05A10.3    AGGTGTCGGGCTCTCTAACA    AGGAGCAAGAAACAGTCGGA    IV-7O10
117 H06 IV  R05A10.4    ACCAAAAGGATTACCCCAGATTA GATTTATGTCGGCTGCAAAGTTA IV-7O12
117 H07 IV  R05A10.5    AAAACTGCCAAATTCAGAAAACA TAGTGGCAATTTATTCCCAGAGA IV-7O14
117 H08 IV  R05A10.6    GCCGGTCAAATTCGAAAGTA    TATTGTCAAAACGCAACCCA    IV-7O16
117 H09 IV  R05A10.7    AAGATTATGCTGACTGCTTCAGG CGTAGATTTGGAATTATTCGCTG IV-7O18
117 H10 IV  R05A10.8    GACGTGTCTACCATTTTTATCGC TATCCTTCAGTTTTGACCTTGGA IV-7O20
117 H11 IV  K01G12.1    ACCTGCCTTCAATACGATGG    GCGATAATGGATGGGTCAAC    IV-7O22
118 A01 IV  K01G12.3    CCGTGCTAAGTCATCTGCAA    CCTCTGCACCATGTTTCTCA    IV-7B01
118 A02 IV  F02H6.1 TTTGAGCAGCAGCAAGAAGA    ATTGCCTCGTTTTCGTGTTC    IV-7B03
118 A03 IV  F02H6.2 CGTGTCGAGCCATCTACAAA    TTGTGAAGCTTCTCCGGTTT    IV-7B05
118 A04 IV  F02H6.3 TTCAATTTTCCAGTAAACTCCGA CAATTCTCGACAGTCCCTTTATG IV-7B07
118 A05 IV  F02H6.4 CAGTGGCAAAACATAAGCGA    CGGATAAGAGCTTCTCGTCG    IV-7B09
118 A07 IV  F02H6.6 ACCTAAGGTTGCCCTGAGTTTAC AAATCTCAAATGCAGCAGATTGT IV-7B13
118 A08 IV  F02H6.7 TTTCAAGTCTCTTGGAATTTTGC TATGTCCAACAGGAGGAATATGG IV-7B15
118 A09 IV  Y64G10A.a   TCTTTCAGGTTTCTTCACGGATA TGAAGCTCCTTGTTGTAATGGTT IV-7B17
118 A10 IV  Y64G10A.b   TTACCCCAAACAAAAACTCAAGA AGTTTTGGAAAAAGGAAATCTCG IV-7B19
118 A11 IV  Y64G10A.c   TAGGATGCGAATAAATGTAGCGT TAAACGAGGTTGTTGTTGTTGTG IV-7B21
118 A12 IV  Y64G10A.d   GTCCCCTTTCAGAAAAGATTCAT GAACTTTAAAAATGCTCCGGTTT IV-7B23
118 B01 IV  Y64G10A.e   TCATTATGAAATTTGGGATTTCG TTCCCTGTATCTCCTACTCACCA IV-7D01
118 B02 IV  Y64G10A.f   AGATTTTGCCTCCCATATTTGAT AATCACAAACTCCTCCATTCTCA IV-7D03
118 B03 IV  F55B11.1    ACTTGCGCACAAACATTCAG    ATTCCGAGTTGGCAATTGAG    IV-7D05
118 B04 IV  F55B11.2    GTGACGTGGAAGATGTAATGTGA CAGCCACATTTTGTAAGTTTTCC IV-7D07
118 B05 IV  F55B11.3    AAATCCCAAAAACTCGCCTT    GACTGGGAACACGGACCTTA    IV-7D09
118 B06 IV  F55B11.4    TAAGAAAGTGGACAGAAAACCCA TTTTGTGAATCCCGTTAATTGTC IV-7D11
118 B07 IV  LLC1.1  GAAAAATGGATATGTTCATCGGA ACGGCTGTTAAGAACAAATTTCA IV-7D13
118 B08 IV  LLC1.2  CAATTTTGAAATCCAATAGAGCG ACAGAGTGCGTGTTGTTTAGTCA IV-7D15
118 B09 IV  LLC1.3  TTTTCGTGATTTTTGCGTCA    TGTTTCTTTCCATCCTTGGC    IV-7D17
118 B11 IV  Y57G11A.2   GAGTTCGACAAGAGTTCGGC    GTGGACTGGTTTTGGGAGAA    IV-7D21
118 B12 IV  Y57G11A.3   TACCAATTGATTACGAATGACCC ATTCGAAAAAGGTGAAAGTGACA IV-7D23
118 C02 IV  Y57G11A.5   TGTCTAAGGGAAAATATGCCAGA AAGCAATAGCTCTGACAACCAAG IV-7F03
118 C03 IV  T27E7.1 TTCAAAGAGCCGTACAAAAGAAG ATCCTATAGCCATGCAGAAACAA IV-7F05
118 C04 IV  T27E7.2 TAAATTTGCCAGATCAAAATGCT CAGATTTCATGCTCTCTGGAGTT IV-7F07
118 C05 IV  T27E7.3 TACCGTTGTATTCTTTCTTGGGA GGAGCCAGTGTAGGTATCACAAC IV-7F09
118 C06 IV  T27E7.4 ATATGCAAGGGATTTCAGCG    GGCTGGAATTTGGTTGAGAA    IV-7F11
118 C08 IV  T27E7.6 AGTTGTCCAGGCGTGATTTC    CCGGAAATGTTCAGCAAGAT    IV-7F15
118 C09 IV  T27E7.7 TCGGTTTCATTCAAAAATAGGAA AATTGCATATCAACAAAACCCAC IV-7F17
118 C10 IV  Y57G11B.1   CACATCTTCCACTGGCTCAA    AACGATTAATTCGGTGAGCG    IV-7F19
118 C11 IV  Y57G11B.2   GTGATTTTCGATCACCTGCTATC TTCAAACTTGCGAACTTGATTTT IV-7F21
118 C12 IV  Y57G11B.3   GTGAATATATGCTTCTGCCGTTC CCAGATTTCGAACATCATTCATT IV-7F23
118 D01 IV  Y57G11B.5   ACTGTCTTCAGGCAAAGTCTACG AGCAAAACAAACGTGTTGAAAAT IV-7H01
118 D02 IV  F13G11.1    GTCTTGAAGGACGAAGTGGC    AAAAACACCGTAGGTGCAGG    IV-7H03
118 D03 IV  F13G11.2    TCCACGACGTTTCAAATTCA    AAACGCGGAGTATTACGTGG    IV-7H05
118 D04 IV  Y57G11C.1   TTGGATCACTGGCTGTTCAC    CCCCATTTGAAACAGGCTTA    IV-7H07
118 D05 IV  Y57G11C.2   AAATTCCAGGTTATGACAGCTCA GTAATTCCCAAATTGACCCTTTC IV-7H09
118 D08 IV  Y57G11C.5   AGTGAATTTAAGCCGCGCTA    TCATCTGCATGCTTTGGAAG    IV-7H15
118 D11 IV  Y57G11C.8   GGTGAACGTGGAAGTCTGGT    CGCTTGATGGTGACGACTTA    IV-7H21
118 E02 IV  Y57G11C.11  AATGTACCCGATTTATTGTGTGG TTTTTCCTGGTAGATGATCCCTT IV-7J03
118 E03 IV  Y57G11C.12  GTTGAGGAATTTGGAGAGGAAGT CCGTTCAACAACAACTAAAGGAC IV-7J05
118 E05 IV  Y57G11C.14  GGCATTTAGTTAACGTGTTGCTC CATGTTTCGGTACGTTTTCAAAT IV-7J09
118 E07 IV  Y57G11C.16  TTTCACTCGTGCATCTCACTAAA TTTCGGGATACTAGCAACAAAAA IV-7J13
118 E08 IV  Y57G11C.17  TGAGAAGCATGAGTGTTGCC    TTCCATGTTCCACGATCTCA    IV-7J15
118 E09 IV  Y57G11C.18  TCAGTGTTTTGTGGCGTCTC    AGCAATTGGCTACGCTTGTT    IV-7J17
118 E10 IV  Y57G11C.19  TCTTGAAATTGGCATGGACA    ACCTTGCGCCTATTCATCTG    IV-7J19
118 E11 IV  Y57G11C.20  GGACGAACCATTAAGCGAAA    GTTTCGGATCAATCGCAACT    IV-7J21
118 F01 IV  Y57G11C.22  ACCATTGATTAATTTTGAAGCGA ATGTCGTGTATTGGAGACATTCC IV-7L01
118 F02 IV  Y57G11C.23  TCGTTTTAGCATAATTGCTGGAT TTTGAAGAAAATTACGCCGATTA IV-7L03
118 F03 IV  Y57G11C.24  AAGATTATGGAAAGGGAGAGTCG ATCAATTCATGATAATTTTGGCG IV-7L05
118 F04 IV  Y57G11C.25  TTCATGAACTTTTCCAATTTTCG CTCGAATTGATCAAGCACAGATT IV-7L07
118 F05 IV  Y57G11C.27  TTTGACTTCTGTCCTTCTTCGAG CTGGAATACGGTAATGTTGAAGC IV-7L09
118 F06 IV  Y57G11C.31  CAGAAAACTTAATATCGCCGTTG GAATAAAACCAATCATTGCCAAA IV-7L11
118 F07 IV  Y41E3.1 AAATTTTGCATTTGGAACGC    GATCCCAGTAAAAGTCCGCA    IV-7L13
118 F08 IV  Y41E3.2 AGTTGGTAGAGGGCTTGAAGACT AATGGACATCGATTCGAAGATTA IV-7L15
118 F10 IV  Y41E3.4 TCCTCTTCCTTTTCCGGATT    CAGTTGGCGACAAAGTTGAA    IV-7L19
118 F11 IV  Y41E3.5 CTTCCTTTGGGAAACATCTTCTT GCAACCAGAAAGCTCTGAAATTA IV-7L21
118 F12 IV  Y41E3.6 GTATCCGTCAGTTCATTTTCTGC TGGACTTTTGAATTAACATGGGT IV-7L23
118 G01 IV  Y41E3.7 ACAGTAACCGAGAGTATGGTGGA AAAAATAAATTAGCGGCTTTTGC IV-7N01
118 G03 IV  Y41E3.9 AAACGGCAGGATGAGAGAGA    TGAAACACCCATCTGTCGAA    IV-7N05
118 G04 IV  Y41E3.10    AGTATTTCTAGCGCTGTTGTTCG AGGCCTTTAGATCTTGTTGAAGG IV-7N07
118 G05 IV  Y41E3.11    GTGTTCCGAGGATCCGTCTA    ACTGTAACCACCGCTATCCG    IV-7N09
118 G06 IV  Y41E3.12    CGGTATTTCACACGATCAATTCT GGAGCTACTGTAACTTTGGAGCA IV-7N11
118 G07 IV  Y41E3.13    GTGAAGAAGGGAGCAGACATCTA TACTTTTAATGGTGCCAGTCGTT IV-7N13
118 G08 IV  Y41E3.15    CAAAGAAGCTAGCCAATGAAGAA GAAAAAGAGCCCAGTAAAGAAGC IV-7N15
118 G09 IV  M199.1  TAACTATTCCAGCAATGAACCGT AAGCTTTCGAACTCTGTCCTCTT IV-7N17
118 G10 IV  M199.2  CATATCAACTTCCACGTGAACAA TTCTATTGGGCAATGTCAAAACT IV-7N19
118 G11 IV  M199.3  AGTAGGATGGTACCCAATGGAAT ATTCCTCGTAATGACCAACTGAA IV-7N21
118 G12 IV  M199.4  TACTGCAAAACATGTTGAATTGG AGACATGGTTCGTCACTTCCTTA IV-7N23
118 H01 IV  Y40H7A.1    ACTTAATAATGAGGCGCATTGAA TTTTTATGCGAGGTCTTTTGTGT IV-7P01
118 H03 IV  Y40H7A.3    GTCGGTCGCTTTTTATTTTCTTT ACTGCACGTAAAACAGTGGAAAT IV-7P05
118 H04 IV  Y40H7A.4    AAGGTAAAATCGTTTGTGGGAAT GTTATTAACGAAAACGAAAGGGG IV-7P07
118 H05 IV  Y40H7A.5    TTTTTGGGTGAGCATGTTTTTAC AGTGTTTAAATTTCTGGGGCATT IV-7P09
118 H06 IV  Y40H7A.6    TCGATACTCGTTGATAGCCATTT CACGGAACTAATTCAGAAACCAG IV-7P11
118 H07 IV  Y40H7A.7    CTCCCTTCAACAATTTTCTTGTG TTTTTCACTGACTTTTGATCGGT IV-7P13
118 H08 IV  Y40H7A.8    GAAAAAGGAACCAGCAGAGAAAT TCTTCCATATCGCTTGTTTGATT IV-7P15
118 H09 IV  Y40H7A.9    AGTTGAGCATTGACGGTTAAAAA ATTGACCTGAATACACTGTGCCT IV-7P17
118 H11 IV  Y40H7A.11   ATTTTTGCAACTCGAACACAAAT AAATCCCCAAATCTACTCTGCTC IV-7P21
118 H12 IV  Y73F8A.a    TTTGATTTTCGTTTTACATCGCT CCTAATCGGCATGTTACATTCTT IV-7P23
119 A01 IV  Y73F8A.b    CAATATCCTTTGCAGATCTGGTC AGCATTTGGATCTTGTACCTCAA IV-7B02
119 A02 IV  Y73F8A.c    TCTACTAAATTTTTGTGCGGGAA AAATCTCACCGTAGGAAACAACA IV-7B04
119 A03 IV  Y73F8A.d    TTTACACTCTGGGAACCCCTAAT AAACGTTAGAGAGCGTTTTTGTG IV-7B06
119 A05 IV  Y73F8A.f    TGTGGGATTTATTCAAATTTTCG TGTTGTCAAGGCTATATCTGCAA IV-7B10
119 A06 IV  Y73F8A.g    CCATATGTCCCCTCCTTATTCTC GGAAAAATTAAAACAAGGGCATC IV-7B12
119 A07 IV  Y73F8A.h    ACGGTCTAGTTTTCTAAGTGCCC ATACAATACGGACGCAAACAAAC IV-7B14
119 A08 IV  Y73F8A.i    AAACAGTTCTCCAACCAGCAATA ATGAGGGAACAGTCTTAAGAGGC IV-7B16
119 A09 IV  Y73F8A.j    ATCAGTGAGATGGGAACTAACGA ATTTGGGTACCCTTACCGTCTTA IV-7B18
119 A10 IV  Y73F8A.k    ATCGAATCCAATCCGTAAAAGTT TCTTCAAGATACAGAAAGCTCCG IV-7B20
119 A11 IV  Y73F8A.l    ATAAACTCTGCAAAACGGTGAAA TGAAAATTGGTGAAAATTCTGCT IV-7B22
119 B01 IV  Y73F8A.n    CTAACCCCAAACTGATATCCCTC CCCAACAATATTTTCTGATTGGA IV-7D02
119 B04 IV  Y73F8A.q    GACTCAAGACCCATGACGAATAG TTTTCCACAATTATCGCTGACTT IV-7D08
119 B05 IV  Y73F8A.r    TAAAATTGTCCTGAAACGCCTAA TAAAATTGTCCTGAAACGCCTAA IV-7D10
119 B06 IV  Y73F8A.s    CGGATGAAATCTCTACAGTGACC TTTGGCAAAACTATTGAGCATTT IV-7D12
119 B07 IV  Y73F8A.v    TCTCGTCTACTCACGGAGAAAAG TTTTTCTTTCGGGACATCTACAA IV-7D14
119 B09 IV  Y105C5A.a   AGATTCTCATCGATTGTCTCCAA AACAACATTTTGGCCTGACTTTA IV-7D18
119 B11 IV  Y105C5A.c   TGTAAAAGACCGTGTTCTTTGGT CATATGTGTATTCCCGCCATACT IV-7D22
119 B12 IV  Y105C5A.d   TGAGACTTCTCTCATAACAGCCC TTGGACTATTTCTTCCTCATCCA IV-7D24
119 C02 IV  Y105C5A.f   CTCCTTCCCAAAATCGTAGAAGT GTGATTCGTACTCGTTCGGATAG IV-7F04
119 C03 IV  Y105C5A.g   TTCGTTCAAAATGAAAACGAAGT TTTTCCAGCAATTTCCAAAAGTA IV-7F06
119 C04 IV  Y105C5A.h   GTTTGTACAGTTTTCCAGGCAAC CGACATCAGGATTTTATGGAAAC IV-7F08
119 C05 IV  Y105C5A.i   AGTGTAGAAATGAAACGTAGGCG CTGTGGACAGACTAAACGAAAGC IV-7F10
119 C06 IV  Y105C5A.j   ACATTAATATTGTCACAACCCGC CGTTCAAAACCTTGTCTCAAATC IV-7F12
119 C07 IV  Y105C5A.k   TTCTTGCATTCTTTTTCTCAAGC ACATTTTTCATTGGATTTGGCTA IV-7F14
119 C08 IV  Y105C5A.l   GGGACATGATGATTGATTAGGAA GTTGTCTTTACAATTTGCTTGCC IV-7F16
119 C09 IV  Y105C5A.m   GAGCAGGAACAATTACCTCAATG TATGTTGATCTCCCTTTCCTCAA IV-7F18
119 C10 IV  Y105C5A.n   TTCCAAAGTGAAAAGGTGAAAAA TCATGCAGTCATTATCAGATTGG IV-7F20
119 C11 IV  Y105C5A.o   TTTCTGCCATTTTATTGACGAAT AACAATAACCTCGTTTGCAGAAA IV-7F22
119 D02 IV  Y105C5A.r   GCACGATTTAAGTTCACTCAACC GTGACCTCAAATAGCACTCCAAC IV-7H04
119 D03 IV  Y105C5A.s   ATTCAAAGTTGAAAGGCAAACAA AATTAGAAGAATTTGGAGGCCAG IV-7H06
119 D04 IV  Y105C5A.u   ACTGTGCGAAATTGTCAAAGATT ATATGGTAGCCAGCAGATGATGT IV-7H08
119 D06 IV  Y105C5A.w   TCTGTTGGAACGGAGAAAATAAA GTCATATCCCTTTATGCAAGCAG IV-7H12
119 D07 IV  Y105C5A.x   TTGACGAACTGAATAGCCATTTT GCATTATTGCATTCTTGGTAAGC IV-7H14
119 D09 IV  Y7A9A.1 AAACCCTTTACGCCGATCTT    TTGGGTACACAATTGCCAGA    IV-7H18
119 D10 IV  Y7A9A.2 TTGGGAGGCAGTTATGAACTTTA AATTGGCTTTTAGCTATGGAACC IV-7H20
119 D11 IV  H25K10.1    ACCTAACCACAAAACGAGATCAA ATGTATCCACAAAATCCGTGAAC IV-7H22
119 D12 IV  H25K10.2    GCAAAATGAGTGATGACAATGAA TTCCCTTCAAAATTCTGATTCAA IV-7H24
119 E01 IV  H25K10.3    TACAAGTACCGTGCTTTTCCAAT CTCTGACCAATCAGGGTTAACAG IV-7J02
119 E02 IV  H25K10.4    TCTAATGCCTTTGGGAAGTTGTA ATTACTTCTCTGGAAATCTCGGG IV-7J04
119 E03 IV  H25K10.5    TTATAGTTCATTCCACCATTGGC TCTTTATAAGTGCCAAATCCGAA IV-7J06
119 E04 IV  H25K10.6    GATCTTGGTGGAATATGTACGGA CCATAGTAATCTCCAATGAACGC IV-7J08
119 E05 IV  H25K10.7    ACAGTGTTCAGAGAGTCTTTCGC TAGTGATCCGACTTTCCAATGTT IV-7J10
119 E06 IV  Y7A9B.1 CCACCTTCCGATCAAAAGAA    AACAGGAACGGTCCACAGAC    IV-7J12
119 E07 IV  F38C2.1 ACATTTATACCAAAAACATGGCG AATCTCATTTCAATTCGCTTCAA IV-7J14
119 E08 IV  F38C2.2 AAAACCGTGGAAAATTTTTGTTT TTTTGCCTGGAAAGTTTGTTTTA IV-7J16
119 E09 IV  F38C2.4 ATAAACGCATTGAAAATCGCTAA TAGCAACGGAGACTCTCTGAAAC IV-7J18
119 E10 IV  F38C2.5 ATTGGATAAAGTTTCAGCGTTCA ACCCCAGAAATTTCCAGATAAAA IV-7J20
119 E11 IV  F38C2.6 AAACCTATGCGAACCCTGTG    TTTGGTAACCAGGCAAAAGG    IV-7J22
119 E12 IV  F38C2.7 GAAAATGACAAACGATAATTGCC TAGGATCCAGTTAGACGAAACCA IV-7J24
119 F01 IV  Y7A9C.1 AGCCGAGATTTTTAGCGTCA    ATTTTCTCGATCAACCGTGC    IV-7L02
119 F02 IV  Y7A9C.3 AAGAATAACAACGCATGGAAGAA AGTGCGAGAAATCACTGAATAGC IV-7L04
119 F03 IV  K03D3.1 TCAGTTTTGCATGGTTTCCA    CAGCTGCGCATTTTCTGTAA    IV-7L06
119 F04 IV  K03D3.2 CTTGTGTATAGAGCACATGCCAC ACGTTAAGCCTGAATAACTGCTG IV-7L08
119 F05 IV  K03D3.3 AAATCGTTGTTGCTGGGAAG    ATTCCACCTGCTTCGATCTG    IV-7L10
119 F06 IV  K03D3.4 CCTCTAGGAAAGAACGCACG    ATCGGGGGAGTTCATAGCTT    IV-7L12
119 F07 IV  K03D3.5 CCACGTGTGTGTTCAGAGTTAAA ACCTGTTTGCATTAATCAGTCGT IV-7L14
119 F08 IV  K03D3.6 ATTGCAAGAAAACCGGACAC    TGAGGGGCAGATCCTTACAC    IV-7L16
119 F09 IV  K03D3.7 TATCACATCATTGCCCAAATACA TTTTTCCGACCTGAAAATATGAA IV-7L18
119 F10 IV  K03D3.8 CCGGAAACAACAGAGAAAGC    TGAAACCATGATGACAGGGA    IV-7L20
119 F11 IV  K03D3.9 CCTGTTCTTGAACCAATTTTCAG GGAAAAGACCTAGAATGAGGGAA IV-7L22
119 F12 IV  K03D3.10    TCAAATGTGTCGTCGTTGGT    AGTTCTCCAATTTCCTCGCA    IV-7L24
119 G02 IV  C35D6.2 TGGGAGCAGAAAACAAAAATAAA AGACGAGTGGTGCAGAAGTTTAG IV-7N04
119 G03 IV  C35D6.3 CTACGGCTTGAAGGGTAATTTCT TAATACGATTGGAGCCTTCAAAA IV-7N06
119 G04 IV  C35D6.4 TCTTCTATCGTATTCATTCCCCA ATAGGAGGGGGTTACATGTAGGA IV-7N08
119 G05 IV  C35D6.5 GCTAGCCAACCTGTAATATGTCG GAATTTCTGTTGCGTTGAAAATC IV-7N10
119 G06 IV  Y7A9D.1 TTTCTCAAATTCGCTTCAGTTTC CTGACTCTTCACAGACCGCTATT IV-7N12
119 G07 IV  Y65A5A.1    AAAATTTTCATCGCTTCTTTTCC TGTGATAACCACTACACCACGAG IV-7N14
119 G08 IV  Y65A5A.2    ATAATATCATTGTGGAAGTGCCG TAAAAATCACGAAAAACGGCTTA IV-7N16
119 G09 IV  Y65A5A.3    ATCAGAATTGTATGGGCTGAAAA TCCGAAGAACAATCCACAGTAAT IV-7N18
119 G10 IV  Y51H4A.a    ATGAGTACGCGAAACATGAGATT TCAGAAATTTCCAAAACCAAAAA IV-7N20
119 G11 IV  Y51H4A.b    ACAACAACAACAACAATCAGCAC GTTTCTGGTGGACAGAGAAAATG IV-7N22
119 G12 IV  Y51H4A.c    AATTCGGAGAAATTAGCGAAAAC TCGGATTCTATAAAGGCATTCAA IV-7N24
119 H01 IV  Y51H4A.d    GGGAATGAAAACTCCAAAATAGG TGAGAAATGTTTCAAGTAGGGGA IV-7P02
119 H05 IV  Y51H4A.h    TTACATTGACCACTTTTACCGCT TCGAGACGTTAGATTGCTTCTTC IV-7P10
119 H06 IV  Y51H4A.i    TTGAACATGACTTGCTACGAAGA TTTTCAGATGGAGGATTCAAAGA IV-7P12
119 H08 IV  Y51H4A.k    TCAACACTCTCAAACAAAAAGCA AGTTTTCCAAGTTTCTAGGCCAC IV-7P16
119 H09 IV  Y51H4A.l    TCTTGTTTTGGTGGATCTTGTTT TTTTAAAGGCCAAAATATGGGAT IV-7P18
119 H10 IV  Y51H4A.m    TTCTGAGGTTTCTGGTCATCAAT AAGGCACAAAGAAACACAGAAAA IV-7P20
119 H11 IV  Y51H4A.n    GCATTTCTGTCCTCCACTAATTG AGCATATTCGCTTGACAAAACAT IV-7P22
119 H12 IV  Y51H4A.o    TTCCCATTCCCTTCATTAAAAAT CAAAGTGAAAACCGAAAGAAATG IV-7P24
120 A01 IV  Y51H4A.p    TTCCCATTCCCTTCATTAAAAAT TTCGGTTTTCACTTTGTATTGCT IV-8A01
120 A03 IV  Y51H4A.r    CAGTTTTTCTGACATTTGGTTCC CCTGCTTCTCGATTCTCTCATAA IV-8A05
120 A04 IV  Y51H4A.s    GAATGGAATTGTGGTTTGAACAT AATGGGTACGTTGTTATCACAGG IV-8A07
120 A05 IV  Y51H4A.u    AAACGAAATTTTTGTGCTTTTCA TGGGGAAAGTGATGACTTGTATT IV-8A09
120 A07 IV  Y51H4A.w    GGCAAAAACTATCGAACTCACTG ATTCTGCTCTGAAGAGATGAGCA IV-8A13
120 A08 IV  Y43D4A.a    TCGAATTCCACTCATCAAAAACT GTCGGAGGTTTTATTGCTAAACA IV-8A15
120 A09 IV  Y43D4A.b    CATGCTACCGATTTGTGTGATTA TTTGGGGATGAATTCGATAATTT IV-8A17
120 A10 IV  Y43D4A.c    TTTTGCTAAATTTGAATGATGGC GATCCAAATTTTCCCCAGTTTAC IV-8A19
120 A11 IV  Y43D4A.d    GGTTGATTTAGGAACTGCAAGTG ACAAGTGATACATCAATGCTCCC IV-8A21
120 B01 IV  Y43D4A.f    AAGTTCATGGAGGACTTGATTGA ATACAACGGATGTTGGTGGTAAG IV-8C01
120 B02 IV  Y43D4A.g    TGTCAACTCATGCACCATAAAAG ATACTACGAAGGCACCAAACAAA IV-8C03
120 B03 IV  Y116A8A.1   ATTTTGCTTTCTAAAACCGAACC ATTAATGGATACTGGATGCAACG IV-8C05
120 B04 IV  Y116A8A.2   CCCGTTAAATACCAACAAATCAA ACGAAAATTGAAAAATTTGGGAT IV-8C07
120 B05 IV  Y116A8A.3   GTGCAACCTATGTGCAACAGTAA ATAAAACCCCGCAAACCTATAAA IV-8C09
120 B07 IV  Y116A8A.5   GTTCAAATAAACTGACCGCTTTG TCTGCTCATCTTGAAAAACCTCT IV-8C13
120 B08 IV  Y116A8A.6   TCCAAAGATTCCTACTGAAACCA CACGTGTTACAAACATTCTCCAA IV-8C15
120 B09 IV  Y116A8A.7   CGTTTCAAAGATTCCCTAAACCT ACAATCTGAAACCGACTTTGCTA IV-8C17
120 B10 IV  Y116A8A.8   TTCAGAATGCATCTGTCAAAATG AAGTTATCCAGCTTCTTTCCCAC IV-8C19
120 B11 IV  Y116A8A.9   TTTTTAGGTTTTTGGGCATTTTT GAATCCCCATACTATCTGAAGGG IV-8C21
120 B12 IV  T06A10.1    CCCAACGATCTGAACAAGGT    TCATTTTCCGTCGTTTCTCC    IV-8C23
120 C02 IV  T06A10.3    TGACACGTTCCATACATTTTTCA AAAATGTACATGAAGACCCGAAA IV-8E03
120 C03 IV  T06A10.4    AACGGTGTGCCAATTATTTTCTA ATCCTTTTGACCAAAACGTCATA IV-8E05
120 C04 IV  Y116A8C.1   GCGACACTTCTAGATGAAACTCG TAAAAGTGGGAGTTGGAACTTTG IV-8E07
120 C05 IV  Y116A8C.4   TGAATCTGAAAAAGGTGAAGGAA AACATTGGATCATCAAAGAATGG IV-8E09
120 C07 IV  Y116A8C.6   CTTCCGGCTTCTCTCATATTTTT AAACTACTCGGCCATCAATTTCT IV-8E13
120 C08 IV  Y116A8C.7   ACAAAAAGACTGTACGTTGCCAT CAGAAACCCCCTACTAGAGCAAT IV-8E15
120 C09 IV  Y116A8C.8   ATGAGCAATTTTGAAACCAAAGA ATTTTAATCGGAGCACAAGTTCA IV-8E17
120 C10 IV  Y116A8C.9   CTACTTTTTCGCAGGGGTATTTT TTCCAATTTTTCAGGTAATTCCA IV-8E19
120 C12 IV  Y116A8C.11  CACCGTTTATGTTTGAGAAAAGC TAAATTTGCAGGAAGGTGTCAGT IV-8E23
120 D01 IV  Y116A8C.12  CAAAAATCGCACTAATTTCGGTA AAAATAGGAATAAGCATGGCACA IV-8G01
120 D02 IV  Y116A8C.13  AAATTTCTAGGCCACACACAAAC CTTGATAAAACGCAAAAGTCAGC IV-8G03
120 D03 IV  Y116A8C.14  CAAAGAAAACCACGAGTAGGATG AATTTTCTCCAAACTTCCAGAGG IV-8G05
120 D06 IV  Y116A8C.17  ATCCATGATTAGGCACTGAGAAA CAATGTTCACTGAAACTTCACCA IV-8G11
120 D07 IV  Y116A8C.18  CTCGTTCTGAATTCTCTCTCCAA TCTGCGTGCTCATTCTATCATAA IV-8G13
120 D08 IV  Y116A8C.19  TTGTTGGTACAATCAACAGGAAA TCGATTAGATACTGTTCCAGCGT IV-8G15
120 D09 IV  Y116A8C.20  GCCTTCAAGTCTTTTTGTCGTTA GTAGTTGTGGCGGAAAAATAGTG IV-8G17
120 D10 IV  Y116A8C.21  AATTTCCACAGATACTTCACGGA CCACACCAAACTACATTCCAAAT IV-8G19
120 D11 IV  Y116A8C.22  ATAGGCATAGCAACCGACATCTA TCAAACGTTTTTAATCGATTCGT IV-8G21
120 E01 IV  Y116A8C.24  ATAATGTACAGTTGCGGCTCAAT AGAAGCCTTCACCTTTTATCACC IV-8I01
120 E02 IV  Y116A8C.25  CGTCACAGACTACAAACTACGGA CGAGATTTTTCAAATTTCCACTG IV-8I03
120 E03 IV  Y116A8C.26  CCGAAAATTCTTTATTTTGGGTC CAATTTTCATTTGTAAAGCTGCC IV-8I05
120 E06 IV  Y116A8C.29  TTACTTTCATTCTCTGCGTCTCC CAAGTGCTAAAAGTACGGGAATG IV-8I11
120 E08 IV  Y116A8C.32  TTTTAGCGTGATGAAAATTCGTT TGGAACAGTTGAGACATGAGAAA IV-8I15
120 E09 IV  Y116A8C.33  ATCTGGGATTATAGTTCCACCGT AATGCATCTCGTTTCAGAAGAAG IV-8I17
120 E11 IV  Y116A8C.35  ATGAAATTGCAGAATCCTCCTTT TTTAGCAGGGCAGTTGGTTATTA IV-8I21
120 E12 IV  Y116A8C.36  TGTTCTCCAGATGACAAATCCTT GCGACAAGTTTCGAATAAACATC IV-8I23
120 F01 IV  Y116A8C.37  TTGTTTCTGGAGGTTCATTGAGT AAGTTTTGCGGAAAATGTGAATA IV-8K01
120 F02 IV  Y116A8C.38  AGAAGCCTTCACCTTTTATCACC ACATTGGAGGCCAAATAAAAACT IV-8K03
120 F03 IV  Y116A8C.40  ACGTCATTTTGGATTCAGAGAAA TCAATTGTTTCGAGCTAATGGTT IV-8K05
120 F04 IV  Y116A8C.41  GATTCTTTGGATTTTCTTTTCCG CAATCACCTAAGAGGGGTCCTAT IV-8K07
120 F05 IV  Y116A8C.42  AAAACTTCATTTTCGGGGTTTTA AGAAGAGAAACTGGAAGAATGGG IV-8K09
120 F06 IV  Y116A8C.43  TTTCGGAGATTTCCCTGTAAGAT CGAATCGTAATTTGGCATACAAT IV-8K11
120 F07 IV  C26C9.2 CGTTTTGAATTTCCTTATTGACG TTATCGTGAGAGAACGGATTGTT IV-8K13
120 F08 IV  C52D10.1    TACCCATTTGTTGTTACAGACCC AAACTTATAGGAAAGCGATTCCG IV-8K15
120 F09 IV  C52D10.2    AGCCTAAAAATTTCAAGGAATGC TCCCAATATTTCCACAGTTTCAG IV-8K17
120 F10 IV  C52D10.3    GAGAAAATAGTTCGCAAAGGGTT TAATTTCTCAATTCACTCGCCAT IV-8K19
120 F11 IV  C52D10.5    CTCGGCAACTTTTCCGATAG    TTCAAGGTCGATCCATAGCC    IV-8K21
120 F12 IV  C52D10.6    CTAGGAACTTGTTGCCTGTGACT GACGTGCATCAAAAACAGTGATA IV-8K23
120 G01 IV  C52D10.7    CCTTTCTGATCTTTTGAATGGTG CATAGTTTTGGAATTTGACCCAA IV-8M01
120 G02 IV  C52D10.8    TGTGGGAGAAATAGGCAAATAAA AGTCGATCACATCTGTCAACCTT IV-8M03
120 G03 IV  C52D10.9    ACACTAAGGTAGGCGTGTCATGT CCTTTCTGATCTTTTGAATGGTG IV-8M05
120 G04 IV  C52D10.11   GATCAAGAAACAGGATTGTGGAG CCAAAAACATCATCAGACCAAAT IV-8M07
120 G05 IV  C52D10.12   TGTTACTTGAATCCGTCCCTCTA GTCGTGAAAGATGTGATGACAAA IV-8M09
120 G06 IV  C52D10.13   GGTGCAAAACCCGAGTAGAA    TTGGCCTGATTATGCAACAA    IV-8M11
120 G07 IV  Y116A8B.1   GTGGTTGCCCTCTCTTATTTCTT TTCACTCTCTTCGTTGACTCTCC IV-8M13
120 G08 IV  Y116A8B.2   TTGGTCATTCAGCAATGGAA    CTGGCTGTAAAGATGCGTCA    IV-8M15
120 G10 IV  Y116A8B.4   ATGTGCTTCTATTTATGGTGCGT AGAAATGCGCTACCAAATCATTA IV-8M19
120 G11 IV  Y116A8B.5   CTCACGTGAATATTTTTATCCGC TAAATTTTTCTTTTGAAACGGCA IV-8M21
120 G12 IV  ZK550.1 CAATTGTGGCAAATGTGGAG    GCGCCAGGAAAGACTGATAG    IV-8M23
120 H03 IV  ZK550.4 AAATTTCCAGAACCGCTGTG    GAGGGAATGGTAGGGGAAAA    IV-8O05
120 H04 IV  ZK550.5 TCATGATGGACTGGACGAGA    ATTTTCAGAGCCCATTGTGG    IV-8O07
120 H05 IV  ZK550.6 ATCCAAGGTTACAGTATTCGGGT CGATCAGCAGCTAGTTTTCAAAT IV-8O09
120 H07 IV  F26D10.1    CAAGTGCCGAACGAAGTACA    GCAGCTGCACATACAAGGAA    IV-8O13
120 H08 IV  F26D10.2    TTGATCGATGCAATTGGAAA    ATATCACGTCCGAATGGGAG    IV-8O15
120 H09 IV  F26D10.3    AGATCCTGGACAGCCTCAGA    CAACAATCTCAACGGTCGTG    IV-8O17
120 H10 IV  F26D10.4    TCGCTTCATTTCATGTCAGC    TATTATGCCAGGGGTTGAGG    IV-8O19
120 H11 IV  F26D10.5    CGAAAGTTGGATGGAACGAT    TCAGGGATCCAGGATTTGAG    IV-8O21
120 H12 IV  F26D10.8    TTCGTTATTCGTCCTTTTTACCA ATGCATGAGAATTAATGGAATGG IV-8O23
121 A01 IV  F26D10.9    CCTATTCATCTCTTTCGGAGGTT TAGGTTTCCAAAGGGAAAGAGAC IV-8A02
121 A02 IV  F26D10.10   GGTCTTCGAGATAGCCCTAAAAA TGTCCCACTTGAACTACGAAACT IV-8A04
121 A03 IV  F26D10.11   CTCGATATACACGAGAAATTGGC GAAAGAGTCTTGGAGGGACATTT IV-8A06
121 A04 IV  F26D10.12   ATGTGTGGGCTAAGACATCAATC GTGATTCATTGGAGTTTTTCTCG IV-8A08
121 A05 IV  T28F3.1 TATTATGCCAGGGGTTGAGG    TCAGGTGGAACACAGTTGGA    IV-8A10
121 A06 IV  T28F3.2 TGTCCAGGATCTTCTTCTTCTTG ACGAAAGCAAACAACTTGGATTA IV-8A12
121 A07 IV  T28F3.3 TCAGGGATCCAGGATTTGAG    AACGAAAGTTGGATGGAACG    IV-8A14
121 A08 IV  T28F3.4 CTGATTGGGCAAAAATAATGGTA GATTATTTGGACGCAAATGTTGT IV-8A16
121 A09 IV  T28F3.5 TCAGTGGAAAGATGAAGGGG    ACGCGCCTCAAGTTCTTTTA    IV-8A18
121 A10 IV  T28F3.6 ACTCCTGATCCCATTTGTCG    TTCGGACTTCCCCTTTCTCT    IV-8A20
121 A11 IV  T28F3.7 ATCCAGGTTTCGACAGTTCG    GAAAGTTCCATGGTGGTGCT    IV-8A22
121 A12 IV  T28F3.8 CAGGAACACAGTCCATCGTG    TTTTCCCAATCAGTTCTGCC    IV-8A24
121 B01 IV  T28F3.9 GTTCAAATGTCTTGGCACCC    AAAGCTTTTGTCAAAGCCGA    IV-8C02
121 B02 IV  C49C3.1 ATTTATGCCAGCAACTTGGG    TTGGTAGAAGACAAACCGCC    IV-8C04
121 B03 IV  C49C3.2 ATCAGTTTTCCTGGTAGAGGAGG TCAAATTGGTGAAATAACCATCC IV-8C06
121 B04 IV  C49C3.3 CATTCAAAATTCTTTTTCGTTCG CGTTCGGTTACTTCTTTTTGTTG IV-8C08
121 B05 IV  C49C3.4 TACGTTTCAATTCAATCATTCCC TACCTTGAGATGTGCTAGAAGGC IV-8C10
121 B06 IV  C49C3.5 GGAGAACATAATGTCTACTGGCG GAATATTTTGCTGCGTATTTTGC IV-8C12
121 B07 IV  C49C3.6 CGTGCGATGTTTTACTTTTGATT TGAGATGGAATGTGTTGAGTGTC IV-8C14
121 B08 IV  C49C3.7 CAACAGGAAGCTCTGATGAAACT CAAAACATAAATGCAACGAAACA IV-8C16
121 B09 IV  C49C3.8 TGGAATTTCATAGCGGAAAACTA CGCGCTGTTAATTATTTTCAATC IV-8C18
121 B10 IV  C49C3.9 ACGAAATTGTGGCAATCTTCTTA AGTTTCCTTTGACGCAACAAATA IV-8C20
121 B11 IV  C49C3.10    ATCCAATGGACTCGAATAAGGTT ACATTTTCAGTCAACCTTGGAGA IV-8C22
121 B12 IV  C49C3.11    AACTATCCTGAAACCGTACAGCA ATGAACATTTTTCGAATGCAAAT IV-8C24
121 C01 IV  C49C3.12    CACCGATAACCATAAAATCTCCA AACCGAGGAGGTAGGTAAGACTG IV-8E02
121 C02 IV  C49C3.13    TAATAAAAATTCAAGCGCGAAAA TAGATTTCTGCCTTCAACACGAT IV-8E04
121 C03 IV  C49C3.14    TTTCAGAAGATTCAAGGAACAGC AAAGCGTTTTGTGTTGAACATTT IV-8E06
121 C04 IV  C49C3.15    GCCAAAACTAATGCTTCTTGTGT AATGTTCCAATGTGTTTGGATTC IV-8E08
121 C05 IV  C30H6.1 CGACAATTCTGCAAATCCTTAAC CTGCTCTCAAGAAAAATGCAAAT IV-8E10
121 C06 IV  C30H6.2 AAAGCCCAATGTGAAACCAG    ATCAGGACACGGGCATAGTC    IV-8E12
121 C07 IV  C30H6.3 GGAGCACATTTAGCATCGGT    TCGGCAAGAAGAAAATGGAC    IV-8E14
121 C08 IV  C30H6.4 GTCATGGTTCACGGTTTTATGAT TCATATTCTGTCACCTATCGGCT IV-8E16
121 C09 IV  C30H6.5 GCCGTCAAACAATACCCACT    TATTGCGTGGCTGTTCTCAG    IV-8E18
121 C10 IV  C30H6.6 CTCGAGCTGAAAAATGCACA    CATCAAATGTTCCTTGGCCT    IV-8E20
121 C11 IV  C30H6.7 TTTCCTTCAATTCCTCTTCTTCC AATCTCACGTAAAAGATCCTCCC IV-8E22
121 C12 IV  C30H6.8 TCCAACATTTTCTTCCACAATTT TGCCATCAACATTAGAACATCAG IV-8E24
121 D01 IV  C30H6.9 ATTATTTTGCCATGGAAATAGCC ATCATTCGATTTTCAGCATGTTT IV-8G02
121 D02 IV  T02D1.1 CTGAAGTCTTGCCACGATGA    GATGGAGTCGGTGGTGTTCT    IV-8G04
121 D03 IV  T02D1.3 TAGACTCGTTCGCGATGATG    GCCGCAAGGTAAGCAGATAC    IV-8G06
121 D04 IV  T02D1.4 TGGCAACTGTGTCCATCAAT    CGACAATAGCGAAGAGGAGG    IV-8G08
121 D05 IV  T02D1.5 AACAAACCTGATGACCTCCG    CATTTGACCCCCAATTCTTG    IV-8G10
121 D06 IV  T02D1.6 TCGAGATGACGTAGCACCAG    CTATGCGTGTGCGACTTTGT    IV-8G12
121 D07 IV  T02D1.7 AGGGCATCTTTGACTAGACTGTG TTCCAACTTTTTGATGATAACGG IV-8G14
121 D09 IV  C06A12.2    TCGAGATGACGTAGCACCAG    CTATGCGTGTGCGACTTTGT    IV-8G18
121 D10 IV  C06A12.3    TTAGAAACAATGTCCACGCCTAT GCATGGTCAGGTGATATGAATTT IV-8G20
121 D11 IV  C06A12.4    AATTGCGTTTCGTAGATTTTCAA AGAATGCAGATGCGGTAATAAAA IV-8G22
121 D12 IV  C06A12.5    GCTCTCCAGTGCCAGTTTTC    CAATTTTTCAGGCCGTTTGT    IV-8G24
121 E01 IV  F11E6.1 TGAAACGCATGAGTATGAAAATG CATAATTTTCTGCCGTAAACCAG IV-8I02
121 E02 IV  F11E6.2 TTAAAAATTTCGGAATCCGTTTT AATCGTATCAATTTGGACGTGAC IV-8I04
121 E03 IV  F11E6.3 CCTAAAACTTGTGGCAGTGAGAT GTCAAGCTCAAAACTCTTACGGA IV-8I06
121 E04 IV  F11E6.4 TCAAAACCCAAGAGAGGTATGAA ATATAAATGCGCAAACAATCTCG IV-8I08
121 E05 IV  F11E6.5 AGAAGAACTTGGCAAAAAGGAAC AAATTTGCAGGTAATCACAATGG IV-8I10
121 E06 IV  F11E6.6 AGAGAATCTACGGAAACCGAATC ACTCACCACACTAGTTTCGCAAT IV-8I12
121 E08 IV  F11E6.8 AAGGATCTGGAGTATTTTCCTGC CGGTCAAAACACTGAAAGGTAAC IV-8I16
121 E10 IV  4R79.2  CATCAAACATTAGCACAACTCCA TCAGATCTTGAAACACTCGTTGA IV-8I20
121 E11 IV  4R79.3  CAGCACCTAGCTTTGCTTGTTAT TTGGAATAAACGGGATTATGTTG IV-8I22
121 E12 IV  Y104H12B_374.a  CTTTACACCTTGTATCTCGCCTG TACCGTATTCCAACCAACAATTC IV-8I24
121 F01 IV  Y104H12B_374.b  AGATATCTACGACGGCAATCAAA AAAGATGGAAAAACGGGAAAATA IV-8K02
121 F03 IV  Y37E11A_93.a    AATTATCAAAAACTTGGAGGGGA ATAAATTTTGCAGAGTGGAACGA IV-8K06
121 F04 IV  Y37E11A_93.b    GAGGGCACTCACAAGTATTCATC ACGTGTTTGTGAGAGGAAAAATG IV-8K08
121 F05 IV  Y37E11A_93.c    TCATTATTTTCGCCTTTTAAGCA ATATGATTCTCTAGGCACCGTCA IV-8K10
121 F07 IV  Y37E11A_93.e    CGGAAAACAAAGCAAGATAAATG AGAACAAAAATCTGACAACTGCC IV-8K14
121 F08 IV  Y37E11A_93.f    CGCCAAAAATACTGAAAAATCTG ATTTTCGACGTTTTCTGGAGAGT IV-8K16
121 F09 IV  Y37E11A_93.g    TCAACATTTCCTCTTTACTCCCA TTCGGCTAATAGTGACGTTGATT IV-8K18
121 F10 IV  Y37E11A_93.h    AGCTATTTTGGAGGCATGTGATA TTGGCTCTATAGCTCAAGTCGTC IV-8K20
121 F11 IV  Y37E11A_93.i    AAGAAGAGCGATGAACTTTTGTG AAAGTTTTCCAGCTACCTCAACC IV-8K22
121 F12 IV  Y37E11A_94.a    TTAATTCGACGCAATCAAAACTT ACACTTCTTACCCCTTTAGACGC IV-8K24
121 G01 IV  Y37E11A_94.b    CTTTCTCACTCTCTGCTCTCAGC CTGCTAGAAACCCCCTCATACTT IV-8M02
121 G03 IV  Y37E11A_94.d    CACGTGCCACTTATATATCGTCA CCAGCATTACACTCAATGTTTCA IV-8M06
121 G04 IV  Y37E11A_94.e    TTAATTCGACGCAATCAAAACTT ACACTTCTTACCCCTTTAGACGC IV-8M08
121 G05 IV  Y38F2A_5743.a   ACGGGGAATTCTAAAAATTGTGT ATGTTGATTCCATCTGGAAATTG IV-8M10
121 G07 IV  Y38F2A_5743.c   AGAAGCTCACAATCTTGAAATCG TAGGAAAAAGATGCCAAAAATCA IV-8M14
121 G08 IV  Y38F2A_5743.d   TTTCCATTTTCCAACATACAACC TCTAAGTCTCCTAGTCCCCAACC IV-8M16
121 G09 IV  Y38F2A_5743.e   TATTTTATGCGAGAAAATCGGAA GCATTTTCAGCTAATTTTTGTGG IV-8M18
121 G10 IV  Y38F2A_5743.f   CATTTTCTCATTAGAGCGCATTT CAATTTTTCAGTCTAAACCGCTG IV-8M20
121 H01 IV  Y38F2A_5743.i   GTACAAAAATGGCTGAAAACCAG TTCCCATCTACAAAACTTCCTCA IV-8O02
121 H02 IV  Y38F2A_5743.j   TTAAAAATTTCAGCGTCGAATGT TCGAAGAGAGGAAGTCATTTGAG IV-8O04
121 H05 IV  Y38F2A_6126.b   AAAACAATTCGTCAAAAATCGAA AGAAGACGCTGAAGGAACCTAGT IV-8O10
121 H06 IV  Y38F2A_6126.c   GTCTGCCTAGGGTAGGCTAAGTC CCAATCATTTCTCAATGGATAGC IV-8O12
121 H07 IV  Y38F2A_6126.d   GATTTTTCACCCCAATAAAAACC AATCGCGCTAAAATAATTGTTCA IV-8O14
121 H09 IV  Y38F2A_6126.f   TAGAATTTTGTGGTAAAAGCCGA CTTTCAGAATTTCATCATCGTCC IV-8O18
121 H10 IV  Y38F2A_6126.g   TAGAATTTTGTGGTAAAAGCCGA TATTGGAACATTTCGATTTTTGG IV-8O20
121 H11 IV  Y38F2A_6126.h   ACAGTAATCTCATCGAAGGCGTA AATAAAGAAATTTCCGGGTCTCA IV-8O22
121 H12 IV  Y38F2A_6126.i   AAAAGCAGTGAATTTTGTGGAAA AATCGCGCTAAAATAATTGTTCA IV-8O24
122 A01 IV  Y38F2A_6126.j   TCGAATCACCATCTTCATTTTTC GAGTTTAAGCAGAATTTCGAGCA IV-8B01
122 A02 IV  Y38F2A_6126.k   AGGTCGATGCACTATGAAGTGTT TAGAGGTGCTGAAAGTGTTGTCA IV-8B03
122 A03 IV  Y38F2A_9208.a   GAAAAGCCGTATCTTGACACATC TAGGCCACAAGAAGAGCTGTTAG IV-8B05
122 A05 IV  Y41D4A_2491.a   TCCATTACCACTTTTGCTCTGTT TCTCTTGTGTTTCTGCCTTCTTC IV-8B09
122 A06 IV  Y41D4A_2615.a   GCACAGACACCTGAAATTACAAA CGGAAAACAAAGCAAGATAAATG IV-8B11
122 A07 IV  Y41D4A_2615.b   CAGGCGGAAAACAATACAAGATA AATGCACAATTGTCTCCATTTTT IV-8B13
122 A08 IV  Y41D4A_2659.a   TGGATTACGGGAATACAAAACCT ATGACAATGTGCATTCTCTTCCT IV-8B15
122 A10 IV  Y41D4A_2768.a   CTATCGTCTTGTACCGATGAAGG AGCATTTACAGGGAAATACCCAT IV-8B19
122 A12 IV  Y41D4A_2911.a   TGGAGCTTTACTTCCAAAGTGAG ATTTCCCTTCAAAAGACGAAAAG IV-8B23
122 B02 IV  Y41D4A_3073.a   CCATCATATTACAATGCCCACTT TTTCCTTTTCCAATTCTTCAACA IV-8D03
122 B03 IV  Y41D4A_3073.b   CGGAGAAAACGGAGAACTAAAAT TGGGAGACGGAATAAGACATAGA IV-8D05
122 B04 IV  Y41D4A_3192.a   TCGATAAATTCCCAGAAAAATCA CAACACATTTCAAATTTTCCGTT IV-8D07
122 B05 IV  Y41D4A_3192.b   ATGAATAAATCGAAATCTGCGAA GTTCAAATTTGGCCTATTTTTCC IV-8D09
122 B06 IV  Y41D4A_3309.a   ATTTATATATTCAGACCGCCCGT CGGAAAACAAAGCAAGATAAATG IV-8D11
122 B07 IV  Y41D4A_3457.a   AAAAATGAGGAAATTGATGAGCA CAAACTTTTGCGATTTTTGATTC IV-8D13
122 B08 IV  Y41D4A_3457.b   AAATAATCTCACAATTCGGCTCA AACTCTATTTTCAGGCCGTTTTC IV-8D15
122 B09 IV  Y41D4A_3457.c   ATTTCAGATCCAACTTTCCCATT AACCCGGTTTAGTAGAAAAATGC IV-8D17
122 B10 IV  Y41D4A_3457.d   ATAAAAATCCCCAAATCGTCAAT CGGGGCTTTAACTAAAAATATGC IV-8D19
122 B11 IV  Y41D4A_3613.a   TTACATTAAAAAGCCGGAAGTCA AAATAACAACAAGTCGAGACCGA IV-8D21
122 B12 IV  Y41D4A_3613.b   TCTAATAAGCCGTGGACTTTCAA CGGATTCTTTTCCTAAATTTGCT IV-8D23
122 C01 IV  Y41D4A_3613.c   CCATCATATTACAATGCCCACTT CGGAAAACAAAGCAAGATAAATG IV-8F01
122 C02 IV  Y41D4A_4723.a   ATAGCTCCACCTATCACGGAGTT GTAGGCGTTGATTAGGCATGTAG IV-8F03
122 C03 IV  Y41D4A_4723.b   TATCAGAACCGCAAATACGAGAT AACTTTTTAATAACTTTGCGCCC IV-8F05
122 C04 IV  Y41D4A_4723.c   TTAATGTATTTGGACCTGGCATC AAACGAGTGTACCGAATATGGAA IV-8F07
122 C05 IV  Y41D4A_4723.d   TATCAGAACCGCAAATACGAGAT AACTTTTTAATAACTTTGCGCCC IV-8F09
122 C07 IV  Y41D4A_5905.b   CTAATCACCGACAACAACAACAA GAAAATTGAAAAATTTGCAGACG IV-8F13
122 C09 IV  Y41D4A_5905.d   ATTGCCTGCAAAGTGTGTAATTT ATTGAACATTTGAACATCCAACC IV-8F17
122 C10 IV  Y41D4B_930.a    GACTACACTAACCACATTTCGGC TTTCAGTGAGTGCTCATCTTTCA IV-8F19
122 C11 IV  Y41D4B_930.b    TGCGACGAAATTTGAGAATTTAT AAAAAGTCCCTCCTACACTTTGC IV-8F21
122 C12 IV  Y41D4B_930.c    TTTGCATTTTTCGACATTTTTCT GATTACGGCTCAAAAACCTACCT IV-8F23
122 D02 IV  Y41D4B_3805.b   GACTTGGTGAGGGACAATGTAAG CGACACAAGATAACAACATCCAA IV-8H03
122 D03 IV  Y41D4B_3805.c   TTCACCAAATTGTTAATTTTCCG AATGAACCGTGATATGAAACACC IV-8H05
122 D04 IV  Y41D4B_3805.d   GGTGTTTCATATCACGGTTCATT CACCCTGTTTGAGAAGTACCAAC IV-8H07
122 D05 IV  Y41D4B_7946.a   ATTTCTACTGCCAACAATCCTGA GGTTGTTTCCACATTTTGAGAAG IV-8H09
122 D06 IV  Y41D4B_7946.b   CGTTGATACCCGTATGTTTGAAT GCCGAGCTCAACAGTTATTACAC IV-8H11
122 D07 IV  Y41D4B_7946.c   CCATCCCAAAGTAATCATTTGAA TACCTTTGTCAGTAACCTCGGAA IV-8H13
122 D08 IV  Y41D4B_7946.d   ACTTGGGAATTAACAAGGATGGT GCTGACTTATATTCAGCCAATGC IV-8H15
122 D10 IV  Y46C8_95.b  CCGACAGTAGTGACCAAGAAATC TTCTGAACAAGGAATTCTGCAAT IV-8H19
122 D12 IV  Y46C8_97.a  TTTCGATATTTGTTTGGTTTTGG CCAGAAGATCCATTTCGATGTAG IV-8H23
122 E01 IV  Y46C8_97.b  ACATCCAGCACATTACTTCCTGT GTACAGTGTGTCTATTCCGGGAG IV-8J01
122 E02 IV  Y46C8_98.b  TATTTGTGAAAAAGTGCCTTCGT GATGCTGCTTAAAAGTTTGCTGT IV-8J03
122 E03 IV  Y46C8_99.a  AGCTTATCAGGAAATTCGGAAAC GCACCACCTTGAAACAATACTTC IV-8J05
122 E04 IV  Y46C8_100.a ATGTTTTGTTGGATATTGTTCCC TGCGAAAAGGTAGTTATTTGGAA IV-8J07
122 E05 IV  Y46C8_100.b AGTTGGAACTGAAAATGTGGAGA TTTGGTAGAAAGATGGTCCTCAA IV-8J09
122 E06 IV  Y46C8_100.c AGTTTCGACATTGCTATTGGTGT ATTTTTGCCCAAACTCCATTTAT IV-8J11
122 E07 IV  Y46C8_100.d ACACAAAGAGCAGGAAATGATGT TCATCCAAAAATCCTGTATGTCC IV-8J13
122 E08 IV  Y46C8_101.a GGTAATTCAAATTTCGTCAGTCG TTGTCCGGATACTCTAGGATTGA IV-8J15
122 E09 IV  Y46C8_103.a ACGATGGAACACGTGAAACTTTA ACACCGGATAGAGAAATGTCAGA IV-8J17
122 E10 IV  Y55F3A_736.a    TAAATAGCCGCTTGTGGTGTAGT GCTCTTCTGCACGTTAAACTCAT IV-8J19
122 E11 IV  Y55F3A_739.a    GAAAGTCGCTCAAAATCTGAAAA GACAAAACTGATCAAAAATTGCC IV-8J21
122 E12 IV  Y55F3A_740.a    CGGAAAACAAAGCAAGATAAATG CAACATTGAGAAGTTATCGAGGG IV-8J23
122 F01 IV  Y55F3A_740.b    TATTTTTCAGAGCAAAAATCGGA ACTTTTCTGATGATAAGGGCACA IV-8L01
122 F02 IV  Y55F3A_742.a    CTAATGAGAAGCTGAGGACGAAA CCGGAAAAGTCGATTAAAACTCT IV-8L03
122 F03 IV  Y55F3A_746.a    CATTTTTATCCCAAAAATCGTGA AAGGATATTTCCCGAAAAATTGA IV-8L05
122 F04 IV  Y55F3A_746.b    CCATTAACAAAAATGCAGTCTCC AAATGATGTGGAAATTGAAAACG IV-8L07
122 F05 IV  Y55F3A_746.d    GAAACAAGAGGTTAAAAGCCGAT CAATACATGAGCCAACACTTTCA IV-8L09
122 F06 IV  Y55F3A_746.e    AATTATCGATTTTCGCCATTTTT CTTTTCGGTACTTTTTCCGACTT IV-8L11
122 F07 IV  Y55F3A_746.f    GTTTGGACGAATTGAGAAGATTG CGGGGTAAATGAATTTTACATCA IV-8L13
122 F08 IV  Y55F3A_747.a    TTGGTTCTGGTGTAGGTCACTTT CAGAGTAAATTGGGACGAAGTTG IV-8L15
122 F09 IV  Y55F3A_747.b    CCACTAGTCATAATCTTCACGGG ATTCTGAATTCCAGACACCTTCA IV-8L17
122 F11 IV  Y55F3A_747.d    TTTTTGTTGCCTCATCACTTTTT CTGTTTTCTTTCGTTTTTCATCG IV-8L21
122 G01 IV  Y55F3A_747.f    AGTTGGATTTTGGAATTTTGGAT CGATTTTGATGGAAATTCATTGT IV-8N01
122 G02 IV  Y55F3A_747.g    TTCCAAATCATACCCAAAAACAC ATTCTGAATTCCAGACACCTTCA IV-8N03
122 G03 IV  Y55F3A_747.h    CAAAAACAAAATTCAAATCTCGC TTTTTGGTCAATTTTCTTCAGGA IV-8N05
122 G04 IV  Y55F3A_747.i    GAGAGCACACAACTCGTCCTACT CAATAGTCAAATGACCATCAGCA IV-8N07
122 G05 IV  Y55F3A_747.j    TCCACCGAAAAAGTTGAAAATAA TTTGCGTAATGTGCCTTTAAGTT IV-8N09
122 G06 IV  Y55F3A_748.a    TTTTGCCAATTTTTGTAGCCTAA TCTGGTCTCCAATTCTCAAATGT IV-8N11
122 G07 IV  Y55F3A_748.b    AACACAATATCAGCGACACACAC TCGTATCATAATCCATCTTTCGG IV-8N13
122 G08 IV  Y55F3A_748.c    ACTCAAAAACCAGCAAGAAATCA ACATTTTCATCCAGGAACCAGTA IV-8N15
122 G09 IV  Y55F3A_748.d    CGACAATCAATTCAACAAGTCAA CAATGGCCAATCAGTTTATCATT IV-8N17
122 G10 IV  Y55F3A_748.e    ATAGACAAATGCTCGAAACCAAA TGTAAAAGATGAGACGCAGACAA IV-8N19
122 G11 IV  Y55F3A_748.f    GGCTCTAAAATCTCTCCTTCAGC ATTTGATGGTTTTCCCAGTTTTT IV-8N21
122 G12 IV  Y55F3A_748.g    GAAATTCCTTCCTTTTTCAGCTC CCAGGCATGATTATACTTCTTCG IV-8N23
122 H01 IV  Y55F3A_748.h    CAAGACGTATAGAGGAGTCACGG CTGTCAAAGTTAATCGGCAAAAC IV-8P01
122 H02 IV  Y55F3A_749.a    TATCTTAAAAATGCGCCGAGATA AGGAATATTAGGCAACGAAAAGC IV-8P03
122 H03 IV  Y55F3A_749.b    ATCCACTTTCGCAATCAACTTTA GTGTGAAGAGCACAACTCACAAG IV-8P05
122 H04 IV  Y55F3A_750.c    TGTTCATTCCTAAAGTGGGAAAA TCTCAAAGTGAATTTTGCCGTAT IV-8P07
122 H05 IV  Y55F3A_750.d    ATTTCTTATCGAAAACGACGACA CACTCAAAAACCTTCAATTTTCG IV-8P09
122 H06 IV  Y55F3A_750.e    CATTTATCTTGCTTTGTTTTCCG TCCAGCGCATAAAACTTGTAAAT IV-8P11
122 H07 IV  Y55F3B_743.a    TTTATGGAAAGAACGACGAAAAA CGGAAAACAAAGCAAGATAAATG IV-8P13
122 H08 IV  Y55F3B_743.b    AAAAATCCACATTTTTCTCAGCA CAAATTTGAGAGAGCGGACTAGA IV-8P15
122 H09 IV  Y55F3B_743.c    TTCTTCTTCCATATTTTCAGCCA GCATTGTACCTTGTTTGTTGTCA IV-8P17
122 H11 IV  Y59E9_116.a CATTTTCATTGGGCTTACTTCAG TGGATACGAGTATGGATGGATTC IV-8P21
122 H12 IV  Y59E9_118.a GCTAAATAATGTTGCTTGTTGCC TAAAAGGAGTCGAAATTGCCATA IV-8P23
123 A01 IV  Y59E9_118.b CAAAAAGGACGAGAAGAAGGATT CAGCTCATTCTCATTTTGATTCC IV-8B02
123 A02 IV  Y59E9_118.c TTGTTTGAGGGTCGTTCTATCAT CTTATCACCATCTTTCTTCTCGC IV-8B04
123 A03 IV  Y59E9_118.d AAGGAAGGAGATGAGAAGAAGGA AGAATCTGCTAATTCACCGACAG IV-8B06
123 A04 IV  Y59E9_118.e GTTTTACGTGTTGGTTTAGCGTC TCTTCACAAGAGTTCATAACGCA IV-8B08
123 A05 IV  Y59E9_120.a TAACTATCAAAGGGGAGCAATCA CATCAACTCAAATCGTTGTGAAA IV-8B10
123 A06 IV  Y59E9_120.b TCGCGATTCTTATTTTTCATGTT AAGAAACCACTTCACAAGAGCAG IV-8B12
123 A07 IV  Y59E9_120.c TTCGAATAAAAACTGGACTGGAA GATGACGAAGGTCAGAATTATCG IV-8B14
123 A08 IV  Y59E9_120.d TGAGGTAGGCGTAAACAGAAAAA CACGCTTCAAAAATAAAATCAGG IV-8B16
123 A09 IV  Y59E9_122.a TTGGCAAAATTGGTAATAATTGG ATGCTTCTTCTGACCACATCAAT IV-8B18
123 A11 IV  Y67D8A_349.a    TTTCGAAAATGAAGATTGACGAT AAATCAATTTCAAAAATCGAGCC IV-8B22
123 B01 IV  Y67D8A_358.b    TAATTAAAAACCGAACTCTGCCA TTTTCAGGAAACCATGAATGAAC IV-8D02
123 B02 IV  Y67D8A_360.a    TTTGACAAAGCCATCTGAAAAAT TTTTTCTCTTGCCGTCAATGTAT IV-8D04
123 B03 IV  Y67D8A_363.a    CATCCATCATTTCCCAGAATTTA TAATGATCGAAATAGGGGGATTT IV-8D06
123 B04 IV  Y67D8A_367.a    ACACTGAAAAACTCTTAAGCCCC TATTCGGTCAAGAAAATGATGCT IV-8D08
123 B05 IV  Y67D8A_369.a    AGGTGACAACTGACACATACACG CGGTGACATTTACTTCAAAAAGC IV-8D10
123 B06 IV  Y67D8A_370.a    TTAAAGGCGCACATATAGGTCAT ATCCTGAGCCTCACTTAAAATCC IV-8D12
123 B07 IV  Y67D8A_371.b    TTGAGTCTTGCCACGATTATTTT CCATAAGTTTTTCGTCCAAATCA IV-8D14
123 B08 IV  Y67D8A_373.a    ATGGCCTAGGATTCTCACTTTTC TTTCTTGGATTTCAGGACGAATA IV-8D16
123 B10 IV  Y67D8A_375.b    TTTGATCTCAAAACACGGAAGTT AAAATGTCAGATTGGTAGGCTGA IV-8D20
123 B11 IV  Y67D8A_376.a    TTTGCTATCGAACTGCACTAACA GTTTACTATAAATTGGCTGGGGG IV-8D22
123 C03 IV  Y67D8A_380.b    AAGTTTAGCGAATTTCTTTTGGG ATTTCAACTTTTCTTTGCTGCTG IV-8F06
123 C04 IV  Y67D8A_380.c    TTGAAACGCTTTGATTTTTGAAT TTCAGTATATTTGGCACGCTTTT IV-8F08
123 C05 IV  Y67D8A_380.d    AAGCATCCGGTTCTTACAGTACA TGAACTTGGTTTTGGTACGAGTT IV-8F10
123 C06 IV  Y67D8A_380.e    AAGTTTAGCGAATTTCTTTTGGG ATTTCAACTTTTCTTTGCTGCTG IV-8F12
123 C07 IV  Y67D8A_381.a    TTAAAAAGTGAATTTCTTGCCGA ATGAATATTTTCAGTCGTTGGGA IV-8F14
123 C09 IV  Y67D8A_382.b    TAATACTTTGTCGCGTATCCGTT ACTCTGTTTGTTGCACTGGATTT IV-8F18
123 C10 IV  Y67D8A_382.c    TCGTTTTTCAACCATTTTCACTT AATAGCGATTTTTAGCGGTTTTC IV-8F20
123 C11 IV  Y67D8A_384.a    GCCTTGAAATCAAAATCACTGAC TTCAAATCTCCAGGTTTCAAAAA IV-8F22
123 C12 IV  Y67D8A_384.b    GAGGCAATGAAAAGGCTAAAACT CTAGACTTAGAAGGGTGGGGAAA IV-8F24
123 D01 IV  Y67D8A_384.c    AATAAATTCCATTTGGACCTGCT GTATCCTTTTCAACGGAACACTG IV-8H02
123 D02 IV  Y67D8A_386.a    ACGTGTAGGCGATATTCAAGAAA TTTCCTTGGTTCATTTTACGCTA IV-8H04
123 D03 IV  Y67D8A_386.b    CATTTTCTCCTTTCCTCACCTTT ACGGGTTAGTAGCTCACACAGAG IV-8H06
123 D05 IV  Y67D8C_383.b    TATGGATGCTGAAGCCAAACTAT CAGCTCTGAAATCTTGGAAAGAA IV-8H10
123 D06 IV  Y67D8C_383.c    GAAATCCAGTAGATCAGGAGGCT AGGCATATTATCTCCGAGGAAAG IV-8H12
123 D07 IV  Y69A2A_895.a    TTTCAACAGCAAAAACTTGGAAT ATTCGGTAGTTTTGGACCAATTT IV-8H14
123 D08 IV  Y69A2A_1783.b   CGCATGTTTTTACTTGAAGCTCT CTACTGTAGGTTGGTTTTCGTGG IV-8H16
123 D09 IV  Y69A2A_1783.c   TTTGTATCCTCTGTTGTCTCCGT TTCCAGGATTCATGTCTGTCTTT IV-8H18
123 D10 IV  Y69A2A_1783.d   AGACCACTTTTAAGTTGTGAGCG TTGGAGTAATTTTGCAGTCACCT IV-8H20
123 D11 IV  Y69A2A_1783.e   AGACTGATGGGATTGATTTGAGA CTTACAAAAATTCATTTGAGCGG IV-8H22
123 D12 IV  Y69A2A_1783.f   TGATTCAGTTTTAGTTTTGCCGT TTTTACTGCTTGATTGGGAAAAA IV-8H24
123 E01 IV  Y69A2A_1798.a   AACCACTGTAACTTGCCTCAAAA TATGAGAATTGGTGGCCTAGAAA IV-8J02
123 E02 IV  Y69A2A_2109.b   TTTGTATCCTCTGTTGTCTCCGT TTTTGCTGCGAGACATAAAAACT IV-8J04
123 E03 IV  Y69A2A_2109.c   TTGTATCCTCTGTTGTCTCCGTT GCATCTAGGAAGGATTTTGAGGT IV-8J06
123 E04 IV  Y69A2A_2326.a   TTCCTTCTTCCACCAATTAGTCA CGGGAGAATTCGAATCTTAAACT IV-8J08
123 E07 IV  Y69A2A_2991.a   ATGCTTGAGCTTTTACCCATACA GATTGGAACAAACTTCTGATTGC IV-8J14
123 E08 IV  Y69A2A_2991.c   ACCCATACAACAATTTCGTGTTC CTCAAAACAGTTATCTTGGGTGG IV-8J16
123 E09 IV  Y69A2A_2991.d   TGTTCTGAAAAGGACAAGGGATA CAGAGGGAAATCGAATCAGTATG IV-8J18
123 E10 IV  Y69A2A_2991.e   CCGTTCATCAGTAAGAAAAATCG CGGAAAACAAAGCAAGATAAATG IV-8J20
123 E11 IV  Y69A2A_3269.a   GTTTCTCCAATAAATTCGAGGCT TGAAAATCAAGAAAATCGAGCAT IV-8J22
123 E12 IV  Y69A2A_7025.b   ATTCGGCTACTCATCAAACAAAA ATACACAAATTTTGGAGTCCCCT IV-8J24
123 F01 IV  Y69A2A_7025.c   TAGAATTATGATGCTTCCGTCGT TTTTTGAAAATTTCTGTGAGGGA IV-8L02
123 F02 IV  Y69A2A_7278.a   CCAAATTTTAGCAACTTTTGCAC AACAATATGTCAAAATGCCAACC IV-8L04
123 F03 IV  Y69A2A_7278.b   CGTTAGAATTTCCTTCTTTGCCT TGAATGCAAATGTGATAATCTGG IV-8L06
123 F04 IV  Y69A2A_7278.c   TTCTACCCAAGTTTGAAACGAAA AAATCGGACACTAGAACATCGAA IV-8L08
123 F05 IV  Y69A2A_7278.d   AGAAAACACGAGTTTCTGCAAAG TACTTTTCAAAATTCCACGGATG IV-8L10
123 F06 IV  Y69A2A_7278.e   AACGAAGAGAAAATGACACAGGA TAAATTCCAGAAAAATCAAGCCA IV-8L12
123 F07 IV  Y69A2A_7278.f   ATTCTCAGTATTCAGCCAACCAA GAATCCATGAGTACCAAGCTGAC IV-8L14
123 F08 IV  Y69A2A_7278.g   CACTTCCACCACACAACTTACAA CAGTAACCAGTAGTTTTCGTGGC IV-8L16
123 F09 IV  Y69A2A_7278.i   TACCATCATTCACCATTCTACCC AAGCATATGTTCTTTAACGGCAA IV-8L18
123 F10 IV  Y69A2A_7278.j   TGATTCAAATATTGTTCGTCCCT AATTTATTGGAAAAATGGGGAAA IV-8L20
123 F12 IV  Y69A2A_7278.l   TGTTGCAACTACAACAAAACCAC AGGTTCAAACTCGCAATTGAATA IV-8L24
123 G01 IV  Y69A2A_7278.m   AGAACCGGTTTTATTTTCCACAT TTCAAAAATTCAAAAGTACCGGA IV-8N02
123 G03 IV  Y71G10A_87.a    CGGAAAACAAAGCAAGATAAATG ATCGAAAATCGCTAAAAATGTCA IV-8N06
123 G05 IV  Y76B12C_65.a    TGAGCTCGAGAACATCTCATACA GTGATATTCTGAGTTCCGACGAC IV-8N10
123 G08 IV  Y76B12C_66.c    ATACTGAAAGCGAAAATGTGGAA CGGAAAATTCAATGAACAAAAAG IV-8N16
123 G09 IV  Y76B12C_67.a    TCGGACAATTTCTCACTGAATTT GTTATCTCAGTCAAATCCGAACG IV-8N18
123 G10 IV  Y76B12C_67.b    ATTTGAAACTTTTCCAACCGAAT CTAAGCCTAAAGTTAAGCCTGCC IV-8N20
123 G11 IV  Y76B12C_67.c    GCCGATTTTAAGACAAAAGAGGT GAGGCCATTTAGTGAAAGCCTAT IV-8N22
123 G12 IV  Y76B12C_67.d    ACTTCTTATCCCAGAGACGATCC TCATAAATCGAAATGGCAGAGTT IV-8N24
123 H01 IV  Y76B12C_67.e    CGGAAAACAAAGCAAGATAAATG AATCGCAAATTTTTGGGTTTAAT IV-8P02
123 H02 IV  Y76B12C_67.f    ATTTCCACCATTACCCTTTCAGT CGATTTTTCGAATTTTTCTTCCT IV-8P04
123 H03 IV  Y76B12C_69.a    ATTTAGCAGAGGATATGGTGCAA TTGTCGGTTTGACTAACTTCGTT IV-8P06
123 H04 IV  Y76B12C_69.b    CAAAGCTGGGAAAATACCTTCTT GAGGAAGTAGACACATGCATTCC IV-8P08
123 H05 IV  Y9C9A_51.a  TCCGAATTTGAGCAAGAGAGTAG TGAAGAGATATAGGGTTGGGGTT IV-8P10
123 H07 IV  Y9C9A_53.b  TCCGTTCTCATTCTACTGGTTGT CCAAATTATTACATCTGCCCAAA IV-8P14
123 H08 IV  Y9C9A_53.c  AAATGCTTACAGCCATCACAGTT TACTCTCATTTAAAGACGCCGAA IV-8P16
123 H09 IV  Y9C9A_54.a  TCATTTTCAACGCTAACCTTCAT TTCAATGATGTCAACAGACGTTC IV-8P18
123 H10 IV  Y9C9A_54.b  TTGGTGCAACATTATTTGAAGTG CGAGTTTATATGGAATTTCGCAG IV-8P20
123 H11 IV  Y9C9A_54.c  CTGGGTTGAAAACTTCAAGAATG GCCAGCAATAATAGAACAAGTGG IV-8P22
123 H12 IV  Y9C9A_54.d  TTTTTCTTCTAATCCGGTTGTCA TGAAACGTCTACAGTAGCATCCA IV-8P24
125 A02 V   B0348.1 ATGAGTCAATTATAGCCCCCACT AGAGCACAGATCCAGAAACACTC V-1A03
125 A04 V   B0348.3 TGAACTACAACAAACGACAATCG TGTAGCAAACGACACATAACAGG V-1A07
125 A05 V   B0348.4 GCAGATCCGGACAGAAAGAG    CAAGTTGGTGACGTTCGATG    V-1A09
125 A06 V   B0348.5 TGACCGTAATCCGAATCCAT    CACACATGATTTGTAGGGCG    V-1A11
125 A07 V   B0348.6 ATAGGGGGAAGCGAAACAGT    CGTTTTCCGAGCTCTAATCG    V-1A13
125 A08 V   Y38C9B.a    TTTTGTGGTGGACTCTAACAGGT CTTCCCCACTTCCATTCTCTACT V-1A15
125 A09 V   Y38C9B.b    AAATTTCTAATCGCCTCCTGAAC CCCCATCATAAAACCATCAAGTA V-1A17
125 A11 V   F56E10.1    ACAATGGTGAGGATTCAGAAGAA GCTCAGATCAAGTTTTGGCTAGA V-1A21
125 B02 V   F56E10.4    TCACTCGGTAACCTAATCCTGAA CGTTTATCTCGTCTTCCCTTCTT V-1C03
125 B04 V   Y38C9A.2    CGCGTAATATTTTTCATCGTCTC TCTGCGTCCTCTTGAATTTCTAC V-1C07
125 B05 V   W03F9.1 TAAAATGGCTGCGGATTCTC    GTCTGTCGCAAAATGCAGAA    V-1C09
125 B06 V   W03F9.2 CGCCAAATACTCTCCGTCTC    AAAGCGCTTCCAAAGTAGCA    V-1C11
125 B07 V   W03F9.3 GAGCTGCTCAACAACAGAAGAAT CCCCCAGAACACTAACTTTCTCT V-1C13
125 B08 V   W03F9.4 CTCGGAGCAAGCTGAAGAGT    CTGTGAATACCACATTGGCG    V-1C15
125 B10 V   W03F9.6 TACTTTCGGCGGATTGAAAC    GACGCATTGTCTGCTTTGAA    V-1C19
125 B11 V   W03F9.7 GTTGCGGGAAAAGTGAAAAA    CACCGAATGCTCAAAATGTG    V-1C21
125 B12 V   W03F9.9 ATTGCGTCCTCTAACCAACG    CACCGAGACCCAAAAACACT    V-1C23
125 C02 V   DC2.1   CAAAATTGGTTTTACTCGTTTGC ATTGGCGTCAGTTTAGCTATTGA V-1E03
125 C04 V   DC2.3   CCTTGTGTAGATTTACGCGACTC TTGTGGAAATTTATTCAAAACGG V-1E07
125 C05 V   DC2.4   GGAGGCTCCAAAAGAGGATATTA CGAGAATCGGCTATAGTGAAATG V-1E09
125 C06 V   DC2.5   AAGTTTTCAAATTTTCTCGAGCC GATTTCGCAGACAACGAATAAAC V-1E11
125 C07 V   DC2.6   ATCACAATTGGCAACAAGAGAAT CCAGTAGCCTGAACCACTAAATG V-1E13
125 C08 V   DC2.7   GAAATTTCCAAAAAGTGCAAAAA ACCCCTTTCAAAGTTCTGAGTTC V-1E15
125 C09 V   R02C2.1 CGGCAAACTTTTGCAGTTTT    TGCCCCTTTACTCTCCCTTT    V-1E17
125 C10 V   R02C2.2 GAATCGGCGATATCCTGAAA    AACGTCGCCAAACAGATACC    V-1E19
125 C11 V   R02C2.3 GGATTGTTCGCTTCAGTGGT    GTAGCCCTTCAATTTTGGCA    V-1E21
125 C12 V   R02C2.4 CCAAGGGTTAGTTTTTGCCA    AACAGCCGTACCTGAATTGC    V-1E23
125 D03 V   Y58G8A.b    TGCTAGAGTCGGAAACAGAAAAG CTAGCTCTTTTGTGAAGGTCCAA V-1G05
125 D04 V   Y58G8A.c    ATGTAAGAACAAGCGTGCAATTT AAAATTCCTGTGATTTTCTGCAA V-1G07
125 D05 V   F33E11.1    ATCTCATCTGATTTCGCATGATT GGTGTTCGGCCTAATTTTAGAAG V-1G09
125 D06 V   F33E11.2    AAAGCGTACGAAAAGCTCCA    TGAACTCCCTCGCTGAAACT    V-1G11
125 D07 V   F33E11.3    AAAAATTCTGGCAATGTGGC    TCCAGAAGCGTTGGGTATTC    V-1G13
125 D08 V   F33E11.4    TGTAGGAGAAGACGTGGGCT    TGCTTTGATCGCACTTATCG    V-1G15
125 D09 V   Y39D8C.1    TGCTAACGGCTCGTTTTTCT    AGTATGTCAGCGGTCCCATC    V-1G17
125 D10 V   T22H9.1 AATCTGAATAAAATCCCGCAAAT CATCTTCCTCAACATCCTCAAAC V-1G19
125 D11 V   T22H9.2 TTCAGGCTCCAAAACAAAAATTA TGCCGAAATTCGACTTAAAAATA V-1G21
125 D12 V   T22H9.3 GAGACGAATGCTTTTATCCAATG CGATAGATGACGATTTTTGAAGG V-1G23
125 E04 V   Y39D8B.c    TAGCTAATGGGAATGGTTTCAGA TTGCAATGCCTATTTCTTCTTGT V-1I07
125 E05 V   ZK6.1   TCCTTCGTCACAACAACTCG    AAGGAGTGCGGAGCTGTAAA    V-1I09
125 E06 V   ZK6.2   CATTCCGTATCCGCCACTAT    TATAGGCTCCATCGATTCCG    V-1I11
125 E07 V   ZK6.3   ACTTCTTCCATATGTTCTTGGCA ATGGCTCTCCTACGTGGTACATA V-1I13
125 E08 V   ZK6.4   TGTAAAATTTTCTTCCGCCG    TCAGGAGTCGTCTTCCGTTT    V-1I15
125 E09 V   ZK6.5   TTCAAGTCGGAATGACCCTC    CCGAGCTGTAGAGGTTCTGG    V-1I17
125 E10 V   ZK6.6   ATCAGACGTTGCTTCTTTAGCAC CTGTAACTTGGCTGAAAAATTGG V-1I19
125 E11 V   ZK6.7   AATGTAGTGCCTTTATTCCAGCA GACGATAAATATCATCAGGAGCG V-1I21
125 E12 V   ZK6.8   GCTACCTCGCATTCGTCTTC    AGTGCGCAATAGAGGCAAGT    V-1I23
125 F02 V   ZK6.10  TGTCGGCTGAGGTACTGTTG    TATCCGCGCCTCAAAATATC    V-1K03
125 F04 V   Y39D8A.1    GTAATGCTAGGTTTCGGGCA    GCAGTCGGGAAAACTGAGAG    V-1K07
125 F05 V   B0554.1 GTAGGTGCAAAAGTGCCTAAATG AAATCAGTTGAGAACTCTGCGTC V-1K09
125 F06 V   B0554.2 ACAAGCGACACCACTTCAACTAT CCTTTCAACTCTATTCGGGATCT V-1K11
125 F07 V   B0554.3 TGCATTCAGTTTCATTTCATTTG GATTTTGCATTGAAACTTCTTGG V-1K13
125 F08 V   B0554.4 GACCCAGTAGAGAACGCTGC    TTTGCAAAAATTCCCCACTC    V-1K15
125 F09 V   B0554.5 TTCGTCAGCATTGCTAGGTG    TACGAATGCCTGAACAGCAG    V-1K17
125 F10 V   B0554.6 CAAGCTTCCGGAGAAATCAC    CCCTGAAGTTGGACTACCGA    V-1K19
125 F11 V   B0554.7 CCGTTTCTATATCCAAACCAACA CATTTAGGCACTTTTGCACCTAC V-1K21
125 F12 V   B0554.8 ACCACCTGATGATTTTTAGGGAT GTCGCACTCTGCTGATTTTTAGT V-1K23
125 G03 V   M02H5.b AACTCACCAACAGCAATGAAAAT GTTTATGCAATTAACAAAACGGC V-1M05
125 G04 V   M02H5.c TTTTTGTTTCGTGCCATAAAAGT CTTTAAGCATTCAAAAATGTGCC V-1M07
125 G05 V   M02H5.d AAAATTCCTTTTTCGAAGCAATC TTCAGAAAAATTCCAGGATGAGA V-1M09
125 G06 V   M02H5.e TATTCCCCCTAAAGCAAGTAAGC TTTAGCGAAACACACTTTGAACA V-1M11
125 G07 V   M02H5.f GAAGACTGGTCTCAAAATGATGG TTGACTCACTTTGTGCAATTTGT V-1M13
125 G09 V   T01G6.1 CAAAAATGACCCGTTTTGCT    TACGATCCGACAGGAACACA    V-1M17
125 G11 V   T01G6.3 CCACCTGCATAGTATTTCAGGAC AGAGAAAAATTCAGCGGAAAACT V-1M21
125 G12 V   T01G6.4 AATTCCCACAATGCAAAAGC    TAAGTGTGCAGATCGTTGGC    V-1M23
125 H02 V   T01G6.6 AACTGCACATTGGCCTTAAAATA TGAGAAAAATGCAAATGGAAGAT V-1O03
125 H03 V   T01G6.7 GAAATCTCATGGAAAGCATTTTG TATATGTCGAGCTGGAAAGGAAA V-1O05
125 H04 V   T01G6.8 GCGCTTGCCTTGAATTTTTA    GCCAGGAACAATCTGGAAAA    V-1O07
125 H05 V   T01G6.9 GTGTGGATGCAGTTGCAGTT    ATTTTCCATCGCGATTCTTG    V-1O09
125 H07 V   R11G11.1    TATCGACGTCAGTGGTCTCG    TAAAACATTTCCGGATGGGA    V-1O13
125 H08 V   R11G11.2    GTGATCCAAGTGCTCCGTCT    TTGTAGTTTGCGAGCACAGG    V-1O15
125 H09 V   R11G11.3    TTCTCATGAGGAATCGGAAATTA TTGTGTGTAATCATATGTGGGGA V-1O17
125 H10 V   R11G11.4    CCACTACATTCCGACGGTTT    CCGGTGAATCTTTTCCGATA    V-1O19
125 H11 V   R11G11.5    AATCAGCTGTTTTCTTGTTTTCG GTGTTCATACTTTCGAAGCTCGT V-1O21
125 H12 V   R11G11.6    CCGCTCATAATTCTATGTTCCTG ACGGGACATCTGAAGTCGTATAA V-1O23
126 A02 V   R11G11.8    TTCACGATCTTCTCCAACCC    TCCTGGCTTGCATCTCTTTT    V-1A04
126 A03 V   R11G11.9    GAGCTCGTGTAAGATTCCGC    AGCTTCACTTGCGAATGGTT    V-1A06
126 A04 V   R11G11.10   TGAACAATTGTCGTGCAGTAATC GTACTGGCTTGCATCTCCTGTAT V-1A08
126 A05 V   R11G11.11   TTGAGAATATGTTGGTTGCCTCT TTCCAATTCTTATGTCAAAGCGT V-1A10
126 A06 V   R11G11.12   GAACATTTCCGGGTGAGAAA    TGTCAGCTACCTGCTGGATG    V-1A12
126 A07 V   R11G11.13   ATTTCCTGCCGAAAATGATG    CGTGAACTTTATCCTGGCGT    V-1A14
126 A08 V   R11G11.14   AAATGTCCTTACCTGCCCATACT AAAATCCGTTTCAGCAAATGTAA V-1A16
126 A09 V   R11G11.15   AATTTCCCAATTCCGCCTAC    TGGGACTAATTGTGCAACCA    V-1A18
126 A10 V   C14C6.1 GTACCTAGGCCTGTGTTCCTTCT AGTTGGAGTAACTTCATGGTGGA V-1A20
126 B01 V   C14C6.4 TGACTGGAAAAGGAGGTTTGTAA TGAAAAAGTGATGACCCAAGAGT V-1C02
126 B03 V   C14C6.6 TTGCAGGAACTTTGGCTCTT    AGCAGGATGCGTGAAGAAAT    V-1C06
126 B04 V   C14C6.7 GGTGGCAATCCTGAAAAAGA    AAACGGAATACGAAACACGG    V-1C08
126 B06 V   C14C6.9 AAGCGGGAGCTGTTACTGAA    GGCAGTCAATAGGTGCGTTT    V-1C12
126 B07 V   C14C6.10    GCCGATTTCCTGAAAACAAA    TAGACTTCAGCGAGCCACAA    V-1C14
126 B08 V   C14C6.11    GCCGGAAAAATATGCAAAGA    ATTCCCGCACAAACTTTGAC    V-1C16
126 B09 V   C14C6.12    TTTCGATCTTCAAGACTCCTCAG CTTTTTCGTTGCTAACAGTTGCT V-1C18
126 B12 V   K06H6.2 TCAGCACCCAAAATGTACCA    AACCCTCTCGGTCCAAAACT    V-1C24
126 C01 V   K06H6.3 TGGACGTGAATAGCCAACAA    TCAGCGGTTTATAATTCGGG    V-1E02
126 C02 V   K06H6.4 ATATTGCGGTTTCAGCGACT    ATTGCGGGTTCAGTATTTGC    V-1E04
126 C03 V   K06H6.5 CATTGGAATTTTCACAAGAAAGC CGATTAGCGATGTCCATAAGTTC V-1E06
126 C04 V   K06H6.6 TGAAAAGTAGCCCATCCACC    CAAAAGTGCCACAGCAGAAA    V-1E08
126 C05 V   ZK488.1 TCAAACCCTGGAAAAATTCG    TAAACACCTTGGCCACTTCC    V-1E10
126 C06 V   ZK488.2 TTGCAAAATTTGTGGAGCAG    CTTCCGTGGGGTAATTGCTA    V-1E12
126 C07 V   ZK488.4 GGTGAGCATTTTGAGGGGTA    GTCCGGCAACCTTGTAAGAA    V-1E14
126 C08 V   ZK488.5 TCCGAGTCAAGTTTCCCAAC    AGTCGGCTCTCCAGAAATGA    V-1E16
126 C09 V   ZK488.6 AAAGAGAAGCACTACTGCACACC AACATTAATTTGACCATGATGCC V-1E18
126 C10 V   ZK488.7 TTGAAAACACCTCGTCTGAAAAT TCGGAAACATTAAAAATTGTGGT V-1E20
126 C11 V   ZK488.8 GGAAGGACACGGATGTTGTT    ACCTGAGAAGAAAATCGCCA    V-1E22
126 C12 V   ZK488.9 GTCTATTGCCAGATGGAATGAAG ACTCGGAAATCCACTTCAATTTT V-1E24
126 D01 V   ZK488.10    TTTCATACTTTTGGGAATGGGTA GCTTGCTCATATACATCCTGACC V-1G02
126 D02 V   F48G7.1 TTTCGGAGCCTTAGCGTTTA    GACTATAGCCACTGGGTCGC    V-1G04
126 D03 V   F48G7.2 CTGCGAGCAATACAGTTGGA    TTAGCCACACTTCCCGTACC    V-1G06
126 D04 V   F48G7.3 CAGTGTCAGCCCTTCACAGA    TTTTTCTTTCAGCTCCCGAA    V-1G08
126 D05 V   F48G7.4 GCGCTGTCATTTATTACCTCAAC CAGAAGTGACAATGTCTAACCCC V-1G10
126 D06 V   F48G7.5 ACTTCCAAAATTATGAGTGGCAA ATTTCGTTACGGAAGTTTTAGGC V-1G12
126 D08 V   F48G7.7 ACATGTCTTCGGACACTTGTCTT AGAGGTACATGACGCAAGTTGAT V-1G16
126 D09 V   F48G7.8 TTGGTGCTCCACTTTCAAGTAAT TTCGAGTGGTTTTTCTCACATTT V-1G18
126 D10 V   F48G7.9 ATGTGGAACGTAAACAAAAATGC TCACAGAACATTCAAACAGTTGC V-1G20
126 D11 V   F48G7.10    GTGAAATGTGTTTTCTAGGCAGG TGTTAGATTGCAATTGTGTGACC V-1G22
126 D12 V   F48G7.11    TTTTTCTTTCAGCTCCCGAA    CTATCCAGTGTCGGCTCTCC    V-1G24
126 E01 V   F48G7.12    TTTATTCAAATTGCACGCCA    ATGCTAAGACCACACCCGTC    V-1I02
126 E02 V   F48G7.13    TGGATTTGAAACATCGGTGA    AGTTTCTGCAGACGCCATTT    V-1I04
126 E04 V   F31F4.2 GGGTTCACCGAAGCATAAGA    AGGTAGGTAGGTAGGCGGGA    V-1I08
126 E05 V   F31F4.3 TTTATTTGTGCTGCTGGCTG    TGTCGGCTACTCTACGGCTT    V-1I10
126 E06 V   F31F4.4 CGCGTTCTTTTTCGGTTTTA    CATGGTCAGCCGAAGTTTTT    V-1I12
126 E07 V   F31F4.5 CATACAAAGATGCTTCGATCGTT ACGAGGAACATACGACAAGGTTA V-1I14
126 E08 V   F31F4.6 TGAAACCCCACAAAACATCA    GGTTTGTGAGCCCATAGCAT    V-1I16
126 E09 V   F31F4.7 GTTGCCCGCCTACTACAAAA    AAGAAGAGGGCGTGGAAAAT    V-1I18
126 E10 V   F31F4.8 AAGTAGATCACCACCACGGG    CAATCATTTTTGGCGTGTTG    V-1I20
126 E11 V   F31F4.9 TGACGTGACAGTTCTCGGAC    ATAATGCTCCGCTGATGACC    V-1I22
126 E12 V   F31F4.10    GTGCTCATAACGCAGCTAATTTT AAGTGTTTCATTGACTTTCGAGC V-1I24
126 F01 V   F31F4.11    GGTCTCCGGACAACTATCCA    AAGACGGATCTATTGGCGTG    V-1K02
126 F02 V   F31F4.12    TGAGCCAGCATGTAGGTCAG    ACCACTTTGGAGTGGACAGC    V-1K04
126 F03 V   F31F4.13    CGATTTTTCGGCTTCTCTTG    CCCGATGACTTTTCCAGTGT    V-1K06
126 F04 V   F31F4.14    GGCCTGAAGCTTCTCAACAC    CATAATCAACGATCCCCGTC    V-1K08
126 F05 V   F31F4.15    AAAGAGTGGGGACTGCAAGA    GGCCTCCTTTATTGAAACCC    V-1K10
126 F06 V   F31F4.16    ACTGTGGGCTTTTTCAATCG    CTACTGATTGGCTTTGCGGT    V-1K12
126 F07 V   F31F4.17    GTCGTGGCACTCTATGAGCA    TCCGGTTAGAATGAGGTTCG    V-1K14
126 F08 V   H25P19.1    TACGGTATGCAATGAGAACTGTG ACACGCGAAGATTTCAGATTTTA V-1K16
126 F10 V   H24O09.b    ATATCGCATACAGTAAACTCGCC TGTCCATTCCCTCTCATTTCTTA V-1K20
126 F12 V   H24O09.d    TAGATCAAAAGCCACCATCAACT AGTGCAAAGAACCGACATGTTAT V-1K24
126 G02 V   H24O09.f    AAGATAGAAATATGGACCGGAGC CCAGAAACTACAAGGAGAAGGGT V-1M04
126 G03 V   C05E4.1 ACAGATAACGGCGTGGAAAC    AATCAAGCATGAACCCCAAG    V-1M06
126 G04 V   C05E4.2 CTTATCTCGGCGGATTTAAAAGT ATTGCATAATTCAAAAACGGATG V-1M08
126 G05 V   C05E4.3 CAAAAAGTCTCAGGAAGCCG    ATTGATGAGTTGCAAAGCCC    V-1M10
126 G07 V   C05E4.5 CCCGTTTTCCCTACATCAGA    CTCGGTTTTGTGGAAGGTGT    V-1M14
126 G08 V   C05E4.6 TCATGGACCATTTCGCTACA    AAAGCAGCAAATTCCCTGAA    V-1M16
126 G09 V   C05E4.7 CCGTAGTAACACGTTGTGTTTGA CTAGGAATTCGAACATTGGACAG V-1M18
126 G10 V   C05E4.8 TAAAATTGTCCTGAAACGCCTAA TAAAATTGTCCTGAAACGCCTAA V-1M20
126 G11 V   C05E4.9 TAGAGGACTCTGCGTCGGTT    CACAATGAGTTCTGCGGCTA    V-1M22
126 G12 V   C05E4.10    GATTTCTTCCCAGCCTTTCC    CCAAATCCCCAACAGCTTTA    V-1M24
126 H02 V   C05E4.12    GTGAGCTTGGTTTTGAAATTTTG ACACCTATCATTGAAGAGCTGGA V-1O04
126 H03 V   C05E4.13    GAAAATCACGAAATTCATGGAAA AAGGAGTCTATTTTCCCAGCAAC V-1O06
126 H04 V   R09E12.1    GGTAACCATCGTCGCATTCT    TTGCAAAATGCACTCAGAGG    V-1O08
126 H05 V   R09E12.2    TTCCCTTATGTCTTCTTTGGTGA ATGTCATAACCGGTGCATTATTC V-1O10
126 H06 V   R09E12.3    TCCCTATTTTCAGGCGATTG    AAGACGAGTCCAGAGGACGA    V-1O12
126 H07 V   R09E12.4    GGATTTAGTGGGGTTAGATGGTC AGACATTTCTCTCGTGGTGTCAT V-1O14
126 H08 V   R09E12.5    GGTTAGTGGAAGGAGCCACA    GCTCCGTCTTTTTGCTTGTC    V-1O16
126 H09 V   R09E12.6    CCCGGAGTCTTCTGATTCAA    CACTGGATCGTCATGATTGG    V-1O18
126 H10 V   R09E12.7    AGAACGTCAGTTGAAAACTCTGC ACCCCAAACCAATATTCTTCCTA V-1O20
126 H11 V   R13D11.1    CCTGCAAAAGAACAAGCACA    ACGGTACTATTGACGCCCTG    V-1O22
126 H12 V   R13D11.3    TTTTCCATCTCAAAAATCTCCAA GTGAATGCTATCCCAGTTACCAG V-1O24
127 A03 V   R13D11.6    AGGCACTAAAAAGACGGCCT    TGCTCCACTCTGTTGATTCG    V-1B05
127 A04 V   R13D11.7    TTTCGAAGCTGTCAATGTGC    GAACGAACCACGTTCTCCAT    V-1B07
127 A05 V   R13D11.8    GAGCATAAACAAAGCCTCGC    TAATTTCAATCGGCCTTTGC    V-1B09
127 A07 V   F41H8.1 CCGCCCTATAATCACTTTTCTCT ACCGACATCGTGTGAGTTAGAGT V-1B13
127 A12 V   K09C6.3 TTTTTCTAATCATGCCGAGTGTT TATCTAGTGTGCAAAAAGGGTGG V-1B23
127 B01 V   K09C6.4 TTTTATTTTCGTTTTCTGCTGGA TTACGGCCAAAATTTTTCTAACA V-1D01
127 B03 V   K09C6.6 TTTTCTTAAAACTGGCGTAGCAG GTTGCCGCTTTTACTCAAAATTA V-1D05
127 B04 V   K09C6.7 CCACTCCCTCAAAATCCTCA    AGTATCGAAGATGGATGGCG    V-1D07
127 B05 V   K09C6.8 GAACAAAGCCACACTTTCAAAAC TGTCTTTACCAGAGGTCCAATGT V-1D09
127 B07 V   T02B11.1    ACTTTTACTTAAGCGTCGCTGTG GCTTCAAAAATCCAAAATTTCCT V-1D13
127 B08 V   T02B11.2    TCGAGTGGAGCCTTCAAACT    GTTGCCAACTTGCTCCTCTC    V-1D15
127 B09 V   T02B11.3    TTGGATGATCTTTTTCGTGAAGT TGAGAATCTAGCCAAACCTTCTG V-1D17
127 B11 V   T02B11.5    AATGTGCCGGAAGTGCTTAG    TACACCCCTGTCCCCAATAA    V-1D21
127 C01 V   T02B11.7    TTGAGCAACCCTGCTCTTTT    AGGCCTTTCCAGGTTTGTCT    V-1F01
127 C02 V   H24K24.a    CGGAGGATTTGACTACACTTTTG CAGACTCTCTCCCTTGTGAAGAA V-1F03
127 C03 V   H24K24.b    TGTACATATTTATCTTCGCGCCT TATCGGAGGACTGTGGAACTTTA V-1F05
127 C06 V   R09A1.1 CAAAAATGAGCTATAACAACGGC GACTGTTTGCCAGTTCAAAATTC V-1F11
127 C07 V   R09A1.2 TGTAATCCACACGGACAAATACA AAAGTCTCGAAATCCACAACAAA V-1F13
127 C10 V   C02E11.1    CTTTTAATGTTTCAAAAACCCCC TGCAACTGTAACCTTTTCCCTAA V-1F19
127 C11 V   K10C9.1 TTTAAAATCTTTCGGCAAATTGA AAAACGTCGGATGCTGTTAAGTA V-1F21
127 D01 V   K10C9.3 ATATTTATCGCAAACCAAGAGCA TAATTTTATGGGAACTGCCTCAA V-1H01
127 D03 V   K10C9.6 TCTTCATCCGGCAACATATAACT TCAGTGATACAGACTGTGGTTGG V-1H05
127 D04 V   K10C9.7 CCCAAATCCGAATCATCATAGTA ATCTCCGGAAGGTAGATGAACTC V-1H07
127 D05 V   K10C9.8 GGTGCATCGAGTTATTGAGAAAC GGTAAGCGATTCCATACTCCTCT V-1H09
127 D07 V   Y50D4B_7.a  TTCTGCCAAAAGTGGAAAATAAA GTGGATCATCATTTGAACCGTAT V-1H13
127 D08 V   Y50D4B_8.b  CTAAAAATTACCGCCTCAATGTG AGTGATTCGCCTACGTGAAAATA V-1H15
127 E01 V   Y50D4B_10.b GAATCATTTTGTGGTGGAATTGT TTTCCAAGAAAATTCCGTGTCTA V-1J01
127 E04 V   W07B8.3 GAATCACATAAATTGCGCCTATC CCGGTTAAACCATGAAAAATACA V-1J07
127 E05 V   W07B8.4 GCAGCACTCTCGATACCACA    TCCATTCGAGGTGAAAAACC    V-1J09
127 E08 V   T21H3.2 GGATTCCTCTTCCTTTTCGG    TACGCCTCTCCACTGCTTTT    V-1J15
127 E09 V   T21H3.3 ACCGGTATTCATCATTGTTTACG TGAGAGAAAAGGTGTTGGTGATT V-1J17
127 E10 V   T21H3.4 TTCCTTCATCCTTCGTGACC    GCCACTTGTTGATCGGAAAT    V-1J19
127 E12 V   F25A2.1 GTTCGTCATATTTCCAAGCAAAG CGCTAGTAGAACTCTTGCGTGTT V-1J23
127 F01 V   C39F7.1 AGCTAAAATCGGGGGAAAAA    CAAATCACCCCCTTCAAAAA    V-1L01
127 F02 V   C39F7.2 CCCCTCAAAAATTAAAAACAACC CTCTACAACGCTCCAGCAACTAT V-1L03
127 F03 V   C39F7.3 CGAGTAACCGTTTTAAGACATGG TTTGCTCCGTTCTACTCTGTTTC V-1L05
127 F04 V   C39F7.4 AAGAGCTTGATGGTGAAAGAGTG GCAATTTATAATTTTTCAGGGGG V-1L07
127 F05 V   C39F7.5 CGCCGTAAATCTACCCAAGA    ACAAATATCGGAGCGAATGC    V-1L09
127 F06 V   Y75B7B.a    TAACTAACCTGTGGCTTGGTGTT TTGTTCATCTTGTTCACGAATTG V-1L11
127 F07 V   Y75B7B.b    GCAAAAATTACACAATCCCAAAA TCGCCTATTTACCAGAATTGAGA V-1L13
127 F08 V   ZK1005.1    AACGGGGTACGCTTTTTCTT    CAAATTTGCCACCGAGTTCT    V-1L15
127 F09 V   F16B3.1 AACGGAGGTCTCTTCGGTTT    TGTCGACAGTTGGATTTGGA    V-1L17
127 F10 V   R12A1.2 GGCACCGCATTAAGACAGTT    ATGGAGGATATCGACGAACG    V-1L19
127 F11 V   R12A1.3 AATTCCCCAAATCACTCTTGTTT CTCCCACAATGCTATATCGTCTC V-1L21
127 F12 V   R12A1.4 TACAACTTACCCGGTTTTAGCAA TTGAAGGGTCCTTTTTGTCACTA V-1L23
127 G01 V   R09B5.1 GTTTGACCCAAAGAGCAAGC    CACCCAAAACATCCACATCA    V-1N01
127 G02 V   R09B5.2 CAGTTAGAGGACTTTTCTTGGCA TCCCGAAAATGAGTCAGAAACTA V-1N03
127 G03 V   R09B5.3 GAATGTTTTTATTTCACACCGGA ACCCCTTCAAAAGTCAAGAACTC V-1N05
127 G04 V   R09B5.4 CTGAACGCGGAAAAGTTCAT    TAAACCAAAACTTGCCGTCC    V-1N07
127 G07 V   R09B5.7 AGTGGTGTTTAGCAGTACCCAAA CTTTCATTGTAAGTTTCTGCGCT V-1N13
127 G08 V   R09B5.8 GAAGAGACAGGAAGAAGGAGGAG AACGGAAATCCAGTTCTACCATT V-1N15
127 G09 V   R09B5.9 CCTGACCTTTCTGATTGATTGTC CAGTTGAAGCTTTTAGGTAGGCA V-1N17
127 G10 V   R09B5.10    AAAAGCCCAGCTCAGTTATTTTC GCAAGAGTGTATTTAGTCCCACG V-1N19
127 G11 V   R09B5.11    GGCAAAAAGTCTCAACTGGC    GCATCATTTCAAGACGGGTT    V-1N21
127 H01 V   F53E2.1 TCATCAGAACACCATTCAGACAC AATACAAATTGGGAAAACTCGGT V-1P01
127 H02 V   C38C3.1 CACTCTTCCAATGTTTCTGCTCT CTGGATGCGTCAAGTAGAATACC V-1P03
127 H03 V   C38C3.2 ATACATGCCCATCACTTTTATCG ACAACTTTTGACGGAGAATTCAA V-1P05
127 H04 V   C38C3.3 GGCTCCACCATCTCAACACT    ACGCTCTCTCATCTGCCAAT    V-1P07
127 H07 V   C38C3.6 AGACGTTTTCATAGGATGCGTAA AAAATAGGGTGGAGACCACAAAT V-1P13
127 H08 V   C38C3.7 ATGTCGAGATCGGTACTGGC    GTGGTCTGAGAGAACCCCAA    V-1P15
127 H09 V   C38C3.8 CACTTTCTAATCAGCTGGCAAGT AAAATAGCCACGAAAGATGACAA V-1P17
127 H10 V   C38C3.9 TTTCTCCAAATTTGCCCTTG    ATTCGCAAGCTTCCAAAAGA    V-1P19
127 H11 V   K02H11.2    GGCAAAGAACCCATGAAAAA    AAGCGCTGGTTCAAAAGGTA    V-1P21
128 A01 V   K02H11.4    TTTTCGACCATCTCGGATTC    ATCTCGCATAATTTCGGTGG    V-1B02
128 A03 V   K02H11.7    TTTGGCACAGATCACCAAAA    TCCAATGCTGGATACAACGA    V-1B06
128 A05 V   F52F10.1    TTAATAACTCCAGAGCCGTTTGA TCTATTCGAATCCCGATTACTCA V-1B10
128 A06 V   F52F10.2    GTTTTGATTTTTGCAGTTTGGAG ATTGCAACTTCCACTCCAATAGA V-1B12
128 A07 V   F52F10.3    CATAGCTTGCAGCTTTGAATTTT GGTGGCACAATCTTCTTTACATC V-1B14
128 A12 V   F16B4.3 GCACTGCAGTTTCCAGAACA    CAGTTGCAGCTCCATTCAAA    V-1B24
128 B02 V   F16B4.5 TGTAGCTTTGAAAATACGGGAAA TCGGCCTTGAAGTCATATTTTTA V-1D04
128 B03 V   F16B4.6 CACTTTTCGCCAATTTTTCATAG GGCCGAGTCTGTAGAGAATTTTT V-1D06
128 B04 V   F16B4.7 TTTTCTGACCAGGTTGTTTTTGT CATGCTGGAAAATTCTAACCAAG V-1D08
128 B05 V   F16B4.8 CTCCGACGAAGATTCCATGT    CTTTCGGCCATTCTCATCAT    V-1D10
128 B06 V   F16B4.9 AATCAAAAATATTTGCCAGCTCA TTGCAGAGACCTACCTTCACTTC V-1D12
128 C03 V   K04F1.1 TTTCAAAACGTGACAACTTCCTT CTGATCGAGTTTTTCTTCTTCCA V-1F06
128 C04 V   K04F1.2 TGCTTCATTTTTGTTTCCAAGTT ACTTACTTTAGTAACCGTCCCGC V-1F08
128 C05 V   K04F1.3 GATCTTCCACATGGCTTGGT    CGTAACTCGTGAAAATGGCA    V-1F10
128 C10 V   K04F1.8 TGTGGAACACTTTCAAATGACAC AGTTTCCCATGATTTTTCCATTT V-1F20
128 C11 V   K04F1.9 TTGAAAACAGTATTGAAAACCCG CGTTTCGTTTCCTTTTTCCTAAT V-1F22
128 C12 V   K04F1.10    AAACGGGTTGTTATGCCAAA    ACCGTGTTGAGAAAACTCCG    V-1F24
128 D01 V   K04F1.11    CTTAGGCGTAGGCTTAGGAAAAG TTCTTGAAGCTTTGGGTACAAAC V-1H02
128 D03 V   K04F1.13    CCACCAAGATTATCACCAGTAGC AGAAGTTAACCCCATTAAACGGA V-1H06
128 D04 V   K04F1.14    TGTTCGTTCGACAGAAAACG    GCTCTAACGTTCGGCTTCAC    V-1H08
128 D05 V   K04F1.15    TTGGGTGTTCCTGTTTTCTTTTA ACCAGTATTGCATAACGGTGAAT V-1H10
128 D07 V   Y46H3C.b    AATGCGTACCTCACAGCATATTT TTTCAGCATTGAGGATATGGAGT V-1H14
128 D10 V   Y46H3C.e    TAGATTCCCAAAGACACTTTCCA ACTCCTGGTAGTCCACGATAACA V-1H20
128 D12 V   Y46H3C.g    TTCATTGTTGTTCAATGCGTTAG CAAAGTTTTCAAATTCACCTTGC V-1H24
128 E01 V   Y46H3C.h    TCCTAACAATTTCGTTCTGGAAA AAGTCGTTCAACATTACGGAAAA V-1J02
128 E02 V   ZK697.1 ATGGCGGTTCAAACTACTGC    TATTTCAAGTTTGCGTGCCA    V-1J04
128 E03 V   ZK697.2 TCGAAGAGCTTCAGCATTTTATC GAATCGGATCATCATATCCTTCA V-1J06
128 E04 V   ZK697.3 AAAACTGTACTTGAAGCACTGGG GAAAGCAGTCAAACACAATTTCC V-1J08
128 E05 V   ZK697.4 CATTGGCTTGTTCCCAATTT    AAATTCCACGAAAATCGACG    V-1J10
128 E07 V   ZK697.6 AATGACAAGATCAGCCCAAGTAA AATTTTTCGATTTTGGAAGAAGC V-1J14
128 E11 V   ZK697.10    TCGCTAATGAGCATACCGTG    TTTCGCCTTGAGACAAAACC    V-1J22
128 E12 V   ZK697.11    CGATAGGGTTGATGAAGTGAAAG CATCTGCTGACATTATGACGAAA V-1J24
128 F01 V   Y46H3B.a    CTCCTGGTTTCCTTTCCATTATC TTTTGGTAGGAAACAAAAGCTGA V-1L02
128 F02 V   Y46H3B.b    CGACATTTTCTGGACTTTCAAAC CTAAAAGCCTGAAGTATGGAGCA V-1L04
128 F05 V   Y46H3A.c    TTTTATGTTGCATTCTGATCGTG GACGAGGGAATATCGTTCTTTTT V-1L10
128 F06 V   Y46H3A.d    GACAGTTTTAAGTGTTTCCGTCG CCGTTGAAAATAAATACCGAACA V-1L12
128 F07 V   Y46H3A.e    GAATGCGGGTATATAAGGAAAGC TCAAAACGGCACAGTTTTAAGTT V-1L14
128 F10 V   Y46H3A.h    ATCCGGTTGGTTTAATCAAGTTT ATGAAGAGATGCGAAGAAGTGTC V-1L20
128 G02 V   T10B5.4 ATTAAGAGCGATTAAAACGAGGG TAGCTTCTTCCCCATTAGTTTCC V-1N04
128 G03 V   T10B5.5 GGGGCACATTGATCTCCTTA    AGCGTTCAGTTATGCTGGCT    V-1N06
128 G04 V   T10B5.6 TTTTCGCCAGAAATTCATCC    GCTCATCATCAGCAGTTCCA    V-1N08
128 G05 V   T10B5.7 TGGAGAAGAGACAGAGAGAATGG CATCCTCCTTCTCGGATACTTTT V-1N10
128 G12 V   T06A1.5 ATCTCCACCTCACCACTTGC    CGCCCTTCTTATCACCAAAA    V-1N24
128 H01 V   Y40B10B.1   GTGAACTGACCATCGGTATAAGC ACATCTCACTTTTTGGCAACATT V-1P02
128 H03 V   T08B1.1 CCCACTGTCCTTTTCCTTGA    CAAGCAGTCATGCCTTCAAA    V-1P06
128 H04 V   T08B1.2 GGCGGACTCTTCCTTCTTCT    TGATCTTTTTGCGCAGTTTG    V-1P08
128 H05 V   T08B1.3 AATGAAAACCTGATGCCGAC    AGCCACAAAACCAGCAGAGT    V-1P10
128 H06 V   T08B1.4 AACATTTTTGAGAATGCGGC    CCCCTAGGCACTCGACATAA    V-1P12
128 H07 V   T08B1.5 TTATACGTTGCATGATGATTTCG ATGAATCAGGAAGGTCACTTGAA V-1P14
128 H11 V   F59A7.3 CAGAAAGCGTTGAAAACTCACTT TTGAGTCTTTTGGCACAATTTTT V-1P22
129 A02 V   F59A7.6 TTTTGAAACATTTTTCGATTCGT CATACTAACATTTTCCGCTTTGC V-2A03
129 A03 V   F59A7.7 TTGAAAGTTCGCCAAGAATAAAA GCTGTTAGAAATGGAGCTGAGAA V-2A05
129 A04 V   F59A7.8 CCGATGACGGAGAAGAAAAA    TCCTTTAGCTTCCTGACCGA    V-2A07
129 A05 V   F59A7.9 TATTCCAAGGCAAAGCATCC    CAATTTCCACAGCTTGCTCA    V-2A09
129 A06 V   Y40B10A.c   AGTAATATCTGCGTCTCTCACGC CAAATGCACTATATTTCACGCAA V-2A11
129 A07 V   Y40B10A.d   AATACAGCATTGTTGAGGCAAAT GTGTTCAATTATCGGGAAGTTCA V-2A13
129 A08 V   Y40B10A.e   AGCAGAACAATTTTGTCTTGAGC CTCCAAAAATGTCTATTGTTGCC V-2A15
129 A10 V   Y40B10A.g   ACTAAACGTATTTGTCCGTGTGG GCCCCCAATGTAGTTTTTAATTT V-2A19
129 A11 V   Y40B10A.h   CGTTGAGATTCAAAGTTGTTTCC GGATGCGATGGAATACAAAAATA V-2A21
129 A12 V   F36F12.1    CGTCACGAAAATGTACCCCT    AATGGGCTTGTTACGGTACG    V-2A23
129 B02 V   F36F12.3    CTGGAAACCGGAGATTTTGA    ACATGAAGCTGCAGCAAGTG    V-2C03
129 B03 V   F36F12.4    CAAGATGGGTCATAAATGCAGAT CATGTTTTAAAGCAATTTTCCCA V-2C05
129 B05 V   F36F12.6    CGATCACCATATAAAACCCAAAA ATATCCCTTGTTAGCCTTATCGG V-2C09
129 B06 V   F36F12.7    CAAGGTGAGTCGAGTTTCAGATT TAAACGATAACACTGAAGACGGG V-2C11
129 B07 V   F36F12.8    CACGCCAACAGTGAGAAAAA    ACTCAATTTCCGGCTTGATG    V-2C13
129 B08 V   F22F7.1 AATGCAGTTGGACCTGTAAGAAA TCCATATCCGAAGAACCAGTAGA V-2C15
129 B09 V   F22F7.2 TCGAATTTTCAAAACGTCTCATT ACCCGATGAAATAACCTTGAAAT V-2C17
129 B10 V   F22F7.3 ATTCGAGTTTGACGAAAAACAAA TCGCTTTCAGATCATGTCAGTTA V-2C19
129 B11 V   F22F7.4 TTCCGTGGAAGGTCTGTACC    CACTGGAAATTGAAGCCGAT    V-2C21
129 B12 V   F22F7.5 GCGTATCAATGTATGCTTCACAA GCCAATCCAACATTCTCTACTTG V-2C23
129 C02 V   F22F7.7 CTGACGTCACATTTTGTGGTAAA CTCGACGAATGTATCAAGGAAAC V-2E03
129 C03 V   C45H4.1 TTTGTTGAAGCAAATTGAAAGGT TGTTCCGCTCTTCTTTCTTAATG V-2E05
129 C04 V   C45H4.2 GTTCCGGAAGTTTTCGATCA    GGTAGGCCTTCTTTTGAGGG    V-2E07
129 C05 V   C45H4.3 TTACTCATCCAGTTTTTAGGCCA AAAAACCAGTAGGGCCTCTGTAG V-2E09
129 C06 V   C45H4.5 CCAGAAAACGTCAATGGCTT    TTTAAATTGGCAAACGGAGG    V-2E11
129 C07 V   C45H4.6 ACAGTGCCCTTCACGTTTTT    AAACACCAAGTATGCCTCGG    V-2E13
129 C08 V   C45H4.7 CTTGGCTAACATTTTCAGCTTGT AGTTATCGTTCGAAAAACCAACA V-2E15
129 C09 V   C45H4.8 AGCGGCGAGAAAATATTCAA    CCCATTATTGCCCATTTTTG    V-2E17
129 C10 V   C45H4.9 AATTGCTTGACATTTCGGCT    TCGGCTGCTTGTTAGTGATG    V-2E19
129 C11 V   C45H4.10    TCGATTTTTGTTGGACGTGA    AGAATTGGTGCAAATGGTCC    V-2E21
129 C12 V   C45H4.11    GGATGTTATCTTGAGCGTACTGG TATTTAGAGAGCTGGTTTGCGAG V-2E23
129 D01 V   C45H4.12    ATAATAATGGAGCAAGGAGCACA ACATCCGTTTGTCCAAATAACAC V-2G01
129 D02 V   C45H4.13    CTGGGGCTGTATGAAGTGTAGTC AGCCATTCTTTACTCTTTCACCC V-2G03
129 D03 V   C45H4.14    AATGCTCAAAAATGTGCAAAAAT GTAACGTACCAGACCCATATCCA V-2G05
129 D04 V   C45H4.15    GCTCCCTCATAAAAGGTTGTCTT ATTTCTTGTTTGCTGAACCGTAA V-2G07
129 D06 V   C45H4.17    GAATTTGTTGTCTATCGCGAATC CACTTCCAATCACTTTGTCCATT V-2G11
129 D07 V   Y5H2B.a TTTATGCCGCTAGTGGAAGTTTA ATTTCAAAGATGGACAGCATCAT V-2G13
129 D08 V   Y5H2B.b GGCACGAATTCCTAGATCTTTCT TCTCTTCCGCCGTACACTATTTA V-2G15
129 D12 V   Y5H2B.f AAGTGAAGTCGAAGTGAGGAGTG TTTGTTTTGTTGTTTGTTGTTGC V-2G23
129 E01 V   Y5H2B.g TCAATTTGGATGGTCCTCATAAC AAAAACATGAAACCGAGAACAGA V-2I01
129 E02 V   Y5H2B.h GTCGATCATTTACCACGAGAGAC CTTACAAACATGCCAAACACAAA V-2I03
129 E03 V   Y5H2B.i CAATTTAGCTTCGAGCAGTCAGT GTTGAAAAATGTTCGACAAGGAG V-2I05
129 E04 V   F44C8.1 AGTACCCCCAGCCTCTCAAT    TCGCCAAAAAGAGGAACATC    V-2I07
129 E05 V   F44C8.2 CCTTAATCGAACCACCTCCA    AATGATTTCCCTGGGCTTCT    V-2I09
129 E06 V   F44C8.3 TCTCGGGATCCTGTGAAGTT    TCCGATAGCTTATCCAACCG    V-2I11
129 E07 V   F44C8.4 TTTATTCCTCTCGGGTCCCT    GATACGCATAGCCCGACATT    V-2I13
129 E08 V   F44C8.5 AAACCGGCAAGTTGTGAAAC    TGCCAAAATCGTACCATCAA    V-2I15
129 E09 V   F44C8.6 GTGAGCCTGATAAAGCGAGC    GCGCTTTCCAATTCCAAATA    V-2I17
129 E12 V   F44C8.9 ACTGGCTGTCTCCAATGCTT    TGTGATCTACCAGCTCACGG    V-2I23
129 F01 V   F44C8.10    TAATCACACGTCCTCAATCACTG TCAAAAACATCTGCTATCCGTTT V-2K01
129 F02 V   F44C8.11    CCACTGGGAAAAACTTTGGA    GGCCGCTAAGCTAAAATCCT    V-2K03
129 F04 V   F41B5.2 CGCAGATTTGCCCTCTCTAC    TGGAAGTCCTTCCGAAGATG    V-2K07
129 F05 V   F41B5.3 AGACTATGTCGGTCGCGTCT    ATGGCTCTGGGAAGATCTGA    V-2K09
129 F06 V   F41B5.4 TACCCCCAGCCATTTAATCA    GAAAATTTCCATCCGAGCAA    V-2K11
129 F07 V   F41B5.5 ACAAGGCCTAGATGTAGAATCCC GTGAGAGACTGCGGAAAGAGTAA V-2K13
129 F08 V   F41B5.6 GCAATGCCTACTTTTAGCGG    ACTTTGTTTCCACGGTTTCG    V-2K15
129 F09 V   F41B5.7 GCTTTCCATTCTCGCCTATG    CTGTGGAGCACTCATCGAAA    V-2K17
129 F10 V   F41B5.8 ATAAATATCGTTGGCAGCGG    CTTGATGCTTCGGCATTTTT    V-2K19
129 F11 V   F41B5.9 TCCGAACTTCCTGGTAATAGTGA GAAAGTTGGAGAAACGTCTTGAA V-2K21
129 G02 V   Y5H2A.b TTCAGGAACGGATATGACACTCT GAACTTCCACAATGTTTCTACGG V-2M03
129 G04 V   T27B7.1 GGTGCTCATTTTGGAGCAAT    CAGCTCAATTTCAGTGGGGT    V-2M07
129 G05 V   T27B7.2 CCCCCTTTTCTCTGCTTTATTTA GTCAATCGCTTCAAATATCGTTC V-2M09
129 G06 V   T27B7.3 CCGGATGTGAAAACTGGACT    TGTTGAGATGGGAATGAGCA    V-2M11
129 G07 V   T27B7.4 AAAATGTGGCAAAAACTCCG    TGTGCAGCATTTTTCAGGTC    V-2M13
129 G08 V   T27B7.5 GAGGATGACGACACGAAAGTTAG TTTCTTTACCCACCTGTTCTTCA V-2M15
129 G10 V   T27B7.7 CGACGGTCGGAAACTTAGAG    AAATAGTGGGAAAATGCCCC    V-2M19
129 G11 V   F15E11.1    AGTAATGTGCTTAACTCCACCCA CTACGTATTAGGTGTAGGCACCG V-2M21
129 H02 V   F15E11.4    GTTTTCTCACGGGATTGGAA    CATTCTGAAGTCGATCGCAA    V-2O03
129 H03 V   F15E11.5    AATCAAAAACATTCACCTGTTGG TTCCAAGCTCTCTTTAGTGATGG V-2O05
129 H04 V   F15E11.6    TTGGTCATTCAGCAATGGAA    TTTTTCTGGCTGGGATTTTG    V-2O07
129 H05 V   F15E11.7    CACTCGTTTCGGACTCCAAT    AAAACTGCGGATTGTTTTCG    V-2O09
129 H06 V   F15E11.8    CTCCGAAAAGTGAAGCGAAC    TCTCTAAAACTTCCGGCGAA    V-2O11
129 H07 V   F15E11.9    CCGACAAAATTCGAGTCCAT    TCCGCTTATCACACCTGACA    V-2O13
129 H08 V   F15E11.10   GCCACCACTGTATAAAATTCCAA ACTGCAATCTACCGATATCCAGA V-2O15
129 H10 V   F15E11.12   GTTTGGTTCAATGTGTTTCGATT ACCTTGTGTATTGTCAGGCAAGT V-2O19
129 H11 V   Y19D10A.a   ATAATTTTTGGATTCAGGGCCTA TGCTAACCAATTTCCGGTACATA V-2O21
129 H12 V   Y19D10A.b   ACGTATTTACCCAAAATGTGCTG TGTTTTTCGTATGTAGCAACACG V-2O23
130 A02 V   Y19D10A.d   CTGTACGGACCAACTTATCTTCG GTGCTAGCGGCATTATGATAAAC V-2A04
130 A03 V   Y19D10A.e   CGTAAAAATCGTTAAAAGCAACG CAGCACAATCTGGGAACTTTATC V-2A06
130 A07 V   Y19D10A.i   CTGATCATATCAGGTTGTCCCAT TCGAGACGTTAGATTGCTTCTTC V-2A14
130 A08 V   Y19D10A.j   GCTGGAAATCATGTTTCGTTTAG GGAAACATTTCTGGCCTCTTTAT V-2A16
130 A09 V   Y19D10A.k   GTTCCATATGATATAGCCACCCA GTTTGTCTGGGAAAATGAACAAC V-2A18
130 A10 V   Y19D10A.l   ACTGAGTGAATTCATTTGATGGG TTTCGGCTTAAAAATCACAAAAA V-2A20
130 A11 V   Y19D10A.m   AACGAAACTCATTGGTTTGAAGA CAAATAAATGATGCAACAAGCAA V-2A22
130 A12 V   Y19D10A.n   CTGGAATTTTGCGATAGTGAAAC AAAGCGTAAACGTTTTGAAACAA V-2A24
130 B02 V   Y19D10A.p   TTGGCACTTTTGGAAAATTAGAA ATTTGCCGATAGAGATTTGAACA V-2C04
130 B03 V   Y19D10A.q   CAGCTCAACGATGCAATATTTTT ATTCTGAAAGCCTTTTGGACAAT V-2C06
130 B04 V   C13B7.1 CCCCATTTCAGTTAAGCTTCTTT GCCGTTTAGACTTGTACAACCAC V-2C08
130 B06 V   C13B7.3 CCCGTAACACTGCTTAATATTGC TCCATATCAATTCATGAGGGAAG V-2C12
130 B07 V   C13B7.4 TTCAGCTTTATTTCGGAGATCAG ACATTTCCAAAAACTTGCTTCAA V-2C14
130 B08 V   C13B7.5 TAGTTGGATTCCCATTCTCTCAA CATTTGAGTTTCTGAACTGACCC V-2C16
130 B09 V   F56A4.a AAATTTCAATCGGCAAAACTGTA CCAGTTCCATATCTAGCCATCTG V-2C18
130 B10 V   F56A4.b TGGAGTCGAACTTACGTCAAAAT CTTCCCCATATTCCTAAGACACC V-2C20
130 B12 V   F56A4.d ATACAATTTTGGCGGGATTATCT TCGAGACGTTAGATTGCTTCTTC V-2C24
130 C01 V   F56A4.e CCGTGCCACAACTTTACTACTTC TGTAGACAACGGTTTTTAGGCAT V-2E02
130 C02 V   F56A4.f TCTTTGGCGGTATAGTGTGATCT CCTCACGGTTCTATTTCAGATTG V-2E04
130 C03 V   F56A4.g ACCCGCACTAGATAAATGTCTGA AATTTTCCAAAATAGCTCCCAAA V-2E06
130 C04 V   F56A4.h TATCCCTACTTCGTTTTCCCATT ACTTTACAAAGCTCTTGTCGCAC V-2E08
130 C06 V   F56A4.j GCTGGAAATCATGTTTCGTTTAG GGAAACATTTCTGGCCTCTTTAT V-2E12
130 C07 V   F56A4.k ATTCATTGGTTGCGTACAGTTTT CCTTTGTCTATTGTTTGTCTGGG V-2E14
130 C08 V   C01B4.1 TGTTGCTTGCACTCTAAATCGTA CACTGATCAACACAGTCCGATAA V-2E16
130 C09 V   C01B4.2 CAACAGAGATGCGTATTTTCCTC AAATAATTTCAGGGGGTCAAAAA V-2E18
130 C10 V   C01B4.3 TTGGCACTTTTGGAAAATTAGAA ATTTGCCGATAGAGATTTGAACA V-2E20
130 C11 V   C01B4.4 AATGATTACAGTAACCGGCTTCA CTTCGGACAGTAATGAGAAATGG V-2E22
130 D01 V   C01B4.6 GGATTTGGTGTTAGGATTTGACA AAAATTTCGACGCATAGAGATGA V-2G02
130 D03 V   C01B4.8 AACGAAACTCATTGGTTTGAAGA CAATAATTCCGACGATCAAGAAG V-2G06
130 D04 V   C01B4.9 CGTAAAAATCGTTAAAAGCAACG CAGCACAATCTGGGAACTTTATC V-2G08
130 D05 V   C01B4.10    TCCAATTACGGGACAGAGTAAGA TGTTTTTCGTATGTAGCAACACG V-2G10
130 D06 V   Y45G12C.1   ATCTGCAACTTCAAGAGACCATC AGTTTCATGAGCGAATTCAAAAA V-2G12
130 D08 V   Y45G12C.3   TATCCCTACTTCGTTTTCCCATT GGGAAGGATGAGTTGAATTCTTT V-2G16
130 D09 V   Y45G12C.4   CTCCTTGGGCACTAAAGCTAAAT CAACAATTCCAGTGAATGTCTGA V-2G18
130 D10 V   Y45G12C.5   AATGCTTATCCTAGGGATTCTCG CTCCAATATGTATGCCCCAACTA V-2G20
130 D12 V   Y45G12C.7   TGTTATGTTCCTGTTGGGTTTTT ACCTTTTTCTGGATTTTCTCTGG V-2G24
130 E02 V   Y45G12C.9   CTATTTCGCGTTATGTGTCATCA CAATTCTCCATCGCACTTTTATC V-2I04
130 E03 V   Y45G12C.10  TAGTTGGATTCCCATTCTCTCAA CATTTGAGTTTCTGAACTGACCC V-2I06
130 E04 V   Y45G12C.11  CATTGCAGTCAAATCATTCAAAA CGCCCCTGATTACAACATTATTA V-2I08
130 E06 V   Y45G12C.13  ATACAATTTTGGCGGGATTATCT GGAAGAGCCTCGTCTTAGTCTTC V-2I12
130 E07 V   Y45G12C.14  TGACGTCACATCCTAGATCATTG CAGCGGATCTACTTATTCCAGTG V-2I14
130 E08 V   Y45G12C.15  TTCCACGATATTTTCGAATAGGA TTTTAAAGCCAATTTCAGAACCA V-2I16
130 E09 V   C29G2.1 GAATAGTACACGACTGGAGTGCC GAAGACTTCGTTCAACATCAACC V-2I18
130 E10 V   C29G2.2 CCTTTGCATATCTTTTATCGTCG TTTAATTGACGGAATTCGAGAAA V-2I20
130 E12 V   C29G2.4 GACCGGTCATAACTTTGAATTTG GTTGATATATTTTTGGCCAGCAC V-2I24
130 F03 V   F53E10.1    ATCTCCAGATTCATCACCGC    GGTCTCACCACTGTGGGTCT    V-2K06
130 F04 V   F53E10.2    ATATTGGCAGGATGAGTTTTTGA TTTCCCTGCATCTGTATTCCTAA V-2K08
130 F05 V   F53E10.3    AAAAATGGTCAAATATCACACGG GGATCAAGACGAAAAGTCATCAG V-2K10
130 F08 V   F53E10.6    ATAATTCCCGGTATCGATTTGTT TAACATCCATTCCCGTGTTTTAG V-2K16
130 F09 V   W02H5.a TTTGAGTCGCCATAACTGTTTTT AATTGGAATCACTCGATTCTTCA V-2K18
130 F10 V   W02H5.b TCGTGGGGGAATTAATTATCTTT TTGTTCAGTTTTTCGAGGATGTT V-2K20
130 F11 V   W02H5.c ATAATAATAGTCGAGGCAAGCCC AAGCCAAAGAAAACAACAAAACA V-2K22
130 F12 V   W02H5.e GCTATCGGGATACCAAGAGACTT TTGTTCAGTTTTTCGAGGATGTT V-2K24
130 G01 V   W02H5.f GAGGAGGACTTGGATAGGCTTTA GTTGCTCTTCTGCAACTGAGACT V-2M02
130 G03 V   W02H5.h GAGGAGGACTTGGATAGGCTTTA GTTGCTCTTCTGCAACTGAGACT V-2M06
130 G04 V   W02H5.i ATGCAAATTCACATATTTTCGCT CCCATCCACTGAAATGAATTAAA V-2M08
130 G05 V   W02H5.j TTCATCCGTTAAAAAGCGTCTAA GTACCAGTGCGTTGATTTTTGTT V-2M10
130 G07 V   W02H5.m TCTTACATGAGAAATACGCAGCA TGAGCCGCTATAACTTTTTACGA V-2M14
130 G08 V   W02H5.n TTGAATTCCCTTCAAAATGCTTA AATTGGAATCACTCGATTCTTCA V-2M16
130 G09 V   W02G9.1 AATTTTGAACCTTTTAATGGGGA TTCTTAACCATGCGAAATCAGTT V-2M18
130 G10 V   W02G9.2 GACGTCACAGTTTCCTGGGT    GCGACTACACTTGGTTGGGT    V-2M20
130 G11 V   W02G9.3 CACAGAATCGTTATTTCTCGCTT GCATAACTAATCCAAAACGTTCG V-2M22
130 H02 V   Y45G12B.1   TTTTTCCAGGACATTAACGAAGA TAACATAGGTTCCCTCCTTCTCC V-2O04
130 H04 V   Y45G12B.3   TTACATGTGAACTTATGCAACCG ATTGTTGACTGGGGTTATGTGAC V-2O08
130 H05 V   C24B9.1 TGAACCTTCGCGATTTATCC    GAATGCGAGCCCAGAAATAA    V-2O10
130 H06 V   C24B9.2 CTGTCAGCATCATTTATGGATCA GCGTTGTTTTTCTGAAAGTGTTT V-2O12
130 H07 V   C24B9.3 TGAAAACGTTTGAGTTTACGGTT TAAGATTTTCTTCGGCATTTTGA V-2O14
130 H09 V   C24B9.5 GACAATCGAAGCGACCTGAT    ACGGGTGTAGGGAAGCTTTT    V-2O18
130 H11 V   C24B9.7 TGCACTACCCAAACAGTGGA    ACCTCATTTTGTGACTGGGC    V-2O22
130 H12 V   C24B9.8 ATGCCGTTTGAAAAAGTTGC    ATGCTGGGAATGACTTTTGC    V-2O24
131 A01 V   C24B9.9 TTTTTCCGAATTTTGTTTTCTGA TGACATTTTGAAGCAAATCAATG V-2B01
131 A02 V   C24B9.10    GGGTCAGATTTGTTGTCGCT    CGCAATTAGGCTCGAAAAAC    V-2B03
131 A03 V   C24B9.11    TCGAGAACCCAAAATTGCTC    GGTAGGGTTTCCATGGGAGT    V-2B05
131 A04 V   C24B9.12    GGAGAGATAGCGTGAACTGAAAA TAAAAACTTCCAGAAACAACCGA V-2B07
131 A05 V   C24B9.13    TTTCAAAACAGTTAGTGCCCAAT CTAGATGCCTTATTTGTGGCTTG V-2B09
131 A07 V   R05D8.b CGCACCATTCTGAATTAAGGTAG CATTTTCAACACTTGAACGAACA V-2B13
131 A08 V   R05D8.c AGACCAGTGTAGATCCTCCATCA TTTCCGTTTCCTTTCGATATTTT V-2B15
131 A09 V   R05D8.d AGTAGGCTACCTTGTACGGAAGG AATCGGTAAATTGGTAAATTGGG V-2B17
131 A10 V   R05D8.e AAAGCCCTATTCAGGCATAATGT CAATGTCATCACAAAACCAGAGA V-2B19
131 A11 V   R05D8.f ACAACTAGATTATCGGGCACAGA TATAATGCTGAAATTGATGCGTG V-2B21
131 B02 V   R05D8.i ACGCTTAGCTTGTGAACACTTTC GCGTGAGTAAGTAGCAGGTCAGT V-2D03
131 B03 V   R05D8.j GCTATTCAAGCCAAAAACAGACA TCGAAAAATGAAATGGGAATTTA V-2D05
131 B04 V   R05D8.k TTTTGCCATACGGCTTAGTTTTA ACAATAATTGCTCCAGTCCAAGA V-2D07
131 B06 V   R05D8.m TTCTTCACATTGCTGACTCTCAA ACATATCCAGAAGACAACGGAGA V-2D11
131 B07 V   R05D8.n CTATTTGAGTGGAAGATCGGTTG ATGATAAGGAGTGCAATGAAGGA V-2D13
131 B08 V   R05D8.o ACCGAGTAGGTTCCAGAGTCTTC CATGAGCAAATAGGAGACCAGTT V-2D15
131 B10 V   R05D8.q CTTAAAACTCACTGCTTGGCAAT GGTCGGCTTATTATCGAGAAAGT V-2D19
131 B11 V   F54E2.1 ATTTGGCTCTTAACACCCCC    GAAGGCAGTTGATCGTCACA    V-2D21
131 B12 V   F54E2.2 TTACACACACTTAACCCTCCTGG TGCGAGAAATGAACTAGGAGAAG V-2D23
131 C01 V   F54E2.3 CATTGCTTGCCTTGACTGAA    GGTGAAGCTACCACCGACAT    V-2F01
131 C02 V   F54E2.4 AAATATCACCCCCTCCCAAC    AGGTTCAGGCTGCTGACAGT    V-2F03
131 C03 V   F54E2.5 AAAAACAAAAATCGATTGCTTCA TCTACAGATACGGCTTTCAGCTC V-2F05
131 C05 V   T03D3.1 CTTCCCTTTACCCCGAACAT    CGATCTCGCATTTGAAAGGT    V-2F09
131 C07 V   T03D3.3 CGGTATATAAGCCGCCTGAA    ACCGCAAGTATTGGTTCGAC    V-2F13
131 C08 V   T03D3.4 GACAACCGAGGTTTAGCAGC    TAATTGCAAAAGGAGGTGGG    V-2F15
131 C10 V   T03D3.6 TGAACAGTTTCCTAGCGCCT    AATACGCCCACTACCTGTGC    V-2F19
131 C11 V   T03D3.7 GATAGCGATAGGGTCCACGA    CCGAACACGACTGAAACGTA    V-2F21
131 C12 V   T03D3.8 CGAAGGAAAACACTCCCAAA    ATCATTTTGCCTTGTCCTGG    V-2F23
131 D01 V   T03D3.9 AACTGACGGCGTTGAGAACT    CCACAATGATTGACGACTGG    V-2H01
131 D02 V   T03D3.10    TGATGTTTTTGGACTCGCTG    CTCGTCACACTGTCTTGGGA    V-2H03
131 D03 V   T03D3.11    GCACAGGCTCTTGCAATACA    ACCAAGAACATTTTGTGCCC    V-2H05
131 D04 V   T03D3.12    AAGCGTTTTCCTTCAGTGGA    TGACATCAGCTTTCTGCCAC    V-2H07
131 D05 V   T03D3.13    ATCTGTGCTCTCCTTTGCGT    TGACAAATGGAAAGTGCTCG    V-2H09
131 D06 V   T03D3.14    GAATTTCGTTGATCCGTGCT    GAAATCCGCAAACTTCGGTA    V-2H11
131 D07 V   Y45G12A.1   TAGGTCTCATATGCAAGTCCGAT CGTATAGTTGGGTCTGGTAGCTG V-2H13
131 D08 V   F37B4.1 ACGTGACAAACTCCGTCAATAAT ACACTTTTTAGCTTTTGATCGCA V-2H15
131 D09 V   F37B4.2 CAAACCACTATCATGTGCCG    GCATGGTAGCCATTGATGTG    V-2H17
131 D10 V   F37B4.3 AGTGTTTGGCGGGATTATTTTAT GTAGGAGAATTTCTTTGCGGTTT V-2H19
131 D11 V   F37B4.4 CGAATTAATTGTGCACTTTGTCA TTTGCACGTATGAAGATCAGAGA V-2H21
131 E01 V   F37B4.6 CCACCGAAATCATAAAAGTTGAC ATTCCGCTTGACTAACCCTACTC V-2J01
131 E02 V   F37B4.7 CCAAATGCAACGACAAGATG    TATCAGTTTGGTCGCCATGA    V-2J03
131 E03 V   F37B4.8 GTTTGGGATACCTGCTTGGA    CTTCGTGGCCTATCATCCAT    V-2J05
131 E04 V   F37B4.9 CCGCATTTATTCCGAGCTAA    TCCAAGCAGGTATCCCAAAC    V-2J07
131 E05 V   F37B4.10    ATACCACATTTCTGCGACCC    CTGCGTATTCAGGAGCACAA    V-2J09
131 E06 V   F37B4.11    CAAAGAAGGCATGGGAAGAA    GAAGCCAAGCTTCCCTTTTT    V-2J11
131 E07 V   F37B4.12    GCGAATTCTGAACATGATTTTTC TCCCAAGAAGTTCTGCATACAAT V-2J13
131 E08 V   C31B8.1 CGCAACTTTTCTATCAGATGCTT GAATAGGTGCAGACGTGAAAACT V-2J15
131 E09 V   C31B8.2 GCACATGATGATGCTCTGCT    CCCGTCGAGAAAAGTGTGAT    V-2J17
131 E10 V   C31B8.3 ACCCCGAAAAAGTTGGAATC    ATATGGCGTGTGAACCATGA    V-2J19
131 F01 V   C31B8.6 ATGAATCGATTGGCGGATAG    AGCCAAACTTGAAGAGCCAA    V-2L01
131 F02 V   C31B8.7 CAGAAGGCAATCCTGAAAGC    CGACCAATGCTCAACAGAAA    V-2L03
131 F03 V   C31B8.8 TGGTTCGTCTTGTGGTGGTA    GCCGAGCAAGTCTTCAAATC    V-2L05
131 F04 V   C31B8.9 AATCCAAACGCCACGTAGTC    TTTGAGAGATCAGGTTGGGG    V-2L07
131 F05 V   C31B8.10    GAATACACAACACGATGGCG    TTGTGTTCACTGAAAAGCCG    V-2L09
131 F06 V   C31B8.11    CAACCAGAATAGTCGACGCA    AGGGCTCAAACCTACAGCAA    V-2L11
131 F07 V   C31B8.12    TGACATTGATCTGACGGGAA    TCCCAGATTCGAAAAATTGG    V-2L13
131 F08 V   C31B8.13    GCCAGGAACATATTCTACCCCTA AGACCAACTATTTCGCTAGTCCC V-2L15
131 F09 V   H27D07.1    TTCCGATCATAATGCACCAA    TTGCAGTTTGCCGATATTGA    V-2L17
131 F10 V   H27D07.2    CGGCATATAATATTGGTTGTCGT TCGTCATTACGGCTATACGTTTT V-2L19
131 F11 V   H27D07.3    CAAACAATCCCCGTTCATCT    TTGATTCTCATCCGAAAGCC    V-2L21
131 F12 V   H27D07.4    CAGCAAACCAAATATAAAAAGCG GAGCATGTCTAGTCTCCGTGAGT V-2L23
131 G01 V   H27D07.5    CCACGCCTACCTTCCATAAA    CGGATTGCACTGATCTTGAA    V-2N01
131 G02 V   H05B21.2    AATTGCACCCAAGACCAAAG    CAGCTACTATGCTAGCCCCG    V-2N03
131 G03 V   H05B21.3    TAGATTCATACACGTGATGCCAG GACTAGCCAAAATCAATGTCCAC V-2N05
131 G04 V   H05B21.4    GTGAATCCGGGAGTTTCTGA    CCCAAACCGTGAAAAATGTC    V-2N07
131 G05 V   C44C3.1 GTTTTCGGAAATCTACGGCA    TCCACATGACAGAACGGAAA    V-2N09
131 G06 V   C44C3.2 ATGTTAGACGACATGGTGTGATG TAACAAACTGACCATATACCGGG V-2N11
131 G07 V   C44C3.3 AACTATGCAGTGGGTAGCTGTGT TGGCTATACCAAATCGAAAGAAA V-2N13
131 G09 V   C44C3.5 TTGAGTTGACTTCAGCCCCT    TTGTGAAGGCCAACATGGTA    V-2N17
131 G10 V   C44C3.6 AAAATGAACCCAACGTGAGC    TTCCCCAAAAGCTTGCTCTA    V-2N19
131 G11 V   C44C3.7 AGAAGCTGGGTCACAAGGAA    GAATTTCAAAATCGCGTGGT    V-2N21
131 G12 V   K12D9.1 GCCCACCCCTTAATTGAACT    TAGAAGCCGGACGCTAAAAA    V-2N23
131 H02 V   K12D9.3 GCATGAATTCTGTGAAAACAACA AATTTCAAAAATCGACAGCAAAA V-2P03
131 H05 V   K12D9.6 CAATCAGGAAAACCAACAACAAT AAAGTTTTCTTCGTGAGCTTGTG V-2P09
131 H07 V   K12D9.8 CAACCCGCTGGTCTTACAAT    AGGTACACATTTGGAACGGC    V-2P13
131 H09 V   K12D9.10    AAAATGTGACGATCGGGAAG    CGACAATTTTGGCAGGAAAT    V-2P17
131 H11 V   K12D9.12    GTTCCGAACACGAGGTTGTT    GAAACATTGAAATCCGCCAC    V-2P21
131 H12 V   F59D6.1 CGCTGATAAGGCTAATCTTGCTA TCAGGTAATTCGGACAAGAGGTA V-2P23
132 A01 V   F59D6.2 TTTGCAAACAAAAACCGTGA    AGCACGGGAGAGTGTATGCT    V-2B02
132 A02 V   F59D6.3 GGCAATTTTCTTCGTGCAAT    CCGATTGAAAATCCATCCAC    V-2B04
132 A03 V   F59D6.4 TACCACAGTCTCCACCGACA    CTATACGGTGGCCTGCAAAT    V-2B06
132 A04 V   F59D6.5 ATTGTCAAAAACCCACAGGC    TTCTAATTGCGCCTTTTTGG    V-2B08
132 A05 V   F59D6.6 ACAACCGCCAGACTTACCAC    GCAAATGTGCAAGAATCCAA    V-2B10
132 A06 V   F59D6.7 TTAAATTCGAAAACTTTGAAGCG TTGAGTGATGCTGAAATGAGAGA V-2B12
132 A07 V   C50H11.1    CTCACGGACTTTACTTTTCCCTT TTTCCTGGGGCTAGAAAACTAAC V-2B14
132 A08 V   C50H11.2    TCGCTTAGCGTAAACTCGGT    TCAGTTTGTGCCAAGTGCTC    V-2B16
132 A09 V   C50H11.3    TGTAACCAAACTTGGATATTCGG TTTGGTATTTTGACGAAAAATCG V-2B18
132 A10 V   C50H11.4    TCAATCTTCGAGTTCCGGTC    GCCCTGAAAAGGTGATGAAA    V-2B20
132 A11 V   C50H11.5    CTTCCTCGCAATTTTGAAGC    AACTATCCCGGCATTCATTG    V-2B22
132 A12 V   C50H11.6    CCATGCTTCCTTGCAATTTT    ATTACACATCCACCGGCATT    V-2B24
132 B02 V   C50H11.8    CAGTTCAAACTACATAGGGACGG TCAGGTAGGACTAGTGGCATGTT V-2D04
132 B03 V   C50H11.9    CGCCCACAAGCGTATAAAAT    TCTTCCAAGTGCCATTCACA    V-2D06
132 B05 V   C50H11.11   CACAATGTGGCAAGTCCAAC    GGCAATTCCGTTTTCAGTGT    V-2D10
132 B06 V   C50H11.12   GGAGTGCACAATTCAAAGCA    GTTAACCTAACCGCATCCCA    V-2D12
132 B08 V   C50H11.14   ACGACCACTCCTGCTACGTT    ATGAGCCAAAACTCCGAGAA    V-2D16
132 B11 V   C50H11.17   TAAATTAAACCCGGGGACTAGAA GAGAAAGCTGAGATAAATGCGAA V-2D22
132 B12 V   Y73C8C.1    TTTATTCCGTTACCCTTCCCTTA ACCGATGACACAAGTCTGAGTTT V-2D24
132 C01 V   Y73C8C.2    TGTAGTCTGCCTGACTTTTGTGA AGTCTGAGTCGTAGCCATAGACG V-2F02
132 C03 V   Y73C8C.4    AATTAAATTGCCTTCCGTTGAAT AATTGTTTTGAAAAGCGAAATGA V-2F06
132 C04 V   Y73C8C.5    ATTTGTGTTCTCCTCAAACTGGA TCCCTCTTCATCTTCATCACAAT V-2F08
132 C05 V   Y73C8C.6    CTTTATGATTGCACATTCTGGGT CTAGAAGTAACTGCAAGGCCGTA V-2F10
132 C06 V   Y73C8C.7    ATGGTACTTTCTCTTGCAATCCA GAATTCATTCATAGCCAACTTGC V-2F12
132 C07 V   Y73C8C.8    TCTGTGAATCTTTGAGGAATGGT ACAAGAAGTGGGAAGCCTTTTAC V-2F14
132 C08 V   Y73C8C.9    GAATGAACGGTTGTTGAATGAAT GATCCATTTCAGAGATGAAGCTG V-2F16
132 C10 V   F02C9.1 CTCACCTTTCAAAATCATCGTTC TAAAATTTTTCATGCTCTGTGCC V-2F20
132 C11 V   F02C9.2 GGTGTGCCTACGTAATGCCT    TTTTTCCGTTATCAGTCCCG    V-2F22
132 C12 V   F02C9.3 TCCTGATGAAGTTGCACTCG    CATGACCGCTTGTAGCTGAA    V-2F24
132 D01 V   F02C9.4 AATTGCAGTACTGAAGGTTCCAA TGATGCTTCTTCTCCAATTTCTC V-2H02
132 D02 V   C36C5.1 CTTTTTAGCATTTCCGATCAATG TTTTTAAACCGAGATTCCTGTGA V-2H04
132 D04 V   C36C5.3 CATAATTTTCCGCATTTTGTAGC GACACAAGAACCGTTAGAAATCG V-2H08
132 D06 V   C36C5.5 CAAGATCAAACCACTTGGAGTTC CGGATGTCAGAAGCTGTTACTTT V-2H12
132 D07 V   C36C5.6 CACATTCCACCAGCGATATG    CTGCCAAGAGATGGAAAAGC    V-2H14
132 D10 V   C36C5.9 TTTCACATCCATTTCAACAACTG AAGAATTTGACGCTACGACTCAC V-2H20
132 D12 V   C36C5.11    CCTTTTTCAGCCGAACTTTG    TCTTCGTCCATATTCCTCCG    V-2H24
132 E01 V   C36C5.12    ATAAAATACCTTGATTGGCGGTT TTAGACAAAATCCCTCACTGGAA V-2J02
132 E02 V   C36C5.13    GCCGCGTTATTGATTGACTT    TGGAATGTCACTCTCCCTCC    V-2J04
132 E05 V   Y73C8B.a    CAGTTGTCATTCTAGAAATCGGG TTGCCAAATTTGCCTACTAAAAA V-2J10
132 E06 V   Y73C8B.b    CTTTGCTAGAAGCCAACAACACT TAGAGACGGTAATCTCCACGGTA V-2J12
132 E07 V   Y73C8B.c    TTGGTTTTAGCATTGGAGTCATT AGGTGTCGTGACAGTTCCTAAAA V-2J14
132 E08 V   Y73C8B.d    CTTTGCTAGAAGCCAACAACACT TTCAAGATTTGGATCAGCAATTT V-2J16
132 E09 V   K08D9.1 CAAATCTTCAAAGCTCTCGTTGT GAAACGGAAACATTCAAAGTCAG V-2J18
132 E10 V   K08D9.2 ATCAATACAAATGCCACGCA    GCATAAGGCAGGCGTAAGTC    V-2J20
132 F01 V   K08D9.5 AGGTGATTTACAATTTTGCCCTT AAGTTCAACAACAAAAACCCTGA V-2L02
132 F02 V   K08D9.6 GTGCGAGACTCGAGCTTACC    AAACCTGCAGAAACTTCCGA    V-2L04
132 F03 V   Y73C8A.1    ATTTCCTGTTCATGTTGTTGGTC TCTTCTCATCTGTTTTGACAGCA V-2L06
132 F04 V   T28A11.1    CCGTTATCTCGGCATTAGGA    AAACACGATTCGAGGCATTC    V-2L08
132 F05 V   T28A11.2    TGGAAATGTCTTGTCTCTTGGTT TTTAAGCTTTTGTTTCCTTGCAG V-2L10
132 F06 V   T28A11.3    TTCAGTCTTACGCTTTCTTGGAC AAATTCATACAAGCTCATTCGGA V-2L12
132 F07 V   T28A11.4    ACAGCCAAATGATAAAAAGCGTA AACAACATTCTCAAGCCACAAAT V-2L14
132 F08 V   T28A11.5    AATTGGATTCAAATCTTGCTGAA TTCGGTTGTATTTTTGAGCATCT V-2L16
132 F09 V   T28A11.6    AGAGTTGCACGACTACTTCCTTG AGGCAAGTGTTGAAATATGGAGA V-2L18
132 F10 V   T28A11.7    ATTCCAGCTCTTTCGAAGTCTTT ATGATTCAACTGCACTTCCAACT V-2L20
132 F11 V   T28A11.8    TTCAATTATGGGATTTTCCCTCT CAGTGCTATGATGAGACACTTCG V-2L22
132 F12 V   T28A11.9    TTTTTGACCCCTTTGGTGAG    ATCGATGAATGGGAAAGCAG    V-2L24
132 G01 V   T28A11.10   GCTTCCTGGTGAACCCAATA    TGACAACGTTGCTGATAGGC    V-2N02
132 G02 V   T28A11.11   CTTACCAAGTTTGCAGACAGCTT TTTATTGTTTCCCATTTCCACTG V-2N04
132 G03 V   T28A11.12   AGCAATTCATGGTACTGGGG    AAAATGTCCGCAGGCTATTG    V-2N06
132 G04 V   T28A11.13   ACCGCTAGTACTGTGGGATTACA CCAAATCACATTTCAAAAACCAT V-2N08
132 G05 V   T28A11.14   TTCACCACAGTGTTCACAAAATC TCCGTCGACTATTTGGAAAGTAA V-2N10
132 G06 V   T28A11.15   GTTTGTCTAGGCACTTTCTTGGA TTTCAGTTGCAAAGATTCCATTT V-2N12
132 G07 V   T28A11.16   CATCCCATTCCATGTTTACAGTT ATTGACCTTGAAATCAGACCAGA V-2N14
132 G08 V   T28A11.17   CTACCTGCTCTTCATTCGCC    TCGAGGTCCTCAATCAGCTT    V-2N16
132 G09 V   T28A11.18   CTTGGACTTCAAAACGAGAATTG ACAGTTGACACATTATCATCCCC V-2N18
132 G11 V   T28A11.20   CTACCACTGCATCAGTCTCTCCT TTTGAACCCTTGTGATGACTTCT V-2N22
132 G12 V   T28A11.21   ACGCGGAAACAATCAATAGC    TATTGTGAACTTCCCCGTCC    V-2N24
132 H01 V   F35F10.1    AGTTCTTTGAAGCTATTTTGGGG TGGGAATTTTTAGGAAGGAATGT V-2P02
132 H02 V   F35F10.2    TTGAAGAAGGCCCTCTGATG    TTGCAATACTTGTTCGAGCG    V-2P04
132 H03 V   F35F10.3    TCAGATAATGCTGCAGAAAGACA ACTGTGTGCAACGTTACTTTCAA V-2P06
132 H05 V   F35F10.5    CTACCGAGCTGTTTCAGTGACTT CAAAACAAAAATTTTCCGTTCAA V-2P10
132 H07 V   F35F10.7    TCTCGTCAAAGTCAAGAGTCTCC TCTCGAATTTCAAAAACCAGGTA V-2P14
132 H10 V   F35F10.10   ACTCAATCGTAAATCCTTCGTCA AAATGGCGGGAGTAGATGATATT V-2P20
132 H11 V   F35F10.11   GCGGAGCAGTTGGGTTATAG    GGCGTAAAGACAAAGCCAAG    V-2P22
133 A01 V   F35F10.13   AAGATTGGTGATTTGCTGAAAAA GTTGCCACAGTGTTCAATATCAA V-3A01
133 A02 V   F35F10.14   TTCCGACAGGCTACTCAAAAATA GTGTAATCTCGAAGTTGATTCGG V-3A03
133 A03 V   C17B7.1 CAACCGACTCCTCAATCACA    TTTAATCCGGGAATTAGGGG    V-3A05
133 A04 V   C17B7.2 AAGAATAATAAAAGGTCGCCGAG TGGATCTCCTTTAGTGCTGTCAT V-3A07
133 A05 V   C17B7.3 CGCAGTTGCTAAGAAGAAGGTTA ACCACTGTTTCCTGAACGTTTTA V-3A09
133 A06 V   C17B7.4 ATAAGATTGGCTTCGTCAAACAA TTCGGTTGTATTTTTGAGCATCT V-3A11
133 A07 V   C17B7.5 GTGGTGATCAAAATGGAGGG    AATCCTCCGCTAATCGGAAT    V-3A13
133 A08 V   C17B7.6 CATACGATTTGGACTTTTTGAGC TTTATGGCATGAGACAAGGAAGT V-3A15
133 A09 V   C17B7.7 CCCGGAGTCTTCTGATTCAA    CACTGGATCGTCATGATTGG    V-3A17
133 A10 V   C17B7.8 CCGTTCAATCTCAGTCGGAT    TCGAGGAGATTTGGAGCAGT    V-3A19
133 A11 V   C17B7.9 AGCAGTGATTTTCTATCGCTCTG ACATGTTTATGGTGAATCAAGGG V-3A21
133 B02 V   C17B7.12    GGTCGCTTCCAAATAACTACCTT CACACATCATTTTTGAGCTACCA V-3C03
133 B05 V   C04E12.3    GCTTTGGAAGGATATTAGCGTTT GTTATTCAAATCAACCAACTCGC V-3C09
133 B07 V   C04E12.5    CTGCCTATGATCGCCTGTATATC CGAGTTCCCAGAAAACTTCCTAT V-3C13
133 B09 V   C04E12.7    AATGCTTTGGCCTTGACATC    TGGAAAATTATGGAGCAGCC    V-3C17
133 B10 V   C04E12.8    ACCTACCCTTCCACGGTTCT    TTTCTTTGCTTTTTGGTGCC    V-3C19
133 B11 V   C04E12.9    AGTTGGCAGAAAATCACATAGGA TGAAAGGTTGGTTGAGTTGAAGT V-3C21
133 B12 V   C04E12.10   CCCAAGCACATTCTTCCATT    GGCAGTTTTAATGCTAGCGG    V-3C23
133 C02 V   C04E12.12   ACACTGGCAAATCGTTGAATACT TATTCGATCAACCTGACGAAGTT V-3E03
133 C03 V   T20D4.1 CAAGCACAATTCGATGTTTCATA TGTAGCTGCAGAATACCAACAGA V-3E05
133 C04 V   T20D4.2 ATGCCGAATAGTGGAGTTGG    ATTCTTTGCTCATTGCCAGG    V-3E07
133 C05 V   T20D4.3 GCCTCTGGCACTTCTCAAAC    CACTGATGCCCAATGTTCAC    V-3E09
133 C07 V   T20D4.5 GACGATGGCTCCCAGTTTAG    CGGGATACCAGTGCAATTCT    V-3E13
133 C08 V   T20D4.6 CGTGGCCATTCTCCTACACT    GAGGTGGAGCAGTTGGGTTA    V-3E15
133 C09 V   T20D4.7 ACCTGTCAAACAAGGAACAAAAA TAAACAAAAATCCTTCGCAAAAA V-3E17
133 C10 V   T20D4.8 GAATACGACCACTGCGGATT    GCTCTTCACTTGCCGATTTC    V-3E19
133 C11 V   T20D4.9 TTAGGAGCCATTGATACCGC    CCCAGTGGATTGCAAAACTT    V-3E21
133 C12 V   T20D4.10    ATGCTTGGGAACAGATGGAG    CCAACCATGTTTTTGCACAG    V-3E23
133 D01 V   T20D4.11    CCAGGATCCCTTCTTACTCACTT AAGGATTCAAATGTCCGCTAAAT V-3G01
133 D02 V   T20D4.12    ACATGTTTATGGTGAATCAAGGG AATGCTTCTTTCTGATTGTGAGC V-3G03
133 D03 V   T20D4.13    TGAGTCCTGAGTTGGTTGGTTAT TTGATGAATGCATAATACGCAAG V-3G05
133 D06 V   T20D4.18    AGTTGTATCAATTTTCTGCCCAA TCTAAACTTGGCGGTTGATTTTA V-3G11
133 D07 V   T20D4.19    GCAGTTCATTATGATGTTGCTGA CCTTTTATGCAACAAGAGACCAC V-3G13
133 D08 V   T20C4.1 AGATCTCAAATGGGCAAGTACAA CGGTAGCTCGGAATTAGGTAGAT V-3G15
133 D10 V   F27E11.2    ATCGGACACTTTGCACTTCC    GGAAAGAACGCGTAACCAAA    V-3G19
133 D11 V   F27E11.3    GATAGTTTGCTTTGGCGAGC    GTGCATGGAACTTTGTGTGG    V-3G21
133 E01 V   C02A12.2    TCTCCCTTCCAAAAGGTGTG    CCATTTGTGGTCGTTATCCC    V-3I01
133 E02 V   C02A12.3    CCGAGACCCTTTGATTTTCA    TCACGGGCTCGTTTATTTTC    V-3I03
133 E03 V   C02A12.4    CTATCACGGGATTGACCACC    TTGCAGTACTCTGCCATTCG    V-3I05
133 E04 V   C02A12.5    CCGAAGAAAGATGGGACAAA    TTGCCCCACTAGGAAAATTG    V-3I07
133 E05 V   C02A12.6    ATCATTGGGCGAAACTTGAC    TGTCGGCTGCTCCTTAATTT    V-3I09
133 E06 V   C02A12.7    GGTCAGAAATCCAAGAACAACAG ACTGCAGTATGCGTTCCATTATT V-3I11
133 E08 V   C07G3.3 GGCAGTTTTCGCTGTTCATT    AACGGGCAAATAACGAGTTG    V-3I15
133 E09 V   C07G3.4 TTCGGCGGTTTTCTCTATTG    GGATAGTTGCAGGGACTGGA    V-3I17
133 E11 V   C07G3.6 TTAGGTCCCGGAGGACTTTT    CTTCTTCACGCAACCACAGA    V-3I21
133 E12 V   C07G3.7 CTGGGAACGGCAGGTTACTA    TCGTTCATAAAACGGTTCCC    V-3I23
133 F01 V   C07G3.8 TACCCTGGTTTCGTGAGAATCTA ACTTTGTTCGTGCTTTGATCATT V-3K01
133 F02 V   C07G3.9 AACAGTCTCTCAAACTTGAACGC TTCCTTCCCTACTCAATGTCAAA V-3K03
133 F03 V   T24A6.1 CTGGAGGAGAGAAAGGAGAGAAA ATCGAAAATGACAAAGTTCGTGT V-3K05
133 F04 V   T24A6.2 GGTATTCTTGTTTGCAATGCTTC CCGAAAAATCAAAGAATTGATGA V-3K07
133 F05 V   T24A6.3 TTAAGGGTGAACACCTGGTTCTA GAAGCATTGCAAACAAGAATACC V-3K09
133 F06 V   T24A6.4 ACGCCAAAATGGCTTGTAAC    ATTTTTCGGGTACTTTCGGG    V-3K11
133 F07 V   T24A6.5 CTGTCTACCAAATCAGACAACCC CGCAAAACTTAGTGTAGGGAGAA V-3K13
133 F09 V   T24A6.7 ACCATGCCAAACACCATAGTAAC GTCAGCAGATGATTGTGTGTGAT V-3K17
133 F10 V   T24A6.8 TTTGAGTTATCGTCCCCTCG    GACGTGCTCAGTCACTTGGA    V-3K19
133 F11 V   T24A6.9 CTTAACCATGCGAAATCCGT    CCAGCACATGGCTATCATTG    V-3K21
133 F12 V   T24A6.10    CTGAAGACGCAAACCAAACA    CGACGATGCGATCAGAAGTA    V-3K23
133 G01 V   T24A6.11    AGCGAGAGGAGATCCACAAA    GTTGCAAAGCCTGTCGATTT    V-3M01
133 G02 V   T24A6.12    GGTGGCGCTACAATATTTACATC AAAGGTATCTGCTGAACGGAAAT V-3M03
133 G03 V   T24A6.13    AAACAACAAGAACGTCAGTCGAT AACTTGCTGATAGCTGAGAAACG V-3M05
133 G04 V   T24A6.14    AAAAACCAAATGATCGCCAG    TTCTGCTCGGAGATGGAAGT    V-3M07
133 G05 V   T24A6.15    AGCAATTACAGGCTTCACATAGC GAGTGGTTTTTAACAATTTCCCC V-3M09
133 G06 V   T24A6.16    CTGTGGGCGACCTAGTTTGT    TCATCAGCTATGCACCAAGC    V-3M11
133 G08 V   T24A6.18    GACTACGAAGCCCTCACAGC    TGTGAACAAGAACATCCCCA    V-3M15
133 G09 V   F40C5.a TCCAGCTTCTGATCTCTCTGAAC TGCTATAAACTAAATGGGACGGA V-3M17
133 G10 V   F40C5.b TTGAAAATTCGGACAGAAAGAGA GAAGATGACCTTCAAACGATCAC V-3M19
133 G11 V   F40C5.c GAACATCACTCGTGTCCTCTACC TTACGTGGAGCTCTTGAGAAGAT V-3M21
133 G12 V   F40C5.d TCTAGACATTGAGGAGCTTCAGG TCGATTATTGTGCATCTTGATTG V-3M23
133 H01 V   F40C5.e CTTACGCGTTATCAGTTTATCGG AACGACAGATAGTAGACCCGCTT V-3O01
133 H02 V   F40C5.f ATCGAAAATGACAAAGTTCGTGT CTTAGAACATCATGCAATCCTCC V-3O03
133 H03 V   F40C5.g ACAAAGTTCGTGTCATTACGGAT AAATCATCAAACCAAACACCAAC V-3O05
133 H04 V   F40C5.h GAACATCACTCGTGTCCTCTACC TGCTATAAACTAAATGGGACGGA V-3O07
133 H05 V   T22F3.2 GAATGACAGTAAATGAGGGTTGG AAATGTGCATTAGCAGGATCTGT V-3O09
133 H06 V   T22F3.3 TTCCAGCTTCCGTGACTTCT    GCTCTCGAACTGGTCGATTC    V-3O11
133 H07 V   T22F3.4 CGCAACGTAAAATTATTGATTCC TTTATCGGCATTTTTGAACTTGT V-3O13
133 H10 V   T22F3.7 TCCGGGACACTCGTTTAGTC    ATTGGTACAGGTAGGCGCAC    V-3O19
133 H11 V   T22F3.8 CAATCACCATACCACCACCA    TGCTTCAACGCAATAGCATC    V-3O21
134 A01 V   T22F3.11    ATAGTCATGGTAAACGCGGC    ACGGCTTATCTGCATTTTGG    V-3A02
134 A02 V   F59B1.1 CGATGTGCTTCGTGATGTTC    TAGTAAAGTGCCGGAAACCG    V-3A04
134 A04 V   F59B1.3 TGCTCCAGGAACTGGAATTT    TCCCCTCAACTTGGTGGTAG    V-3A08
134 A06 V   F59B1.5 GTGCGTGCAATGTGTATTTTCTA ATTCCTATTGGGAACGGTAAGAA V-3A12
134 A07 V   F59B1.6 CTTACTAATTGTGTCCACCTCGG ATGCAATAATTTCGAGAAAACGA V-3A14
134 A08 V   F59B1.7 CATCATCATCACAATCACGTTTT ATCGGTAACCTCTCGGTATTCAT V-3A16
134 A09 V   F59B1.8 ATGGACAAACGGAATAAGCG    CTTCTCCTCTTGCGTGATCC    V-3A18
134 A10 V   F59B1.9 AAAATTCGATTGCCGAACAC    TGGTCCCCGTAAACTTCTTG    V-3A20
134 A11 V   Y39H10B.1   TCTGAATGGTCCTGAAACAAACT GAAACAACTGACACCATGAGACA V-3A22
134 B01 V   W08A12.2    CCGCCCATGTATTGATAAGATAA CCCAAAGTCTCAAACATGAAAAC V-3C02
134 B02 V   W08A12.3    TCCTTGTGGGAAAAAGTGACTAA TTATCTTATCAATACATGGGCGG V-3C04
134 B03 V   W08A12.4    TGATCGAGCTCTCTCAGCAA    AGAGGAAGCGTTTCGACAAA    V-3C06
134 B05 V   T27C4.2 AAAATGCTCACCCTAATCTGTGA CATGGAAAAGCGAAAATAAGTTG V-3C10
134 B06 V   T27C4.3 TATCTGAAAGCGGTTGAAACAAT GTCTCCAATCAAAGAACGACAAC V-3C12
134 B07 V   T27C4.4 TCTCATTGAAATCCTTGCCC    CTGATGACGTGGCAGAGAAA    V-3C14
134 B08 V   R08E5.1 TTTTGTGCACTTGAAGCAGACTA GAACCTAGCAGTAAGCAATGTGG V-3C16
134 B09 V   R08E5.2 AAATATTTCTTCGCAATTCCCAT CTCCCTTCCTATGTTGTTGTGAG V-3C18
134 B10 V   R08E5.3 ATTCCTACAGTAGCCACAATCCA GTAGGTCTTGTGCGGACTTAAAA V-3C20
134 B11 V   R08E5.4 TCCCACCACGATTATATTTTCAC GGAAATCAATAAAATTGCACCAA V-3C22
134 B12 V   R08F11.1    GGAGCAGAATTGCATTGGAT    GTCTCAGATCTCGGCACTCC    V-3C24
134 C01 V   R08F11.2    GTGCTTCTAGGCCAATTTTTCTT CTCATACTCCTGAAGAATGGTCG V-3E02
134 C03 V   R08F11.4    CTCTTCCTTCCCCACATTGA    TTTGTAGGTACGTCCGGGAG    V-3E06
134 C04 V   R08F11.5    GGTTTTAACCCGGAGAGAGC    CAATAGAGCTCGCCATGACA    V-3E08
134 C05 V   R08F11.6    GTGCGGCGATCAATTATTTT    TTTTTGGGTGAAGATCAGGC    V-3E10
134 C06 V   R08F11.7    CGTCTTCATCAAGGAGCACA    GGATCGCATCGATTTGAGTT    V-3E12
134 C07 V   H10D18.a    TTTTCACGTGGAGAAATGAGAAT AACAAAAAGCGCTCACTGTAGAC V-3E14
134 C09 V   H10D18.c    TACCAAAGGAGGACATTTTGCTA GAGATTTCATCCACTGAACTTGG V-3E18
134 C11 V   H10D18.e    TTTAAAACTCGTTTTGATTGCGT ACTCCTTTTCCCATGAGTTTGAT V-3E22
134 C12 V   H10D18.f    ATCAAACTCATGGGAAAAGGAGT AAAATTATGGGCAAAGTCCAGAT V-3E24
134 D01 V   H10D18.g    AATATCAAAAATCGCAAAAAGCA CCCTTCAAATACAATTCAAGCAC V-3G02
134 D02 V   F47C10.1    ACAGGTGTTGCACATCCTCA    GCCAAGACGCCAAACATTAT    V-3G04
134 D03 V   F47C10.2    TAGTCAAGTTTCTGTGCCCATTT GATGGTCTGTCAGGCTTGATTAC V-3G06
134 D04 V   F47C10.3    GGCAATAAACTTGGGCAAAA    ATCGGCGTTGTATTGACCTC    V-3G08
134 D05 V   F47C10.4    TTTTCGGATCATTAGGCCAG    CTTGTGAATATGCACGGCAC    V-3G10
134 D06 V   F47C10.6    TAACACTCGGTTTCCCAAGG    CCGATTATTGATGAATCCCG    V-3G12
134 D07 V   F47C10.7    CCTGGATTACAAAACAGCAAGAC TTGTCAATGGATAGGAGCACTTT V-3G14
134 D10 V   C17E7.2 GGAAGCCGTCACAAATGACT    TCATTTAGGATATGGGGGCA    V-3G20
134 D11 V   C17E7.3 TTGCAACGTATTTGCTGGAG    TGTGACGGGAAAATGTGCTA    V-3G22
134 D12 V   C17E7.4 TTCGAACAATTTTCAAGGGC    GGCTCACCCAGATTGAGAAG    V-3G24
134 E01 V   C17E7.5 AATGACCTAGAGACAATTTGGCA GCAAAATCTCAAAAAGCTCGTAA V-3I02
134 E02 V   C17E7.6 CGAAAGACCATCGTAAGGTACTG GGTGCAGATCAAAAGTATTCAGG V-3I04
134 E03 V   C17E7.7 TCCAAAATGATGAGTGGCAA    CTGACTTGCGATGCCTGTAA    V-3I06
134 E06 V   C17E7.10    GGCTGCCTAAGCCTCCTTAT    CCTTGCCTCAAAAATTGCAT    V-3I12
134 E08 V   T20C7.a TTTCGTTGTCATAGTTCGGAGTT TGTTGCAAAATTGTCAAAAACAC V-3I16
134 E09 V   T20C7.b TTGGTTCGATCTGTTTTCTTGTT ACGCACCTGTGAAAGACATAAAT V-3I18
134 E11 V   K07C6.2 TTTGCCGCCAATTTTTATTC    ATCTGGCGATATTCTCACCG    V-3I22
134 E12 V   K07C6.3 AACCGTTGTTCAAACTTCCG    GCAACTGGTCAGCTGTTGAA    V-3I24
134 F01 V   K07C6.4 AATTCTCTGCTCGTCGGAAA    TTCCAGCGCTATACGGAAGT    V-3K02
134 F02 V   K07C6.5 GATGTTGCTCATTCTCCGGT    ACGGCATTGTCTCCTCTGTT    V-3K04
134 F03 V   K07C6.6 CAAACCTTGCTGGTTCTCGT    GGCTTTTTGCACCAAATGTT    V-3K06
134 F08 V   K07C6.11    TGATCCCGGTCAGTTTATCC    AATTGGTTGTTCTGCTTGCC    V-3K16
134 F09 V   K07C6.12    AAAGGCAACAAACGAAATGG    CCTAGTGAAGCTGGTGGAGG    V-3K18
134 F12 V   K07C6.15    TCAACTTCCAGGATAAGCGTAAA ACAGACGGTAGACAGTGTTGTGA V-3K24
134 G01 V   T09H2.1 TAAAGGCACATGTTGTTTCTGTG AGTCCAAGATCATATTTCCGGTT V-3M02
134 G02 V   B0213.1 ACTCTGTTTGTTGCACTGGATTT TAATACTTTGTCGCGTATCCGTT V-3M04
134 G04 V   B0213.3 ATCAAACACAAATACCACGTTCC ACCACTTTGCAAAAATGTTGAGT V-3M08
134 G06 V   B0213.5 CGAAAGTCCAAATTATGTCAAGC TTTTCCTAATTTTTGCGTTTCAA V-3M12
134 G07 V   B0213.6 AGTGAGAGAGGGAGAAGAAGGAA TAAGGTTGAATCCTAACTGCCAA V-3M14
134 G08 V   B0213.7 TCCATAGGCAAGTAGGCAGG    TGCCTAAAAATTTCGGATGC    V-3M16
134 G09 V   B0213.8 ATGGTCATGGCAACCCTTTA    TAAATTTTGTGACGTGCGGA    V-3M18
134 G10 V   B0213.9 TGAAACCCTGTACTCCCTGC    CTTGGTCGCATTTCCAGTTT    V-3M20
134 G12 V   B0213.11    GGAGCACTTACATAGGGCCA    TGGCATTGGAAAACAGTTCA    V-3M24
134 H01 V   B0213.12    GACCAGTCTCAGCCAAAGAATTA TTTGCTCCATTTGATTTTGTTTT V-3O02
134 H03 V   B0213.15    TGGATTCCCTCGTTTTTGTC    AGCAAGGCAGAAACTTCCAA    V-3O06
134 H05 V   K09D9.1 AGGAGTGGAAAAGTTGACAAACA GATGATCCTCCAAATTGTAGCTG V-3O10
134 H06 V   K09D9.2 AGCAAAGAACGGAGTCACTGTAG TTATAGCGAAGAAGGAGGTTTCC V-3O12
134 H07 V   K09D9.3 AGTCATGCTTCACATTCTCCATT ATCTTGAAATGCAATCACGTTTT V-3O14
134 H09 V   K09D9.5 TTTGAAACTTCTCAAGCTTTTCG AAAACTCACCGCTAGGGAAATAG V-3O18
134 H10 V   K09D9.6 ATGTCATATCAATCCAAAATCGC GCTCTTGGATGACCAATGTTAAG V-3O20
134 H12 V   K09D9.8 TTTGATGCACAAAAGATCACATC CAATTATCACACCACATGTACGG V-3O24
135 A01 V   K09D9.9 AAACCAGTTTATTTGCCTTACCC TTCGACTTCTTATTTTCTCAGCG V-3B01
135 A02 V   K09D9.10    CAGACATAGGGTTCAGGTCAGAT CTCTTTTGGATTTCTCTCTGCAA V-3B03
135 A03 V   K09D9.11    TTGAATTGGAATTTGATTTTTGG AAATGACTCACTTGTTCTCTCGC V-3B05
135 A04 V   K09D9.12    GACGATTACAGTCGTTCCAAAAC AATGCAACTGGTTCCTCTATCAA V-3B07
135 A05 V   C49G7.1 CCGAATCTCCTCATATTCTTCCT AAACGCCTCCACACTTAATACAA V-3B09
135 A06 V   C49G7.2 GCATAATTTCCTGCTTGCGT    TGCATGTCGATAGGGTGTGT    V-3B11
135 A08 V   C49G7.4 GCTTTTCTGACTCCACAGGC    TGTCTCTAGCAGAGCGAGCA    V-3B15
135 A09 V   C49G7.5 CACCACTCACACAGGCATATTTA GCCCACAAGATTCTTCACATAAC V-3B17
135 A10 V   C49G7.6 TGCTTCAGTCCAAATTTTATCGT ATAGAAACCCAAATGTATTGCGA V-3B19
135 A11 V   C49G7.7 CGATGGGAAATTAACGGAGA    GTCCAAGAAGGTGGCCAATA    V-3B21
135 A12 V   C49G7.8 AACGATTTGATGCAACCACA    ATGGTCTCTTTCCGATGCTG    V-3B23
135 B01 V   C49G7.9 AGTTCATAAGTGCAAAAGGCAAA AAATATTCACAGCCATACGCACT V-3D01
135 B02 V   C49G7.10    AAGAAGCCCTTCTCGAAGAAATA ACAAAACTGTGTTCCAGCAAGAT V-3D03
135 B05 V   D1065.2 ACGCGAAAAATCAAGTTTGG    AAAAGAAAATTGCGCACTGG    V-3D09
135 B06 V   D1065.3 CGCCAGTAATGCTTCAGACA    TAATTGTTTTCAGCCCCGTC    V-3D11
135 B07 V   D1065.4 ATACGGCTCGTGAATAAGAGACA GTGCACTAGCGGAGAAACTTAAA V-3D13
135 B09 V   F38H12.1    TCTTGCCAAAACACATCCAA    GATGGGGAGGCATAAGATGA    V-3D17
135 B12 V   F38H12.5    CGATGTGTTTATAGGACCGATGT CAATCCTTGATGAATTTTTAGCG V-3D23
135 C01 V   T05B4.1 TTTCACAACTGATTGAGCTTTCA TAAAACCATTTTTCAGCTTTCCA V-3F01
135 C02 V   T05B4.2 CGAATGTGTGATAAAAATGAGCA AGCCAAAACACCAAATAAAACCT V-3F03
135 C05 V   T05B4.5 ATACTGACAACGCTGATTTTGCT TTTTGCAGATCGGTTGTATACCT V-3F09
135 C06 V   T05B4.6 GATCTTTGCATTGTTCCGGT    TTTACAGTTCAAGGGCTCCG    V-3F11
135 C07 V   T05B4.7 TGCATGGGATGATCTGAAAA    TCACAGCTGCTGAACAAACC    V-3F13
135 C08 V   T05B4.8 TCACCGGTCACCATCAAATA    AGATGCCCATCGACCACTAC    V-3F15
135 C09 V   T05B4.9 CACGGAAAAGTACCGGAAAA    CGTTTCTTTCTTGGCTCCAG    V-3F17
135 C10 V   T05B4.10    TCTCTTGTCGCTCTGCTTCA    CGTTTCTTTCTTGGCTCCAG    V-3F19
135 C12 V   T05B4.12    CACCTGAGGTCGTTTGTTGA    CATCAGCCTCTTCTTCGTCC    V-3F23
135 D01 V   T05B4.13    TAGACCTCAAAACGAATTCCAAA CAGGATATGAAGACTGCTGCTTT V-3H01
135 D03 V   H43I07.2    TGAGATCGAGATGAAAGAGGAAG ATTTCAGCAGCTTCAAAATTCAC V-3H05
135 D06 V   E03D2.3 GGCCTTTGTTGTGGTGATCT    CCATCCATCTACTGGGGCTA    V-3H11
135 D08 V   ZC142.1 TCTTACGGTCCTGTTGAGGG    TTCCGCGAAGTAATTATGCC    V-3H15
135 D09 V   ZC142.2 ATTTATGGGCTTTGCGTGTAGTA TCTCCGTCGTTTCAACTAATGAT V-3H17
135 D10 V   F47D2.1 ATTATATTGGGAGCCAGGGG    ACTTGCCAAAAACCACCAAG    V-3H19
135 E01 V   F47D2.4 CAATTCCCAGAGTAGATGACCAG TTTTATTGCGGTCGATTTAAGAA V-3J01
135 E02 V   F47D2.5 TCGACCTTATCGAGACGCTT    AGCGCTAGGACTCCAAGTCA    V-3J03
135 E03 V   F47D2.6 AATTTTCCAAAAATGCCGTG    TAGATCATTCGTTTGCGCTG    V-3J05
135 E05 V   F47D2.8 AAAATACAGACGGATTCGCTACA ACCGTATCCGAAAAAGAGAAAAG V-3J09
135 E06 V   F47D2.9 GTCTCCAGTGGTGCCAAAAT    GACGACAAAATTCGCTCGAT    V-3J11
135 E07 V   ZC132.1 CGCCAAAGGTATCAGGTTGT    AAATGGTAGTCGGTTGGTGC    V-3J13
135 E08 V   ZC132.2 CACGGATCAAGTTCTGATCTACC TTGTCTTCCTCCAACCATTCTAA V-3J15
135 E09 V   ZC132.3 GAAGTTTCCGGCAACGAATA    CTCGGAAGCCAAAATGTGTT    V-3J17
135 E10 V   ZC132.4 TGGTTGCGGTAATTTTGTCA    TCTATTCCGGGTACCAGTGC    V-3J19
135 E11 V   ZC132.5 CGAGCTAGACCTTCCACCAG    AAGTCCTGGGGGTAAAATGG    V-3J21
135 E12 V   ZC132.6 GTCCTTGATTAGACGATCTGTGG TTCCAAAAGTCAAAAGTTTCCAA V-3J23
135 F02 V   ZC132.8 ATTTTAATTGCATGAAACGCATC TACCCTTTTAAATATGTTCGGCA V-3L03
135 F03 V   ZC132.9 GAAACAGGTGAGAGATTCAATGC TTGCACCAACAACTACGAATATG V-3L05
135 F04 V   R02D1.1 AAGATCCGTTCAAAATAACACGA AAGTCACAGTTCTCGATAAAGCG V-3L07
135 F05 V   D2063.1 CATTCACACAATTTGTCTCTCCA TTTGAGTCTTTCGCAAGTCCTAC V-3L09
135 F06 V   D2063.2 AAAGAATATGAAATGTCCCCGAT TTCCCGCATTGAGTATTTTCTAA V-3L11
135 F08 V   F32D1.2 TCAAAAAGACTGGGGTAACTTGA ATATTTTTCCGACATGGACTGTG V-3L15
135 F09 V   F32D1.3 ACTCAATGAAAATTCCGTAGCAA AAACTCTTCAATTCCAGACCTCC V-3L17
135 F10 V   F32D1.4 GACTTGCAAACCGTAATTTTCTG AAAAATATCATTTTCCGCCATCT V-3L19
135 F11 V   F32D1.5 GGTTTGTTGTCGTCGGAACT    TCGATTTCAAGGATGTGCTG    V-3L21
135 F12 V   F32D1.6 AGCTTTGTAGGATGCATATGAGG AGCACTGCTACAGGTGATTTCTC V-3L23
135 G01 V   F32D1.7 ATGAGCCTTCAGAGCTTCCA    CGCGAATTTTCGGATTTTTA    V-3N01
135 G02 V   F32D1.8 CACACAATCCTGAAAAACTCACA TCCAAAATCTACATCTACGGCAT V-3N03
135 G04 V   F32D1.10    AACGTGTGTCCGAAACATCA    TTGTCGTTCTCACGATCAGC    V-3N07
135 G05 V   F13A2.1 CTTTATGTTCTTCGGCTAAGGGT GAAAATGCGCTGTTTTCATAATC V-3N09
135 G06 V   F13A2.2 GAAACACTTGAAACTGTGCCTTT GGAGGAGCTCAAGTTGGTTTATT V-3N11
135 G07 V   F13A2.3 TAATGGAACAATTGGGTAGAACG GACCAACAGGGTGAAAATGTTAG V-3N13
135 G08 V   F13A2.4 TATTATGCAAAAGCTTCAGGCTC TGTCCTTCAATCTCAATCCAAGT V-3N15
135 G09 V   F13A2.5 GGCAAATTGTCATTTTATTGGAA TTCTCACACGCTCTTTTGTGATA V-3N17
135 G10 V   F13A2.6 AGTACAACTGCCATCGGTCC    ATTGCCTAGCAACATCCGAG    V-3N19
135 G11 V   F13A2.8 CTACAGTACCCGTCATTAGCACC ATCGATCTTGCTCATGGTTAAAA V-3N21
135 G12 V   Y47D7A_138.a    AAAAACGTTTAATGACAGCGAAA TCCAGAAATCACCCTAACTTTCA V-3N23
135 H01 V   Y47D7A_138.b    TTTTTAACAGCTTCCCAATTTCA AACATTATTATGGGATGCGTTTG V-3P01
135 H02 V   Y47D7A_138.c    CCTGAAAATCATTCAACTTCCAG GGGAAAACTTTTAAAGCGAAAAA V-3P03
135 H04 V   Y47D7A_139.a    CTCATTCCCAACACTCTTACAGG ATCACATTGGATAATGTAACCGC V-3P07
135 H06 V   Y47D7A_143.b    AAATGAGGTGAAGCTGTGAAGAG AACACAAAAAGTTCCGTTCAAAA V-3P11
135 H07 V   Y47D7A_143.c    CTATTTCATGTGTCTGATTGCCA TTCCTGGAACAAACACCTTTTTA V-3P13
135 H08 V   Y47D7A_143.d    AAAAGTGCACATGAGACAAGGTT CTGACTACTACAGCCGGAAAATG V-3P15
135 H09 V   Y47D7A_143.e    GTCAAATCACTGATCTTCCGAAC TTGAAACATGCAAGAATGCTCTA V-3P17
136 A02 V   H22D07.1    CGTAAAATTACACGTAACCGGAA TATTGCAATTGATCGAGTGTTTG V-3B04
136 A03 V   T08H10.1    TCTGCTTTTCGGTCATATTCATT AAACCTACAAATCAGCGATGAAA V-3B06
136 A04 V   T08H10.2    TAACCAGATCGAAAACGAAACAT CTGGAGATCCATCATTTTTCAAC V-3B08
136 A05 V   T08H10.3    AATGCGATTTGGAGACTATTTCA ATAAATCACCCATCATTCAGTGC V-3B10
136 A06 V   T08H10.4    TTTAGCATTTTTCAGGCTCTCTG CTCCGTTGTCCGTTGTTCTATAC V-3B12
136 A07 V   T08H10.5    TGACATCCATCGAAGTAGTTCCT CATTGACGTATTAATTTCCTGCC V-3B14
136 A09 V   T28F12.2a   AAGCCAACACAAGAATCACAAAT CAATCTATTTCTCACCTCCATCG V-3B18
136 A12 V   F54D11.2    GCTTAAAGGCTCAAGTAAGGAGC GAAATATCCGAAAATCGGAAAAC V-3B24
136 B01 V   F54D11.3    TCTTGATCCAGCTCAACGTG    ATTCGAGGCCGTTTACCTTT    V-3D02
136 B02 V   F41F3.1 AAAGTGTTCATTTGGCTTGAAAA TTGATTCTCCATGTCTTCCTGAT V-3D04
136 B03 V   F41F3.2 ATTGGAAGGTTCATTAAAACGGT ATTGCTCCAATTGAGATTTTTGA V-3D06
136 B04 V   F41F3.3 TGGAAAAGAGATGATCAAGGTGT TTGTTTTAGCTCCAATTTTTCCA V-3D08
136 B05 V   F41F3.4 CCTTGTTGTCAAGGCTGGAT    ACCGATTCATTGCCTACTCG    V-3D10
136 B07 V   F41F3.6 AATCTGATATCCGGCAAACG    AAATCGGCATGCTTTTTACG    V-3D14
136 B08 V   F41F3.7 ATATTCTCAACCAACTTCTGCCA GTTGAAAATAATCGCAAAAATGC V-3D16
136 B09 V   K03B4.1 AAACGAATATGACGAATGGTTTG CTCCTTTCCTTCAATAAGGTCGT V-3D18
136 B11 V   K03B4.3 ATGTTCTGATTTTTGAACCGCTA AATTAGGTGTGATATGGTGGACG V-3D22
136 B12 V   K03B4.4 AGGATTACCTAATCTCGACTCCG GATAAACCGGGTCAAGTCTTTCT V-3D24
136 C01 V   K03B4.5 GATGACATGTATGCTTTGCCATA TTTTTGATCATCACCAGCTTTTT V-3F02
136 C02 V   K03B4.6 GGCACTTTGGGCAATAAAAA    TAATCACAGCGGAGAGCCTT    V-3F04
136 C05 V   ZC266.2 GCTCAAAGAGATCAAATCTGGAA CGGTGTCCTATATGGAATTTGAA V-3F10
136 C06 V   F39G3.1 CAGCTATGTACCGCCCGTAT    CAAGTGTCTTGAATTCCGCA    V-3F12
136 C07 V   F39G3.2 TCCACCTGAACAACAGGACA    TTGATGTGCAGGTTTGGGTA    V-3F14
136 C08 V   F39G3.3 AAAACGTCAAATGCCGAAAC    ATGACGAGCTTTTCGCTGAT    V-3F16
136 C11 V   F39G3.6 GTCCCATTGGTTCTTGTGCT    GCCCTAAATTGTTTCGCAGA    V-3F22
136 C12 V   F39G3.7 TGGAGAATAGTTGTGCACCG    ATCTGGGTTTACGTTGGCAG    V-3F24
136 D01 V   F39G3.8 CTTCTGGTGCGATAACCCAT    AGTGTTTCCAGACAGGCCAC    V-3H02
136 D05 V   C18G1.4 TCGCAAGCCATATCATTCAA    GGAGTAGCAAGAGGCACTGG    V-3H10
136 D06 V   C18G1.5 CTCCAAGTGACCACTACTCATCC GGACACCTACAAGAGGGAGAGAT V-3H12
136 D07 V   C18G1.6 AGAAGGTAGCTGCCCATCAA    GATGACAGACGCGTTGAAGA    V-3H14
136 D08 V   C18G1.7 CTTTGTTCTGGGTTTTAGCTCCT AAGTGTGGTCTTCATTTCCAAAA V-3H16
136 D09 V   C18G1.8 CTTTCAATAACCGTGGCGTT    ATTTGAAATGGCATCGCTTC    V-3H18
136 D10 V   C18G1.9 TATGACTCTTGGCATGCTCG    AAATTGAGGAACATTTGCGG    V-3H20
136 D11 V   Y60C6A.1    CAGAGCATTGATTCTTCTGCTTT TAAATTTTGTGCGCAGGTTACTT V-3H22
136 D12 V   R02F11.1    GAGGGAGACGAAAAAGAGAAGAC CAGAGAGTCAGAGAACGGAGAAG V-3H24
136 E01 V   R02F11.2    TCTGGAGCCTACATCCCATC    GCAAAGTGTCCCAAACGAAT    V-3J02
136 E02 V   R02F11.3    CCGGCTGGGTCAAAGTAGTA    AATCCGGAGACCCTCAATTT    V-3J04
136 E03 V   R02F11.4    CGCGAGTACTGTAGCTGAAAAAT TCTGGAGGAATTCAGTGAGGATA V-3J06
136 E04 V   C37H5.1 TCCGGATTTTCATCCAGTTC    GCTGTTCGGAGTTTTTCAGC    V-3J08
136 E05 V   C37H5.2 CGAGTCGCACAAAATTCTCA    CTGCCAACTGGATTCTGACA    V-3J10
136 E06 V   C37H5.3 GTAGATCATCTCGCCCCAAA    CCAAGTTCACTTCCTCTGGC    V-3J12
136 E07 V   C37H5.4 CGAAAGCTATCTGTTGGAAATTG TGCGGGTGAAATAAAACTTTAGA V-3J14
136 E08 V   C37H5.5 GGCTATCCGGACAGTTTTCA    AGAATCGCCTGTTCCACATC    V-3J16
136 E09 V   C37H5.6 CTTTTCCGATCGTCTGAAGC    CACAAGATCAATGTGACCGC    V-3J18
136 E10 V   C37H5.8 GCGTGATCGAAGTCTTCTCC    GATGCAAAATGCCCTGACTT    V-3J20
136 E11 V   C37H5.9 CCGTGGAACTGTTGAGGATT    AAATTGTGCCTTATGCCTGC    V-3J22
136 E12 V   C37H5.10    GAGCTAAAACCTTCTCACCCAAT GCTTTCGAAAATGATCTCAAAGA V-3J24
136 F01 V   C37H5.11    CTTCGATGATGGCCTAGTAATTG CCAACAGATAGCTTTCGAAAATG V-3L02
136 F02 V   C37H5.12    TCACGGGTTACTGGAAAATAAAA CATTGTTGTTTATGTGTCTGCGT V-3L04
136 F04 V   T19H12.1    CTGAAGCAGGATTCCTCGAC    AAAAATCGGACGATTGGTTG    V-3L08
136 F05 V   T19H12.2    GCTGTTCTCCCAAAATTTACCTT TGAATTGAAAAATAGACGGGAGA V-3L10
136 F06 V   T19H12.3    CAGTCTGCCGATTTTTAGCC    TTTGCCCACAAAACTGTTCA    V-3L12
136 F07 V   T19H12.4    TACTGCCGACAGCATCTTTG    TTGTAGGCTCCACAAATCCC    V-3L14
136 F08 V   T19H12.5    TTGGTGTATGTGTGTATGGGTGT TTTGGATTGGCTATACTTGGCTA V-3L16
136 F09 V   T19H12.6    ACAATTGGTGACAGCAACGA    CGGGCAATGTAAAACAGCTT    V-3L18
136 F10 V   T19H12.7    CTACGAGTTTGCCTGAAGCC    CATCCGTATCTTCACTCGCA    V-3L20
136 F11 V   T19H12.8    TCGCTGAATATACCGTTCCC    GGTCAATGGGCTTCAAAGAA    V-3L22
136 F12 V   T19H12.9    GATTTAAAACCGAACGCCAA    TTGGACTATGCGGTTCCTTC    V-3L24
136 G01 V   T19H12.10   TGGTTGATTGGTGAGCACAT    ACACTTCCTGGGAGTCCCTT    V-3N02
136 G03 V   H23N18.1    CGATTACTTCCCAAAACACTACG AACTCGTTTATCAGCAAGCAAAG V-3N06
136 G04 V   H23N18.2    AAAACCTCAATTTTTGCAGTCAA GCCAGATCAAGTTTGTCATAAGG V-3N08
136 G05 V   H23N18.3    ATATTCTCAACAGCCATTCTCCA GCAATCAGTAGAACACCGAAACT V-3N10
136 G06 V   H23N18.4    GAGAAAACTGCAACTCGTAGGAA CTGAGGTTGATCTCCAAAAATTG V-3N12
136 G07 V   H23N18.5    TTGGCTGTGTTACAGAATGTGTC AATTAATCAATAGCGTGGGGATT V-3N14
136 G08 V   C02E7.1 GATGCCGAGTGATTGGATTT    CTGCTTCTGGTCCCTCGTAG    V-3N16
136 G09 V   C02E7.2 TCGGATTTTTCTGATTTGGC    AAACGTCCAAGTTTTGGCAG    V-3N18
136 G11 V   C02E7.4 CTTCACCCACTCTATTCATTTCG AACTGGTCATGGAAACTTTTTGA V-3N22
136 G12 V   C02E7.5 GTTTGCCGGAAAATGTGACT    TTGCTGAATTTTCCGAGCTT    V-3N24
136 H01 V   C02E7.6 CTCGCATCATGAATGTGTAAAAA TTTTGAAAAACCCAATCACATCT V-3P02
136 H02 V   C02E7.7 ACTCGCTAGGAAATTGGATTAGG CGCTAAAGTAAGCAGTCCTTCAA V-3P04
136 H03 V   C02E7.8 TCAGGCCAATAGAGGAAATATGA CTAATAACAAGCAGCAGGGAATG V-3P06
136 H04 V   C02E7.9 AAGGGTCTGTGTAACCAGCG    AATTGCGGAAAATTCGACTG    V-3P08
136 H05 V   C02E7.10    TGAACACGAAATGCCGAATA    AGAAGTCCGGTACGTCCCTT    V-3P10
136 H07 V   C02E7.12    CATTTCCCGCACTTTGACTT    TAATTATCGCGCATTCACCA    V-3P14
136 H08 V   C02E7.13    CGATTGTCAGCGACACTGTT    TAAACCATTCGCCAAAGGAG    V-3P16
136 H09 V   C02E7.14    TACACTTCGGAAAGAATAACCCA CCCTCTAAAAACTTCCAGCAAAT V-3P18
136 H10 V   F26G5.1 CATTCTGGCTCAATTCCGTT    GCTGGGTGATTTCTTGGTGT    V-3P20
136 H12 V   F26G5.3 ATGAACATCTGAAAAAGTCGCAT ACCAGAAACAACTCGAACAAAAA V-3P24
137 A01 V   F26G5.4 GGATTGTTGCTCAATTCGCT    TCAATGTTGGAAGTGGGTCA    V-4A01
137 A02 V   F26G5.5 TTGTGTGCAAACACCGATTT    ATCAATTGCGGGAAAGATTG    V-4A03
137 A03 V   F26G5.8 ACTTAATGGCAGAGTAGCACCAG AGTAACGAAAACCGGCAATATCT V-4A05
137 A04 V   F26G5.9 TAATCTGCGGTGGAACATCA    CCACATCAACTTGTGATGCC    V-4A07
137 A07 V   C13D9.1 ATATTGCGGCGATAATGAGC    AAATGGCAAGAATGTGGAGG    V-4A13
137 A08 V   C13D9.2 TCCAGGATGTTTGAAAAAGAAAA GATTTCAATTTTGAGTACGCCAG V-4A15
137 A09 V   C13D9.3 CCTGGTGAAAGCTTCTTTGC    TCATGAGAATGTGAAGCCCA    V-4A17
137 A10 V   C13D9.4 GACGACTCGCAGAAAAATCC    GCACACATGGCAACAAAATC    V-4A19
137 A12 V   C13D9.6 CCATTTTGAGCCCATTTGTC    TCCAATCTGCCCAATGTGTA    V-4A23
137 B01 V   C13D9.7 TTCAATTGGATACCGGGAAA    CATTTCTGGCGTTTGGAAAT    V-4C01
137 B02 V   C13D9.8 TGGAATGGAATAAGGTTCGC    TTCCAGCCACTCGAAAATCT    V-4C03
137 B03 V   C13D9.9 CTGCGGTAACCACTTCATCA    ATATGCCCAGTTTTTGGCAG    V-4C05
137 B04 V   K11D12.1    CAAGGGGCACCTCATTTTTA    TCCCACTCCAATCATCATCA    V-4C07
137 B06 V   K11D12.3    GATTTGCGGCAGAGCTTATC    TTCAGACTTTAGCGAGCGGT    V-4C11
137 B08 V   K11D12.5    TAAATTGTGTTTCAAACGTGCTG AAAAATTTTCTGGAGTCTCTCCG V-4C15
137 B09 V   K11D12.6    GTACTTTGGAACTGATCGTGGAC CCCAAAGATCATATAATTTGGCA V-4C17
137 C01 V   K11D12.10   TGCGTTGCACTTTTCATCTC    GTTAACGCTTTGCAGGAAGC    V-4E01
137 C02 V   C04F5.1 GCTTCACCTGTCTTATCACTGCT ATCGATTCAAACAAAATTCGATG V-4E03
137 C03 V   C04F5.2 CAGACATTTGGGAGTTCTGAAAC AAATGTGGATAAAATCGCTCAGA V-4E05
137 C04 V   C04F5.3 TAGCTCACGATCAGAAAGCAAAT GTCGCTTTTCTTCATCTTCAAAA V-4E07
137 C05 V   C04F5.4 ACATCCAAAAACTTTCAAAGCAA ACTTCAAAACTCGAACCAATTCA V-4E09
137 C06 V   C04F5.5 AACTCACTTTCAATAACCGCAAA CAATGCTTTCAGAACAGTCCTCT V-4E11
137 C07 V   C04F5.6 GCTATATTTTCAATGCGCTTCAC AAGAAAAATCGTCGTCATCTTCA V-4E13
137 C08 V   C04F5.7 TTTGTTGATAATTCGGATGCTCT TACCTTTCAGATTCTCTGTTCGC V-4E15
137 C10 V   C04F5.9 CGCTGAAATTTTAGGGAAATTCT TCCTTTGATCTACAGGATTGGAA V-4E19
137 C11 V   F14F9.1 TCTGCAATTTGTCTTGCTGG    TCGACAACCAGCAACTTTTG    V-4E21
137 C12 V   F14F9.2 CGCGTCAGCTGTAGTGTTTC    AATTAGCACCGGGTCATCTG    V-4E23
137 D01 V   F14F9.3 TGCCATCAAACCAAACAAGA    TCCAATTTTCTTTTCCACGG    V-4G01
137 D02 V   F14F9.4 TTTGTTTCGGTCATTGTGGA    CGTCATTTACGGCAGTCCTT    V-4G03
137 D03 V   F14F9.5 AACAATCACGGAAGAAGATGAAA ACTGTCGGTTGACGAAAATCTTA V-4G05
137 D04 V   F14F9.6 TTAACCATTACGGCCAAAGC    GTGCCATTTTCGTTTTCGTT    V-4G07
137 D05 V   F14F9.7 TCGATTGATGCATTAAGTGTTTG ATAAATTCAGGAGTTCCCTGCTC V-4G09
137 D06 V   C03A7.1 AAATGGGAATGAAGTGCGTC    TGTCCTTCCAGTCGCTTCTT    V-4G11
137 D09 V   C03A7.4 TCCAATACCAACAGTGCCAA    CTGCTGGCGAGCTAGAAAAT    V-4G17
137 D10 V   C03A7.5 TCTGGGATAAGTCGTGGTCC    TTTCTTCATGCGGGTTTTTC    V-4G19
137 D11 V   C03A7.6 ATCTAACAACGTTGAATGCCAGT CCGGGATCTCTAGAGTTTGAAAT V-4G21
137 D12 V   C03A7.7 GGAGTTGTCACAGGCTGGTT    CGAAAAGTGAACGGAAGAGC    V-4G23
137 E01 V   C03A7.8 GTTGGCAGATCCTTGGTTGT    GCACCAGTTGAACGGAAGTT    V-4I01
137 E04 V   C03A7.11    CATCCTCGAACAGCTTCTCC    ACAATTTTGGCTGTTTTGCC    V-4I07
137 E06 V   C03A7.13    GCCAGTATCTCTCTGGACGC    TAGTCAAAGGGCACGGAAAC    V-4I11
137 E07 V   C03A7.14    GCAGATCCTTGGTTGGTGTT    GAGAGAAAACGAGCATTCCG    V-4I13
137 E09 V   C52A10.1    CCTTCATATTCGTCTACAGTGGC TGTAGGGCATTCTGGTTAAAGAA V-4I17
137 E10 V   C52A10.2    TTTTCTCAACTCGTCAAATGGTT TACCGAAGTTTTCAATGCTTCAT V-4I19
137 E11 V   C52A10.3    TAGGCTTAGTTAGGCACTGCAAG TTCTTTGCTATACAGCTTTTGCC V-4I21
137 E12 V   B0238.1 TACGCCTCCACAGCTTTCTT    AGAAATGGACGGAACCACTG    V-4I23
137 F01 V   B0238.2 TCTCGCAGATGAACAGTTGG    ATGTCTGCGTTTCCCATTTC    V-4K01
137 F02 V   B0238.3 TAATCGGGTGAAAGTAGCAATGT CATTCTCACCAGACATCATGAAA V-4K03
137 F03 V   B0238.4 AAATCCCAAACTTTAGCTATGCC TCTTCAGACATCATCAAATCCCT V-4K05
137 F05 V   B0238.6 TTTGTAAGTCCTCGAAGAACAGC ATGACGTGGCAATGGTTAAATAC V-4K09
137 F06 V   B0238.7 TGTTGGAGTGAAATTTGCCA    CGTCTTGGACCACTTGGATT    V-4K11
137 F07 V   B0238.8 CATGCGACAGTCAAAAATGG    TTTTCTAGGACTCGCCCAAA    V-4K13
137 F08 V   B0238.9 ATCGAGACCACTATCCGGTG    AGATCGAGCTTGGTGAAGGA    V-4K15
137 F09 V   B0238.10    AACTGCCAATTTTCGTAATGAGA CTTTTCCTTTAACAAGCCACCTT V-4K17
137 F10 V   B0238.11    TCGGAAACTTTTGCTGCTCT    ATTAATGGGGAATGGGTGGT    V-4K19
137 F12 V   B0238.13    TTTTGCCAAACACAATTGGA    CTCCCAACTACCGAATTGGA    V-4K23
137 G01 V   B0238.14    CAGGATTGCAATTTCATCTTTTC TCGTTTAACCAACCTTCTCATGT V-4M01
137 G02 V   Y49G5A.1    CTTTGTATATTTGCTGGAGTCCG AGCAATTTGCACTGGAAAAATAA V-4M03
137 G03 V   C10G8.1 GAAAATTTTGATGAGCCCGA    GCACCATATTGAAGATCGCA    V-4M05
137 G04 V   C10G8.2 CACCTTCTCCCTGGTTTTCTAAT TCTAACTCATCGGTTCTTCCAAA V-4M07
137 G05 V   C10G8.3 TCGTGATGCTTAAAAGGAACAAT TTGAAATTTATTCGACAATTCGG V-4M09
137 G06 V   C10G8.4 TACAGGGAAAATTCAGGAGACAA AAACGATATTTCGTCCTCAGATG V-4M11
137 G07 V   C10G8.5 AACTTGAAATCGCCGAGATG    TGCATGTTTAAAGCGCTACG    V-4M13
137 G09 V   C10G8.7 GAACGGTTGTTCCCAGAAAA    CTTTTTCAGTTGCGACACGA    V-4M17
137 G11 V   T09D3.1 TGCCATGGCCCATATATTTT    ACGAAAAGGCTGCCGTAGTA    V-4M21
137 G12 V   T09D3.2 TGAAATTGAGCCTGCAACTG    TCATTGCTCAATTGCGTAGC    V-4M23
137 H01 V   T09D3.3 TTTTGGCGCCTATATGGAAG    GTTTGGCCACCTGTTGAACT    V-4O01
137 H02 V   T09D3.4 TGGTAAAACTGAAGAGAACCGAA GACGGATTGTTGTACTCGATCTC V-4O03
137 H05 V   C35A11.2    TTGGATCTTTCTCTCTCTTGTCG GGTAGAAGGAATGCAACAAAATG V-4O09
137 H06 V   C35A11.3    AAATTGTTGCTTGGAAACTGAAA AAGTGTTCACGACAGCATTTTCT V-4O11
137 H09 V   F08F3.1 TCCGGAAAGTTAGTTTGGTCATA AATTTATGGTTCGAACTTCAGCA V-4O17
137 H10 V   F08F3.2 TTTCCCGTTGATGGAAGAAG    CGACTTGCTGAATCCACTGA    V-4O19
138 A01 V   F08F3.5 GTATTCAATTGGCTTCCACTCTG AGTTTTGGGATAACTGTTGGGAT V-4A02
138 A02 V   F08F3.6 AGAAATTCACCGGAACATGC    TTTGACCGCATTTTGATTGA    V-4A04
138 A03 V   F08F3.7 TGTTCAACGTTTTTCCGTCA    TCTGTTCATGAAATGCTGGC    V-4A06
138 A04 V   F08F3.8 ACGACAGCTCCGACAGAAAT    AAGTAGGGCGTTCGGTTTTT    V-4A08
138 A05 V   F08F3.9 TCCGTTGCTCAACACTTCAG    TACGACGCTTACGCAATCTG    V-4A10
138 A07 V   ZC317.2 AGCTGTCATTTCAATGCTTGTTT ATATTTTTGGCAAACTTCGTTCA V-4A14
138 A09 V   ZC317.4 TTACCAAACCCGAGCAAAAC    GACGTAATGAGCCCGAAAAA    V-4A18
138 A11 V   ZC317.6 GCATGTTGTATTACATTGCCCTT TTTCGAGACCCACTACCGTAATA V-4A22
138 A12 V   ZC317.7 TTTTAGCTCAGCCCGTTGTT    TCGAAACCTTCGAATTCACC    V-4A24
138 B02 V   T05C3.2 ATAACCAACCTTGCCACTCG    AATACATTCGGCTGTTTCGG    V-4C04
138 B03 V   T05C3.3 GGATTGAGATAGTGGCGGAA    CCATGTCGTTTTCGTTGTTG    V-4C06
138 B04 V   T05C3.4 ACTAATGCCAGAAACGCACC    AGCAACCACTACAACCGTCC    V-4C08
138 B05 V   T05C3.5 TTTGGCATTCCTTTTCCAAG    TCACTGTCATGTCCGCATTT    V-4C10
138 B06 V   C24G6.1 AACACATGGAAAATGACCGATAC AATTGGTGGATTTGCATAAATTG V-4C12
138 B07 V   C24G6.2 ACATACTAATGCCTTTTGTCCGA TAGAAGGATTCCAAATGACCAGA V-4C14
138 B08 V   C24G6.3 AAATGGTGTCGGATTTTCCA    ATAACCGCTTCAAATGCCTG    V-4C16
138 B09 V   C24G6.4 CCACTTTTTCAGGTTGCCAT    TGCAAATGACGAAAGAGCAC    V-4C18
138 B10 V   C24G6.5 CTTACGTCAGATTGGTCTCCATC CTGCAGTACAAAGTCCCAAATTC V-4C20
138 B11 V   C24G6.6 AGCTCGATCAGCTTCTCTGC    ATTGGCGAAAGCAATTGAAG    V-4C22
138 B12 V   C24G6.7 GTCGATTGTTTTCCAGCGAT    TCACCAAGATACGGCATTCA    V-4C24
138 C01 V   C24G6.8 ATGGGGAGATAAATGGGGAG    AAATGATTGAAAGGCGCATC    V-4E02
138 C02 V   C18C4.1 TAACGATTTAGCCAACGTGTTTT TCTTCCTTAACATGCTTGATGCT V-4E04
138 C03 V   C18C4.2 AGTTTTTGCGATTTTCGTGG    CATGGGTCAATGTTGCTACG    V-4E06
138 C04 V   C18C4.3 CCTTTTCTCTCGACAGACCG    AAGCACAGGTTTTGGATTGC    V-4E08
138 C05 V   C18C4.5 CCTTTTCGCTTCATCCAAAG    ATGCCATGGAGCAAGAAATC    V-4E10
138 C06 V   C18C4.6 TTTGCATTAGCCAACTCAATTTT TAAAATTCAGATTCGATGCCCTA V-4E12
138 C07 V   C18C4.7 GACGCAGATAAATTGTGTGTTGA ATTTTTGTTGAAGCTGATGGAAA V-4E14
138 C08 V   C18C4.8 TTTGGTGGTTCTACAATGCTCTT ACTCGGGAAGTTTCAGCTTTATT V-4E16
138 C09 V   C18C4.9 CAAAGCGCAGAATGTTTCAA    TTCCCAATCATCCTCACCTC    V-4E18
138 C12 V   CD4.2   CTGGGTCATCCTTCATATCAAAA ATACATCATAACAACGGGTTCCA V-4E24
138 D01 V   CD4.3   CAGGTTGAATCCGTTTTTATTTG CAATGCTTTGAGTTCTTCTTGCT V-4G02
138 D02 V   CD4.4   ATTAATTTTCAGGGCGAAATGTT ATTTACAAGCGATGACCAGTTTG V-4G04
138 D03 V   CD4.5   GACACGTTTAGCCTTTTCGC    TCTTGACGTTTTCAGCAACG    V-4G06
138 D04 V   CD4.6   AATGGACAGAAGGCATGGAC    AGTCGAATATGCCGTTGAGG    V-4G08
138 D05 V   CD4.7   CTCGACATGGAAGTGAGCAA    CGTTTCCAAGCTTCTTGAGC    V-4G10
138 D07 V   CD4.9   CCAGATGAAGCTCTTGGGAG    GGTCTATTCCATTGCGGAAA    V-4G14
138 D09 V   M03E7.2 AAGTTGAGGCTTTATTCCCTTTG GAAGGACATTGATGATCCCATAC V-4G18
138 D10 V   M03E7.3 TTGGCGATGCTACTCTTTACATT TTCGTGTTTCTTTTCAGCTTCTC V-4G20
138 D12 V   M03E7.5 GAAGCAGAACATGAATATCAGGC GCCGTCTCTCACTCTCTAACAAA V-4G24
138 E01 V   C14C11.1    GTATTCCACCCACGCATCTT    CCAACGCAAACCATTTTTCT    V-4I02
138 E02 V   C14C11.2    TCTCTACAATGCCAAGTCAATCA CTTCATGCCTAATCACTTTTTCG V-4I04
138 E03 V   C14C11.3    TGGAATCCCATTCTTTCATATTG GTGGCATTTTTAGCTTCAACAAC V-4I06
138 E04 V   C14C11.4    GTTTGCAGACTCCGTTGGAT    AAGAACGACATCCGGTTTTG    V-4I08
138 E05 V   C14C11.5    TCTTTTGGCCAATTCCAGTC    AACGGCCCAAATCATTACAG    V-4I10
138 E06 V   C14C11.6    ACGAGCTGCTGATTTTTCGT    CAAATCCTGGCATCGATCTT    V-4I12
138 E07 V   C14C11.7    TAACGGTAAATCCTTGAATTGGA TTATCATCTGTTGTCGTTTCGTG V-4I14
138 E08 V   C14C11.8    GTGGCTGCTGAACGACAATA    CCAACAACCACAACAACAGC    V-4I16
138 E09 V   F25B4.1 GATAAGAAGCGTCCACTCGC    GCTTATTCGCCACCTTTTCA    V-4I18
138 E10 V   F25B4.2 CGACGTACTCGAAAAGGGAG    AAATGATGGTTCCATTCCCA    V-4I20
138 E11 V   F25B4.4 TTCTGCAAAACTTCGTTTTCTTC CTGTGCCCATTGTTTTCTGTTAT V-4I22
138 E12 V   F25B4.5 GAGTGAAGATTTGGGGACGA    ACATTCCATGCACCATCTCA    V-4I24
138 F01 V   F25B4.6 GCTGACGCTAGACCACTTCC    GCAACAGCAAATGGGATTCT    V-4K02
138 F02 V   F25B4.7 AAGTTCATTGTAAATCGCCAGAA AGTGGAACGGGTCAAACTAATCT V-4K04
138 F03 V   F25B4.8 ATATATAAATCGGTTCCACGGCT GCATGTAAATTGCTCTCATTTCC V-4K06
138 F04 V   F25B4.9 CAGGTGATTACCGTACCCATTTA CACAGTCGATTCAATTCATTTCA V-4K08
138 F06 V   K09H11.2    TAGACAAACCGCTTGTTTTCATT TAACTTAATCACCTGGAAAGCCA V-4K12
138 F07 V   K09H11.3    GCAAGGAAGGCAACTCTGTC    GTTATTTCTCGGTGTGGCGT    V-4K14
138 F08 V   K09H11.4    GAATTGTCGGATGCAGGAGT    CGCCACTTCTTGACCAATTT    V-4K16
138 F09 V   K09H11.5    ATATGTGGGAATTTGTTTCAACG TTGTCTCGAGAGGTTCTCACTTC V-4K18
138 F10 V   K09H11.6    AGAAGACCCGATGAACACATAGA TGAGGAATAAAAAGCGTGTGAAT V-4K20
138 F12 V   C53A3.1 ATTTCGGCATATTTCCTTCTAGC ATCGACTGAAAATTGTGCGTATT V-4K24
138 G01 V   C53A3.2 GATTCGACTCCGGAACAAGA    GATCAGTTCCCCACTTCCAA    V-4M02
138 G02 V   F44E7.2 CCAACTATCATCGACAGTCAACA CACCGTATGCATTAGACAACAAA V-4M04
138 G03 V   F44E7.3 TTCGATAATTCTCTTCGATTCCA CCCCATGATTGTTTCCTATTGTA V-4M06
138 G04 V   F44E7.4 CTTTTCGGGCAGATGAAGAG    CTTCTTGTCGCCACAGTTCA    V-4M08
138 G06 V   F44E7.6 CCATTCGGGTGATAAGCAAT    CATTGCGAATCTGCGTTTTA    V-4M12
138 G07 V   F44E7.7 AAACTTCGTAGAGCTGGCGA    CAACATCATCTGTATGCCCG    V-4M14
138 G08 V   F44E7.8 TGCCTTTCTACATCCAAAACCTA TGTCCACTTTGGAGTTTTGTCTT V-4M16
138 G09 V   F44E7.9 ACAAACCACGAACATAGCAGTTT CGTCCATTTCAGTCAGTACAACA V-4M18
138 G10 V   ZC250.1 GACATGGAGCTTGTCAGCAA    AGCAGCACAGACGGAACTTT    V-4M20
138 G12 V   ZC250.3 ACAAAACCATTGTTATTCATCCG ATAGCAATCTTCATCGTCATCGT V-4M24
138 H01 V   F26F12.1    GCTTAAGCCTTGTAGGCACG    ACCTTGCTTTTCCGGAGACT    V-4O02
138 H02 V   F26F12.2    GGACGACTAGCAAACGAAGC    ATTTGAATTTTGGCGAGACG    V-4O04
138 H04 V   f26f12.3a   CTCAATGTGAGCTGAGAAACCTT TACTGCCTTCTCCCAATACAAAA V-4O08
138 H06 V   F26F12.5    GTAAGCAACCTTTCGATTCCTTT CGAAAACTATGTTTGCACTTTCC V-4O12
138 H10 V   C02G6.2 ATGGATGGAGTCGAGTTTGG    CAAGAATCTGCCACCCAAGT    V-4O20
138 H11 V   C04E6.2 TATTTTCAGACAATGCCCCTCTA GAGCTATCGAAATACATTGCCAC V-4O22
138 H12 V   C04E6.3 TTGAAAAGCTGGTGGAAAATAAA CTAATGCGTGTGTGGACTACTTG V-4O24
139 A03 V   C04E6.6 CAGACTCCAGTGCTCCATCA    GTTCCGTTCGATTCAGCTTC    V-4B05
139 A04 V   C04E6.7 TGACAATGAGCACAAGCACA    ACCGGAGAAGGAGGAAAGAG    V-4B07
139 A05 V   C04E6.8 CTCCAAACGACATATTTTTCTGC ATCAGTGGGATCCAGACACTAGA V-4B09
139 A06 V   C04E6.9 GCTTGTTGACTGGTCTGGATTAC CTTATTGGGCTGCTGTACATTTC V-4B11
139 A07 V   C04E6.10    TCGGTATGGACGCACATAAA    TCTTCGGGATCACTGGAGTC    V-4B13
139 A08 V   C04E6.11    CAGACAATCCGATACCCGTT    GTGATCCTTTTCGACGTGGT    V-4B15
139 A10 V   F58D7.1 CCGTTCTTTTTCAATCAACTCTG GAACCTCTTATCAAGCCAATGTG V-4B19
139 A11 V   M03F8.1 CAGAGATCGAAAAGTCTTCCAAA GAATCACCGGATCTAAAATGTCA V-4B21
139 B01 V   M03F8.3 TTTTCGCTAGTTTTTGTCTGAGC TCGTTGGAGTAGGGTTTCATAGA V-4D01
139 B02 V   M03F8.4 CTTTTGCATTCTCGGCCTAC    TCCAAGATATGCCCAAGGAG    V-4D03
139 B03 V   M03F8.5 GCCTTCAAAAAGTGCGTAGG    ATAATCGTCAACGCCCTGTC    V-4D05
139 B04 V   M03F8.6 AATGGCCAATGAAAAGCAAG    CTCCCATGAGACTTTGAGCC    V-4D07
139 B06 V   C10F3.2 GAATCGAGCGGCAAGTATGT    CCATCCAATATTCGGGTTTG    V-4D11
139 B07 V   C10F3.3 AATCATATGGAGTCGGCTGG    CCATAAGCTGGAAACAGGGA    V-4D13
139 B08 V   C10F3.4 TGCATCACCACTGGAAAGAG    ACCGCAAGTGTATCCAGGTC    V-4D15
139 B11 V   F29G9.1 TAGCGAATAAAGGCTAATGACCA TCACTCACTCACTCACGACTGTT V-4D21
139 B12 V   F29G9.2 TTTGGTCGCTACACAAGCAG    GGAGCACAGTCTTCGGACAT    V-4D23
139 C01 V   F29G9.3 ACGAAGCCACATGTCTGTTTTAT TTGGTATTTACGGAAGCTTTCAA V-4F01
139 C02 V   F29G9.4 TAGATTCAGAAATGCCGGTAAAA GGTAGAAACTAGAAGAGCTCGGG V-4F03
139 C04 V   F29G9.6 TCATTAACATTTTTCCCAACACC GGAGGAGAGATATGCCAGAAAAT V-4F07
139 C05 V   F29G9.7 AGCGCCAAGAATTTTGAGAA    CTGTCTTGACTTGTTCGCCA    V-4F09
139 C06 V   R01B10.1    GAAAGCCATTCTCGTCTTCG    GATCGCACGCTCTATCACAA    V-4F11
139 C08 V   R01B10.3    CCGTTATGTCTCTCAATGTCTCC CATTTCCCATGTTATGGTTTTGT V-4F15
139 C09 V   R01B10.4    AGTCAGACCACCAGATTGGG    AATTGCTCCACAAAATTCGG    V-4F17
139 C10 V   R01B10.5    TGACATGGCATTGTTTCGAT    TGGTCTCTTTCGTCGCTTTT    V-4F19
139 C12 V   Y38A10A.2   GCTTTCCATTGATTGTACTCCAG TTCAAGAATACCTTGGTGGTTGT V-4F23
139 D03 V   Y38A10A.5   CTTCAATTTGTCAAAAGTCTCGG CGAAAAACGAAATGAAATCACTC V-4H05
139 D04 V   Y38A10A.6   AAACACTGTGAGGAGAACACGAT GCAAAACTCCAAATCATTCAAAG V-4H07
139 D05 V   F17A9.1 GAAAAGTTGGAAAAGACGTGATG AAAATGCACATTCAAATAATCCG V-4H09
139 D06 V   F17A9.2 CGACGATGACGATTCAAATG    AGCCGATTCACGGAGTTCTA    V-4H11
139 D07 V   F17A9.3 CGACGATGACGATTCAAATG    AGCCGATTCACGGAGTTCTA    V-4H13
139 D08 V   F17A9.4 ACCGGTCAAGTAGACAACGG    TTTCCGAAATGGGAAAACTG    V-4H15
139 D09 V   F17A9.5 TGAAAATGGATGACTTGGCA    CGTCGACACAAAGAACCAAA    V-4H17
139 D10 V   F17A9.6 CAAAACTTGGGGTTCCTTGA    ATTGAATTTGGCACCTCTGC    V-4H19
139 D11 V   F12F3.1 GTGAGCTCGACTTTTGGAGG    CTAGTCATGGGCATTGAGCA    V-4H21
139 D12 V   F12F3.2 GACGGAGCAATGAATTTGGT    TGGCTCACCTATACCGGAAG    V-4H23
139 E01 V   F12F3.3 TTTCTGCATCGGCTTTCTTT    CGCTACTGATTCCGAGAAGG    V-4J01
139 E03 V   Y38B5A.b    CATCCTCAGCAGCTTTTATGAGT GACGCTTCAGAAGTGAAACAAGT V-4J05
139 E05 V   W06H8.a AAGAAATTCTGGGAAAAGAGTGG TTTTGGTTGTTTTGAAATGGTTC V-4J09
139 E06 V   W06H8.b CTAAATTTTTATCCAGTGCGACG TTTTGGTTATGAGACTTGGCTGT V-4J11
139 E07 V   W06H8.c GTGCAACAGTATTCTCCCTCATC CTCCACCAGAAGAAGTCAAAGAA V-4J13
139 E12 V   K08B12.1    ATTGGCAATTTCACTCGGTC    TCCGACATCCAAGATCATCA    V-4J23
139 F02 V   K08B12.3    TAAAGCTGCTCTCTTCAAAATGG TCCGATTAATGCTCAATGTTTCT V-4L03
139 F03 V   K08B12.5    GTCGACGTTCTTCTTCTGGC    TTGAAGCTCGAAAGTCGGTT    V-4L05
139 F04 V   F31F7.1 CCAATTCCCCAACATACCAG    GAAATTTCGTCGGTTCCGTA    V-4L07
139 F05 V   F31F7.2 CACATTTCCACGATCATTCG    ACACACTTCCGTCGAACCTC    V-4L09
139 F06 V   F31F7.3 AAATGAAGCACTCAAAAAGCAAG TCAAATGTCCACTCACGAGTATG V-4L11
139 F07 V   K12B6.1 GAAGGCACACCAGTCCAAAT    AACTGAAAAGACGGCGGTTA    V-4L13
139 F08 V   K12B6.2 AGCAAAAGGAATTCGAGCAA    AAGAATTGGAAAATGCGACG    V-4L15
139 F09 V   K12B6.3 ATTTTATTTGCAACCAATTCACG ACATTTTCAACGAGGGGTTTATT V-4L17
139 F10 V   K12B6.4 GTTGAGCAGTGCTGATAAGGTTT TAATCCCCTTGGAAAACAACTTT V-4L19
139 F11 V   K12B6.5 CCCATTGAGCTCTTTTTGGA    GTGAAGCTCACGCATTTTCA    V-4L21
139 F12 V   K12B6.6 ATATGCGTTCTGATTTGCATTCT TCTTACCTGATTACGCTCATGGT V-4L23
139 G02 V   K12B6.8 AATTCGCCACGTATTTCCAG    TGATTCCCGGACTTCAAAAG    V-4N03
139 G05 V   T28C12.3    ATTTTACGCGTTCGAGAGGA    TCACGAGTTCATTGTTCCGA    V-4N09
139 G06 V   T28C12.4    TTCCACTTGCTCCAGTTATTGAT CGTGTAAAACTATAGGCAGACCG V-4N11
139 G08 V   T28C12.6    CACTACGGCAATCGCTATCA    ACTTGCTTCTCGCGATGTTT    V-4N15
139 G10 V   F13H6.2 CCGATAAACTTTTGTTATCAGCG GTGGTGAGACGTTTCTTCAAATC V-4N19
139 G11 V   F13H6.3 TGCCGACTTCTTCTTTCCAT    GGAACGGCTCATTGTGACTT    V-4N21
139 G12 V   F13H6.4 TTTCCACATCCCAAAACCAT    CAGGCAGCCATCGTTAGAAT    V-4N23
139 H01 V   F13H6.5 CGTTGTGGCAACTGTCATTC    CAATACGCCGTACCACCTCT    V-4P01
139 H03 V   F57F4.2 GGTATGACTTGGTTTCAGGATCA TAAAAGAGTTCCTCGTCTTCGTG V-4P05
139 H04 V   F57F4.3 TTTGCAGTTGTCGTAGAGTTCAA GATGTTGTTGTACCAATGGACCT V-4P07
139 H05 V   F57F4.4 TTTGCAGTTGTCGTAGAGTTCAA GATGTTGTTGTACCAATGGACCT V-4P09
139 H06 V   T05H4.1 AATCTCTCTCCAACAGAATGACG AAACTTTTTCAGTCGCTTCTCCT V-4P11
139 H07 V   T05H4.2 TCGATCCCAAAATTCAATGTATC AATTGAGCCAGACGAACAAAATA V-4P13
139 H08 V   T05H4.3 AGAGATGGAACGGCTGAAGA    CGAGGGCAGTTAGTCGAGTC    V-4P15
139 H09 V   T05H4.4 CGCCTTTCAGTAGTTGTCCATAC TGCAAAACAATGAGAAAGTTGAA V-4P17
139 H10 V   T05H4.5 CACTTCCGTTGATTGAAAAGTTC CATCGTCTTCTTTTCAAAATTGG V-4P19
139 H11 V   T05H4.6 ATTTCGCTGATCATTCCACC    GACGATTTCCAAAGCTGCTC    V-4P21
139 H12 V   T05H4.7 AAACAGTCCGAAAATGGCTG    GAAAGTTGGAGAGCACCTCG    V-4P23
140 A04 V   T05H4.11    CATTGTAGTTGTTGCTTCTGCTG ATGGCATTCATCTTATGATCTGG V-4B08
140 A05 V   T05H4.12    AACAAAAACGTTCATTCGGTCTA CCTCCCCTCTCTTGAGTATGTTT V-4B10
140 A07 V   T05H4.14    GGGAGAATCCGCAATCAGTA    GCAGTCGGTATCGGTGTCTT    V-4B14
140 A09 V   ZK40.1  GTCTTGCTGTTCCTGAAGCC    GCCCAGTAGAACATGAAGGC    V-4B18
140 A10 V   W01A11.1    CCCCCAATTCAAGACTGAAA    GGGAGACCTCGATTGGTGTA    V-4B20
140 A11 V   W01A11.2    AGAAATGAGACTCCGGCTGA    GTCGGTTTGGGTGACTCTGT    V-4B22
140 A12 V   W01A11.3    TTCACCTTTCCCTCCCTCTT    ACTCCATCTCATCCGCAATC    V-4B24
140 B01 V   W01A11.4    TCTACACTTTGCAAGCATCTGAA AGAAGTGTGTCTGATACCTCCCA V-4D02
140 B03 V   W01A11.6    GACCCACACATCCCTAGGTTACT GATCACGTTGTTCATTTCAGACA V-4D06
140 B04 V   W01A11.7    CAAACATTTGGTTTCGATTTCAT TTGATCTTTTCCTCTTTTCCCTC V-4D08
140 B05 V   W01A11.8    ACTCACGACGGGAGGTATTTATT GTTGCGTCGTTGTTTATTTTTGT V-4D10
140 B06 V   F46E10.1    GGAAACTCAACCAGATGACTCAC AACATTTTCTTCTGAATTTGGCA V-4D12
140 B07 V   F46E10.2    CGACCCCACATTACAAGATACAT TACATTCATCAGAGTGCCATTTG V-4D14
140 B08 V   F46E10.3    AGAGCAAATCCAAATGTCAAAAA TTTACCCAAGTTTAAAACGACGA V-4D16
140 B09 V   F46E10.4    ACGTAAAGCCTCCAAAGTCCTAC GTGATGTTATAGGAATGACGGGA V-4D18
140 B10 V   F46E10.5    ACGTACTTTAACTGCTTTCACGC AAAACTTTAGTTTGGAGTTGCCC V-4D20
140 B11 V   F46E10.6    CAAACATTTGGTTTCGATTTCAT TTGATCTTTTCCTCTTTTCCCTC V-4D22
140 B12 V   F46E10.7    GAAAGCACAGAATCAGAGCAAGT GAATCGAACCCAGAGACAATAAA V-4D24
140 C01 V   F46E10.8    AAGCGAGAATCAAGATCAAAGTG TGAGCAGACCCGTAAACAACTAT V-4F02
140 C02 V   F46E10.9    ATGTCGCTTTAATTACGTGTCGT AGATCTTCCAAGCTCGTCTTTCT V-4F04
140 C03 V   F46E10.10   ACATTTTAAGTTTAAGGGAGCGG TTCTCGAAGGAGTTGTTTTTGAG V-4F06
140 C04 V   F46E10.11   TGTGACGCTTTACTCCTTCTCTC TACAAATAGTTACGGTCGCGTCT V-4F08
140 C05 V   K04A8.1 TACGAAATTACTCGGCCCAC    TGTGTCAAGCCATTCGAAAC    V-4F10
140 C06 V   K04A8.2 TAGATCTTCCGGTGACGATAAAA ATTGGAACACCGAGAAACAGTAA V-4F12
140 C07 V   K04A8.3 TCGAAAAGAAAATGAAAATTGGA GGAGAAATTAAATGCACATGCTC V-4F14
140 C08 V   K04A8.4 AGGAAGCTCACCAAAAAGCA    TACAGGGATACCCGGTCTGA    V-4F16
140 C09 V   K04A8.5 TTGGCCACTCTTTTTGTTCC    GATGGGAACATCCGCAATAC    V-4F18
140 C11 V   K04A8.7 TGAAAGGCCGAAAAGACTGT    CGTTCGAAGTGCCCTAACTC    V-4F22
140 C12 V   K04A8.8 ATGAAAAGCTTCACAGATTGCTC ATTGTTTCGAGTTCCCACTGTTA V-4F24
140 D01 V   K04A8.9 ATGAAATTAATCCGTGATGCAGT GAAAAATCTATGGACGAGGCTTT V-4H02
140 D02 V   K04A8.10    CCCTTGGTAAGCAATCTCCA    AATCCAGCTTTTGGTGCAAG    V-4H04
140 D03 V   EGAP9.2 TCGACTGTGTTTGGTGGTGT    CACAACCCGGATGACTAGGT    V-4H06
140 D04 V   EGAP9.3 GTTGTTGGTAAGGTTTGCGTTAG TACAGACAGATTCCCACGAAAGT V-4H08
140 D05 V   ZK1055.1    AAACATCAAGAATGCCGAGG    CTGTGCTTCAGACGAATCCA    V-4H10
140 D06 V   ZK1055.2    ATGAATTTGTTCTCGCAGTTGAT ACCATCGTTTGCGTTTTATGTAG V-4H12
140 D07 V   ZK1055.3    CAATCAAGGATTATTTCCACTGC CATTTTCCCAACGTGTTGATATT V-4H14
140 D08 V   ZK1055.4    GCCGTGCTATTTTTAGACGC    GACGTTGTTTCGGTTGGTCT    V-4H16
140 D09 V   ZK1055.5    AAAATATATGCAATGAGCGAGGA AGGCATTAAATTACCTGCAATCA V-4H18
140 D11 V   ZK1055.7    CGATAAAACGGAAATGGGAA    GTGACTTTGGCTCCACCAAT    V-4H22
140 D12 V   F44C4.2 AGGACGAATTCTCTACGCCA    AGCAATTTCTGCTCGCATTT    V-4H24
140 E02 V   F44C4.4 TTTTCAATCGGGAACCTGAC    GTGCAAAACACATTTGTCGG    V-4J04
140 E03 V   F44C4.5 AGTGATCTCCATCCACGTCC    CAGGTTCCAGTGGTCATGTG    V-4J06
140 E04 V   T10H9.1 ATTTGGGCGTGCAATTAAAG    TGTCCACTAGCCTCGCTTTT    V-4J08
140 E05 V   T10H9.2 GAGACCCGATTGAGCAATGT    TTGAGTTTGAACCACCACCA    V-4J10
140 E07 V   T10H9.4 AAGTTTGGGGGAAAGAAATTACA TTTTTGACTGCCTCTTGGTAAAA V-4J14
140 E08 V   T10H9.5 ATATCCTCCGAGCTCTGCAA    CCTACCCTTTTCCGTGTCAA    V-4J16
140 E10 V   K11G9.1 TATCGCCTTGGAATTCTTGG    TTCTTCCGTTGGCTCAAACT    V-4J20
140 E12 V   K11G9.3 ATTGAATCATTTGGGGGTGA    GTGAACTTTTCCCATTCCGA    V-4J24
140 F01 V   K11G9.4 AATTCACTCAGCAATTTGGAAAA CAAACAGTGTTCCCTACACTTCC V-4L02
140 F02 V   K11G9.5 CAGTTTCAAAGTTTGGCGGT    TCGCTACAACATTGATCCCA    V-4L04
140 F03 V   K11G9.6 GTTAAACGTAGGCACAACCTGAG GCAAAGGATTAGAGTGCTCAAGA V-4L06
140 F04 V   W02F12.2    TATCATCCGTGACAGTTGTTGAG TAGCCTCACGTTTTGATCAATTT V-4L08
140 F05 V   W02F12.3    GCCTGCTGGAAACCAAGTAG    GTCCAGCCAGCACTCTTTTC    V-4L10
140 F06 V   W02F12.4    CATGCATCAGAGCTTCGGTA    GCACGAAAAGATGAGCTTCC    V-4L12
140 F07 V   W02F12.5    TTCCGTTGACTGGAACAACA    AAGGACCAGCTTTTGCTGAA    V-4L14
140 F08 V   W02F12.6    ATTCGATATAACACGTGGGTTTG TCGACGATATTGTTTTTCTCGTT V-4L16
140 F09 V   W02F12.7    TCGTAGTCTGACGTTCAAGCATA TTGGTTTTCCGATAGCTGTTTTA V-4L18
140 F10 V   ZC487.1 GATGGATTTAAACCCGAGCA    CCTCGGCAGATGGAAAATTA    V-4L20
140 F12 V   ZC487.3 CTCGTTCCAAAAAGAAAGTCTCA CAATTCCATCTATTTTTCAGGCA V-4L24
140 G02 V   ZC487.5 TTCGGAAGAAAAGTGACCAGTTA TTATTCCACAAGTGCTTCAGGTT V-4N04
140 G03 V   T25F10.1    TGATACGAGACCTAAACACGTCC GATTTACAATCCACGTTATCCCA V-4N06
140 G04 V   T25F10.2    CGACTCTGTGCGGACAACTA    AAGCATCGTAGCCCTCTGAA    V-4N08
140 G06 V   T25F10.4    TTCGCATAGACTCGGCTCTT    CTCGACGCGTTTGGAATTAT    V-4N12
140 G07 V   T25F10.5    AGAGCGCGAAATCAAACTGT    ATCCAATTTTGAGGTGAGCG    V-4N14
140 G08 V   T25F10.6    TCAGCCTCCTTCTGTCCTGT    TGGCTGAAATCACTGACGAG    V-4N16
140 G09 V   ZC404.1 CATTCTTCCTTTTCCTTTCCTGT AGTTTTCACTTGCATCATCTGGT V-4N18
140 G10 V   ZC404.2 TTAAAAATTTCCACGACGCTTTA CGCATATATCTGCTTTTGTTTCC V-4N20
140 G11 V   ZC404.3 CACTGCAAATTGACGGAAGA    TGTACCGGTGAATCGTCGTA    V-4N22
140 G12 V   ZC404.5 ATTGTCTCAATCAAAGGCGG    AATATGCCAGCGAGGTTTTG    V-4N24
140 H01 V   ZC404.6 TAAGTGTGTTAACGTTGGTGTGC CCTCAAAAATGCTATAAAATGCG V-4P02
140 H02 V   ZC404.7 CGATTACGTGCATCTCTAAAACC TTGCTCCCAATACCTTCACTTTA V-4P04
140 H04 V   ZC404.9 TTGAGCTCCTTGTCCTCGTT    CCTCACGAAAAATCCGAAAA    V-4P08
140 H05 V   ZC404.10    TTCACCGAAGGAATGTGTCA    TTAAACCAGTGGCCAGATCC    V-4P10
140 H06 V   ZC404.11    ACAACCACTCTTCGACCCTG    TTGCTGTTTGTGATTTGGGA    V-4P12
140 H07 V   H34P18.1    GATCAAGCATTACTGACCGAAAC GGCAAATATCTTAATTGTCGCAG V-4P14
140 H09 V   T15B7.2 GCAGGGTAACAATGAGCGTT    GACTCCTCACGGATGACGAT    V-4P18
140 H11 V   T15B7.4 CCCATCGAAGGAAGAGATGA    CTTAGGCAACAGCCTTCTGG    V-4P22
141 A01 V   T15B7.6 TCATAAGAAAGGCCTAAGAGGCT ATTATGAAGAATTCCCTGGTGGT V-5A01
141 A02 V   T15B7.7 AAAAACGGCTTGGACAACAG    TGGACCACAGAAAATCACCA    V-5A03
141 A04 V   T15B7.9 TTAATAGGTTTCGGGGGTTTTTA TTGAACGATTCCAGTTTTTGTTT V-5A07
141 A05 V   T15B7.10    AGTGTCTGAATTTAATGACGGGA ATGCCGTATTTCTGTAGTTTCCA V-5A09
141 A06 V   T15B7.11    CACAGCGATCGTGTTTTGTT    CAATACCATTTCCAAACCCG    V-5A11
141 A07 V   T15B7.12    TCCAAAACCTGGCTTGGTAG    GGGTGTTCAATTGCAGGACT    V-5A13
141 A09 V   T15B7.14    CCTGAATTCGATCCCTCTGA    CTGATCCTACGGTTTTCCGA    V-5A17
141 A11 V   T15B7.16    TCAACTCACGCGGTTGTTAG    ATACGGTTCCGTTGAAGACG    V-5A21
141 B01 V   C55H1.1 TGAATGTCAGCAAGACGAGG    TGGGATTTGTTGGTTGGTTT    V-5C01
141 B02 V   C55H1.2 TTTTGAAGTCCGGGTGAATC    CAATTGGAGCAAACCGTTCT    V-5C03
141 B03 V   T19F4.1 CTGACCAAGTCAGTTTCTTTGCT ATTGCATACCTGCTATTGCTCAT V-5C05
141 B04 V   K11C4.1 ACAATATGACAGCAGCTCCAACT TCTTCTTCATTTCACCAACCTGT V-5C07
141 B05 V   K11C4.2 AACCACCATCGTTTTACTTCAGA TCTGCGTAACACAGTTCAGAAAA V-5C09
141 B06 V   K11C4.3 CAACGTCTTGCTGGACTTCA    CGTGGTTGTCGATTTCATTG    V-5C11
141 B09 V   T07H8.1 GTTGCTGCCCGAAGAATAAG    CATGCTGCGAGGTAAAATGA    V-5C17
141 B10 V   T07H8.2 TCTTTCAGATTTACCCGATTGAA TCGAAAAACTGTCAGAAAATGGT V-5C19
141 B11 V   T07H8.3 ATTTTTCAATTGGACAGCGG    ACATCCGGATTGAACACCAT    V-5C21
141 B12 V   T07H8.4 AGGTGCTTGCAAGTCGTTTT    ATAATTTTGTGGCAGCAGGC    V-5C23
141 C01 V   T07H8.5 TATTTACGATGCTATTAGGGCGA TATATGCAGGCATGAAACAAATG V-5E01
141 C02 V   T07H8.6 TTTCGACTTTTGTTCCACCC    AGCCATGATCGGAATTCTTG    V-5E03
141 C04 V   C33G8.1 CCTGTTGTACCTCCGAAAGC    TTTTTCTCCGCATTTTGTCC    V-5E07
141 C07 V   C33G8.4 AAATCACGTTTCCAACATCAAAC TAAAAATAAGCTTGAAACGCCTG V-5E13
141 C08 V   C33G8.5 TTGCTCTTCATTCCCTGGAC    GGATCCATCTGCATGCTTTT    V-5E15
141 C11 V   C33G8.8 GTAAGTCGCCGATCGAAAAA    GTGGAGCTAACGGAGCTGAG    V-5E21
141 C12 V   C33G8.9 TGCAATTTTATTCCATTGGTTTT ATATCATTCCAAGGTCTTGCTCA V-5E23
141 D03 V   C33G8.12    CGCCGTCAAACAACAGTAGA    TTCCCGCCAAATATTTTCAC    V-5G05
141 D04 V   F20A1.1 AACCAATCGTTTTTGTGTCAAAT TGCCTACCTACATGCCTAAAAGA V-5G07
141 D06 V   F20A1.3 CATTTGCAACCAATACGACG    GCATTTCGATATTCCGTGCT    V-5G11
141 D07 V   F20A1.4 TTAATGCTTCCCGAGGTGTC    ACTTGAAAAATTTGCGTGCC    V-5G13
141 D11 V   F20A1.8 CATCCAAATTCAATGGTGTTTCT TCCAAGGTTTTAGCTCTTTACCC V-5G21
141 D12 V   F20A1.9 TTCTTTGAGCAAATCCGCTT    TCCACGTGAATCCAAACTGA    V-5G23
141 E01 V   F20A1.10    TCTTTTAGGCATGTAGGTAGGCA AACGGGAGCTCTTTTTACATTTC V-5I01
141 E02 V   VC5.1   GGAGTAGTTGACAGACAAATGGG AGTCATGCATTGATTCTGGAACT V-5I03
141 E03 V   VC5.2   ACTTCTCTCAGAGTTTTTCGCCT TTAACCCAACTCACTCAATTCGT V-5I05
141 E04 V   VC5.3   GGAGTAGTTGACAGACAAATGGG AGTCATGCATTGATTCTGGAACT V-5I07
141 E05 V   VC5.4   TTTGTGAAATGTCCTGAACTGTG GACGAATGGGTTCAGTCTGATAG V-5I09
141 E06 V   VC5.5   CTCGTTGAATAGACGGCAATAAC TGAACGTGAAGTAAGGCAGTGTA V-5I11
141 E07 V   T01C4.1 TCAATGGAATGGCATCAAGA    ATATCCACCATTGGAGCAGC    V-5I13
141 E09 V   T01C4.3 TTGCGGATAGTATTGACTAGGGA TTGTTCCCAATTTCACTATTTGG V-5I17
141 E10 V   T01C4.4 CAATAGGACAGAAACCCAGTTGA GTAACCTTCACCGATCTTTTCCT V-5I19
141 E11 V   T01C4.5 AGGTGTACCGAGAATATGCTTCA TCTCTCCATCATGCTTTTTCATT V-5I21
141 E12 V   T01C4.6 ATTTCCATCTTTGCGCAGTT    TTTGTGCGGTGTTTTTACCA    V-5I23
141 F01 V   F10D2.1 AGCAAGGTCCTTTGGGATTT    AAGCGTTGGGTAGAGAGCAA    V-5K01
141 F02 V   F10D2.2 GCCACTATCGCTGATTCATTAAC CATTAATACTTCCAAGTCCAGCG V-5K03
141 F03 V   F10D2.3 TCAAAAATTGTTGCGTTCCA    TCCTACATCAAACCCCGAAG    V-5K05
141 F04 V   F10D2.4 AACAGCTGCAGGTTGTGATG    TCTGATTTCTCGGAAACGCT    V-5K07
141 F05 V   F10D2.5 TTTTACGGGTTGGAATTGGA    GAGCCTATGCGAAAGAATGC    V-5K09
141 F06 V   F10D2.6 AAAAATGCAGTTAGACGGCG    AGCAAGCATTTGTATTGGGG    V-5K11
141 F07 V   F10D2.7 ACTCCATGCATCATTCAGTTTTT GCCAAGTGTAGTTTCAGACTGCT V-5K13
141 F08 V   F10D2.8 ATCCAGTGATGGTAGACGCC    TCAAAGGCAATTGGAGAACC    V-5K15
141 F09 V   F10D2.9 TATGGACAACCAACGCGTAA    GTATCACAGCTGGAGCCCAT    V-5K17
141 F10 V   F10D2.10    ACAACCTCTGCCACCAAATC    CATTCGGCCATTCTATCGTT    V-5K19
141 F11 V   F10D2.11    TTTCTCTGCGTTTTCCGAGT    TTCCAGTCTTCCTCCCAGTG    V-5K21
141 F12 V   F09G2.1 GTGGAATGAAAAGTGCAAAAGTC TACATACTGAGATTTGATGGGGC V-5K23
141 G02 V   F09G2.3 TTGGGACATCAGTTGGATCA    ACTTCCTTGTGGTTCCGATG    V-5M03
141 G03 V   F09G2.4 ACCGGAGCTCATCACATTTC    TCGGCATTTCTTCAACATGA    V-5M05
141 G04 V   F09G2.5 AGACGGGCTCATCTTCAAAA    TTTATTCCGATTCAGGTCGG    V-5M07
141 G05 V   F09G2.6 TGCCCAAAGTGTGTTCTCTG    AATACTGCCGAGCAAAATGG    V-5M09
141 G06 V   F09G2.7 ATGGAACGGTGTAGGGATCA    CAAAAGGGCCCGTTAATTTT    V-5M11
141 G07 V   F09G2.8 ACGCTTTTTCGTGCATCTTT    ATCACGTGTTCCCTGTTTCC    V-5M13
141 G08 V   F09G2.9 GCTCCTCTGGCCTTCTTTCT    ATGGAAGCGAAAAGCTCAAA    V-5M15
141 G09 V   C13F10.1    TCAAAACCACAGAAAACGAGAAT GTGGCAAGATTATGGAAAGAGTG V-5M17
141 G10 V   C13F10.2    TGCGTAAATCGATAAATTTGCTT CTTGTGTCAAAAAGTCCCCATAG V-5M19
141 G11 V   C13F10.4    TGGCTGCTGACTGACGATAC    CGTGGGCAGAGGTTTATGTT    V-5M21
141 G12 V   C13F10.5    GAGCATGTCTCTTTCGAAATGTT ATTTCAAACGACTTCCCAATTTT V-5M23
141 H02 V   C13F10.7    CTATGGGGACTTTTTGACACAAG AACAGTTCTTCCCCTCTAAAACG V-5O03
141 H03 V   C05C8.1 TAACGTGTACGTCATTTCCTCCT CATGAATTCTCGAACTTTCCAAC V-5O05
141 H05 V   C05C8.3 AACCATTTCAGTGACTAAACCGA CATTTCTTGTGTTCAGTGGATCA V-5O09
141 H06 V   C05C8.4 TGGTGTGACAGTTGGCGTAT    ACACTGCTTCTGCTGGCTTT    V-5O11
141 H07 V   C05C8.5 TCATACGAGCAATGACCGAA    ATGGCCATCGATTAGACTGC    V-5O13
141 H08 V   C05C8.6 ACTGCTGAGCTCTCGTGACA    ATGCGGTGAATAGCGGTAAG    V-5O15
141 H09 V   C05C8.7 TATTACCCCGTAATTCGGCA    GCAACCTGTTTGCAAATCCT    V-5O17
141 H12 V   C13A2.2 GTTTGTGTTCAAAAATACTCCGC ATCCATGCTACCTAAAATGAGCA V-5O23
142 A01 V   C13A2.3 ATGATGGAGTTGACAAAGGAAGA AAGTATTGGGGGAATTGAAGAAA V-5A02
142 A02 V   C13A2.4 GTTGGCGAGACCAACAAAAT    TCGTGATGCCCAACTATCAA    V-5A04
142 A03 V   C13A2.5 CGCTCATCGGTTAGTGGTTT    GGTTTACCAGCCCAAGACAA    V-5A06
142 A05 V   C13A2.7 AAGTGCCGTCAAATGAAAGATTA TTCAAGCGGGTCTATTGAAGATA V-5A10
142 A06 V   C13A2.9 TGTATTTCCCGTCTTCGAGC    CCAGCGGTTCAATTTCACTT    V-5A12
142 A07 V   C13A2.10    TTCCAACACCTTGAACACGA    TCTCCATCCGGAATTGTAGG    V-5A14
142 A08 V   C13A2.11    TTTTCTGCAATTATACGCGATTT GGAGAACCGAAATTTGAGACTTT V-5A16
142 A10 V   F07G11.2    ATTTTTCAAGCTTTTCACGATTG TTCGCTATCAGCAACATTAACAA V-5A20
142 A11 V   F07G11.3    AAAAACAATCTTCGCAACCG    TAGAGGGCCAGAATTTGGTG    V-5A22
142 A12 V   F07G11.4    AAATCGCAAAACTGTGGACC    TTTTCGGGGTCATTTGTGAT    V-5A24
142 B01 V   F07G11.5    TTCCAGTTGCATTTTTGCAG    CGGCCGATATCTGTCTGAAT    V-5C02
142 B03 V   F07G11.8    AATCGATTCCACGCTTTGTC    TATTGGCTTGGCTTGCTTTT    V-5C06
142 B04 V   F07G11.9    ATTGTTCCCTTGGTTGCTTG    ACACAAAATCCAAAAAGGCG    V-5C08
142 B05 V   F10G2.1 TTTGTTTCGGCGCTTTTAGT    AAGGGTCTCAATGCAAGTGG    V-5C10
142 B06 V   F10G2.2 GGAATGATGAACGCATGATATTT TTTGTTAGTACCTAAAACCGCGA V-5C12
142 B08 V   F10G2.4 TGAATCGATATTCTCGGCTAGAG ACGCAATCCTTATCTATCACGAA V-5C16
142 B09 V   F10G2.6 TCAGAGGCGTCTTCGTTTTT    TTGCATGCCAAACTGAATGT    V-5C18
142 B10 V   F10G2.7 CTTCAGGCGCACAATGTTTA    TTCGAACTTTCATTCCCTCG    V-5C20
142 C01 V   C03G6.1 GTGACTGGGTCGATCAGAATTAG CCAGACGATGATAGCGTAGACTT V-5E02
142 C02 V   C03G6.2 ATAAACCGAGCGTTTGCTGT    GCGCTTCGTTGAATTCTTTC    V-5E04
142 C03 V   C03G6.3 CTCGCTCATGGACCATTTTT    ATTTCAAGCTCTCCGAAGCA    V-5E06
142 C04 V   C03G6.4 CAGAAAAGAGCACCAACTGTTCT GGCTCATGTTTCTTCATCATACC V-5E08
142 C05 V   C03G6.5 GGGTTTTCTGTTTGAGCCAG    TGATGCAGTCTGGAAGTTGC    V-5E10
142 C06 V   C03G6.6 GTTGGCCGATCTGTTTTGTT    ATATGTCCGAACGCATCTCC    V-5E12
142 C07 V   C03G6.7 CTCGCTCATTCGGCATATTT    AGCCCATTGGCAGAAGTAGA    V-5E14
142 C08 V   C03G6.8 CAGATGAGCCATATTTGCGA    TGATTTTCCAAAAGCCCAAG    V-5E16
142 C09 V   C03G6.9 GCGATTTTTGTGAAACGTGA    AAAGCGGTATCAGGACGATG    V-5E18
142 C10 V   C03G6.10    GAAAGTGCCTGGATGTTGGT    ACAAACTGCCCACGTTCTCT    V-5E20
142 C12 V   C03G6.12    GTCCAGGACCGTCGGTATAA    TGTGTCCCCTGAACAACAAA    V-5E24
142 D01 V   C03G6.13    TGTCGTCACCCGTAGTGTGT    TGGGCATCTGAACAATCAAA    V-5G02
142 D02 V   C03G6.14    AGCCAATGATTCTCCAATGC    GGGTGTTTTGGTAACGAACG    V-5G04
142 D03 V   C03G6.15    AATGGATGCATGACGTTGAA    GGTGGCATTGTTTCGACTCT    V-5G06
142 D04 V   C03G6.16    GCAACAGGATTATTCGGCAT    TTGCACTCATGGCTTGTTTC    V-5G08
142 D05 V   C03G6.17    AGGTCGGTGCTTTTTGAGAA    AGCCAAAAGAAATGCCTGAA    V-5G10
142 D06 V   C03G6.18    TAGCAAAAATTTCCCCATCG    TTCCAATATTTCTGCAGGGC    V-5G12
142 D07 V   C03G6.19    TGGATGGTTATCTTTTGAGAGGA ACTCGTGATGAGATCAGAAAAGC V-5G14
142 D08 V   C02H6.1 TGGACGGAACGGTAGAAATC    ATTTCAAAAAGGACAGCCGA    V-5G16
142 D09 V   C02H6.2 AGTTCGCTTCGAGAACATTGTAG ATTGAAAAGGATTACCCGAAAAA V-5G18
142 D11 V   R13D7.2 TTATGGAAGGAAAATGCTCAAGA TTTATCAAACGTTTTCATCGCTT V-5G22
142 D12 V   R13D7.3 GTTAACCCCGTGTTGGCTTA    TAGCAGCTGGAGTGACATGG    V-5G24
142 E02 V   R13D7.6 CATTGGAACGAGCATTTTACTTC AAACTCGATATGACCTCACCAGA V-5I04
142 E03 V   R13D7.7 AAATCGTCTTGCCTTAATTGACA TAACCAGATAACGTCCTGTTCGT V-5I06
142 E04 V   R13D7.8 AAACGGCGAAAAGGAAATCT    AAAACACAGGGAAGAAGCGA    V-5I08
142 E05 V   R13D7.10    AACGTGCAAACCATGACGTA    CATGTCCCTGCAAATGTCAC    V-5I10
142 E06 V   F18E3.1 ATTTGCCGACTTTTTCATGG    GCTTCGTGGAATTCGTTCTC    V-5I12
142 E08 V   F18E3.3 AAAAAGTTCATCAAGCTTCTCCA ATTTCTCGCATATGCACTTCATT V-5I16
142 E09 V   F18E3.4 TTCTGCAGCACTTGAAAACG    CGGTGTGTACGGTCATTTTG    V-5I18
142 F01 V   F18E3.8 CTAAATCATGTGTCGTGTCCAGA CTCAGCCTGTATTGGAGAAATTG V-5K02
142 F02 V   F18E3.9 TTCCCCAATTTTTCCAATGA    TACAGGCGCATAGGTGACAA    V-5K04
142 F06 V   F25E5.3 TCGATCCGTTGCAATGATAA    AGGTTCCAAATCGCAATCAG    V-5K12
142 F08 V   F25E5.5 ATCGGAATAGCAAGCCAAGA    CGGCTTTTGCAAATTTCTTC    V-5K16
142 F10 V   F25E5.7 TTCGGCAATATGCCCTTAAC    TCATCGGGTCAATTCTCTCC    V-5K20
142 F11 V   F25E5.8 AAGAAGCAAGGACCCCAAAT    TTTGAACCTTGCAGCATGAC    V-5K22
142 F12 V   F25E5.9 GCGAGAAATGGATATAGTCATGC CTCAATTGGAATTAAGCCATCAG V-5K24
142 G01 V   F25E5.10    ACATAGACACCGTAAGCCCG    AATTGAATCCCGCAATTCTG    V-5M02
142 G02 V   F25E5.11    CCCTATGGCAAGTTGACGTT    TGACAGTTCCTGTTCAAGCG    V-5M04
142 G04 V   C18B10.1    CCGGAGTTCGCACAAACTAT    CTCGATGTAGCCTACGGAGC    V-5M08
142 G05 V   C18B10.2    TTGTGTGCCTCCATGACAAT    TTTCCGACATTTTCCTCCTG    V-5M10
142 G06 V   C18B10.3    AACTTTTGAAAACTCCGAAAAGG CATGTACCACAAATATCGGGACT V-5M12
142 G07 V   C18B10.4    AAATCACCTTTGATTGTTCTCCA TGTGTTAAAATAACATCCCCTGC V-5M14
142 G08 V   C18B10.5    CCATTTATCTTGATGCACTCTCC TATCCATGCTTCAGGTGCTATTT V-5M16
142 G09 V   C18B10.6    TCGAACACATCCTCCATCAA    GCGATGCACATAATCGAGAA    V-5M18
142 G10 V   C18B10.7    AGGAAGTGCGAACCATTTTG    TAAATTGGTGGAAAATCGGC    V-5M20
142 G11 V   C18B10.8    AAATTGCACAGATAGCGCCT    TTGCGTGTTTTCCTTGTCTG    V-5M22
142 G12 V   C18B10.9    TATTTTGAGTGCGTGTTTCTTCA CCATCGTCTAGACTCATTCCATC V-5M24
142 H01 V   C18B10.10   TCTGCAACATTTTGAGCCAC    TTGGAGTTACTGCCGGTTTC    V-5O02
142 H02 V   C04F2.1 CTTTTTGTGCTCCTGGGAAG    CGGCATTAGACATTCCGAGT    V-5O04
142 H03 V   C04F2.4 CCTCCTCTTGCAGAAAAACG    TCAAATTCCCAATACCTCGC    V-5O06
142 H05 V   C54F6.3 GCCATTGTGGGAAGAACTGT    TTCGTGGAAGGTTTGGACTC    V-5O10
142 H06 V   C54F6.4 TTCAATGTTCACTTCCATGTGTC CAAAATCAGGATATTGCGTCTTC V-5O12
142 H08 V   C54F6.6 AAACGGGATGAATTTCTCATTTT TTTGCATTACTAGAGAAGAGCCG V-5O16
142 H09 V   C54F6.7 TCGCAGAAACTCAACTCCCT    AAACCGTAGTTTGTCGGCTG    V-5O18
142 H11 V   C54F6.9 AGTGAAATTGCCGATTAGCG    GGCGAAGAAAGTCAAGCATC    V-5O22
142 H12 V   C54F6.10    ATGAGGCTATCAATCGGTGG    GGGATTTGTTGCGACAGTTT    V-5O24
143 A03 V   C54F6.13    GTAAGCTTGATCGCGTCCTC    TCGGTTCCGAAAACTTGTCT    V-5B05
143 A04 V   C54F6.14    TGTCGAACAAATATTCTCCGAGT TTTTCTGCCAAGTAAATCGTCAT V-5B07
143 A05 V   F19F10.1    CCCTGTACTAGTATGTGACCCCA TTGGCTACACAAAAATTGGAGTT V-5B09
143 A06 V   F19F10.2    TACATTTCCCATGTTTCTGCTCT GAATTTTATCTGCCTCCGTTTTT V-5B11
143 A07 V   F19F10.3    TCAAATCTGAAATTACTGGCGTT TCAAATTTTTCACGATATGAGCA V-5B13
143 A08 V   F19F10.4    ATTTACAAGAAATCCTCCTCCGA TGAGGCTTCACTAATCTTTGAGC V-5B15
143 A09 V   F19F10.5    AAGGTTTGGGTGATGTGAGC    TAAACACTGTGTACCGCCCA    V-5B17
143 A10 V   F19F10.6    TCCATTACGAGGATCAGTTTCAT TACGATGAATTTCGCATTTTCTT V-5B19
143 A11 V   F19F10.7    AGTTCCACACACAACTCCAACTT CACCCTGTATGTTATTTTGCCAT V-5B21
143 B01 V   F19F10.9    GCACCAAGTCAGAGGCTTTC    ACAGCGAGAGCCTGAGGATA    V-5D01
143 B04 V   C50E3.1 CCAAAACATAACTCAATCGGAAG TGAATTTTTACAGACCTTTCCCA V-5D07
143 B06 V   C50E3.3 TTCCAAAATTAGTGGAGCTGAAA AAGTATTTGATCATGTGATGCCC V-5D11
143 B08 V   C50E3.5 CTAGACACACTGTTTTTCGGGTT CAAAAGGTTTTGTCAAGTTACGG V-5D15
143 B09 V   C50E3.6 CCCATCGATTCTTCTCCAAA    CGGAGAAGATGACGGAAAAG    V-5D17
143 B10 V   C50E3.7 GGCTGCTTCGATAAACAAGAATA GGATTTGGCAACACCTATGATTA V-5D19
143 B11 V   C50E3.8 TTCACTTTTGGACAGAATGGTTT CCTCCAGTCTTTGTCTAGCTTCA V-5D21
143 C03 V   C50E3.12    ATACCGGTGAACCAAATGGA    GGATGTCAGACGACATGCAG    V-5F05
143 C04 V   C50E3.13    GGAAGATGTGGATGGAGCAT    TCCCAGTCAACTGATCACCA    V-5F07
143 C05 V   F07C4.1 ATAATTTGGTGCTTGTCGGC    CAACACAAAGACTGCAGGGA    V-5F09
143 C08 V   F07C4.4 CTCATGCAAATTCCAGAGCA    AAATGTAGGGGAGGTTTGGG    V-5F15
143 C09 V   F07C4.5 AATCATCCCATTTCTCGCAG    TGTTACTTCTAATGGGGCCG    V-5F17
143 C10 V   F07C4.6 ATCGCTGTTCAAATACCGTTTTA TGAATTGTTTGTTTGAGAAAGCA V-5F19
143 C11 V   F07C4.7 AAAGACCGAGATAAGACAGGAGG AGAGCTCCAAGAACATTATGGGT V-5F21
143 C12 V   F07C4.8 ATTTTCTGCAGGCAAACCAC    AATTCTTGTCATCCCAACCG    V-5F23
143 D02 V   F07C4.10    TGATTTTCTCTGTGCCAACG    CATCATTGTGGAATTGGCAG    V-5H03
143 D04 V   F07C4.12    ATCCCCGAGGAACTGAAAAC    AACTGCACAAAGTATGGCCC    V-5H07
143 D10 V   C12D5.5 CTAAAATTTCAGAATGCTGGTGG TGACATTGAAGAGTAATTGGGCT V-5H19
143 D11 V   C12D5.6 TTTCAGAGTGATGGTGATGAATG TTTTTCCTTTTTGGTTGTCTGAA V-5H21
143 D12 V   C12D5.7 GTCCGATTGCATAGCCCTAA    GGTCGAGCTTCTCACTCCTG    V-5H23
143 E01 V   C12D5.8 AACACCATTCGACGGAACTC    AGTTCAACAAAAACGCGACC    V-5J01
143 E02 V   C12D5.9 AAAAATGGGCAATTGACAGG    TGCCAAGAACATGAGTAGCG    V-5J03
143 E11 V   T05B11.2    ATTTGGATTTGTGTGCTCCC    CACGCGAGAAACAATTGAGA    V-5J21
143 E12 V   T05B11.3    TCTTTCTCTCACTTTCATCTGCC TTGTTTGATTTGTCATCTTCGTG V-5J23
143 F01 V   T05B11.4    GTCCTTCTTCCGGATCAACA    GAAAACAGCCAGCAACATCA    V-5L01
143 F03 V   C26F1.2 CTGTCCTGGAGAGCAACACA    AGCCGAGCCAAAGAATTGTA    V-5L05
143 F04 V   C26F1.3 TGGAATTGCTGAAATAGGAAAGA TCAAAGAACGTCTCCAAAATCAT V-5L07
143 F07 V   C26F1.6 GTGGAATTCTCACGAACTTCATC ATGGATTCTGAAAAGAATTGGGT V-5L13
143 F08 V   C26F1.7 TGATAATTTTCATTGACGTGCTG AAAGCAAAATTGGTGAGAAATCA V-5L15
143 F09 V   C26F1.9 ATTGAACAACAGATAAGGCGAAA GCATTAACGTTGAATACTCAGGC V-5L17
143 F10 V   C26F1.10    TATCCTGTTTTCCCACCACATAC TTCTACCATTACAGTTGCAGGGT V-5L19
143 F11 V   ZK742.1 CAACGATTCCTCACCTGGAT    CTCGTGCATGAACTCGAAAA    V-5L21
143 F12 V   ZK742.2 TTTTAGGTCAAGCCCGAATG    CAGGATGTCCCGATAGGAAA    V-5L23
143 G01 V   ZK742.3 GCAGCTCCATCTTCCAAGTC    AAATACTGCCGTTCTCGGTG    V-5N01
143 G03 V   ZK742.5 ATCATTTCGAAAAGTCTGACCAA GCATCAAATCAACATTCAGATCA V-5N05
143 G04 V   ZK75.1  TCCGCCCATCTGATAAGTATAAA CAAAAACGACAATGATTCCAAAT V-5N07
143 G05 V   ZK75.2  GTCGTCCCATTTCTACCTAATCC TCAAAGGAATTTCATACCGAGAA V-5N09
143 G07 V   C37C3.1 GCAAGAATCTGCTGGGAAAG    TCTCCGACGTCGTTTCTTCT    V-5N13
143 G08 V   C37C3.2 TCCGCCGATGTGTATGTTTA    CTCCCCATGAAATAAGCGAA    V-5N15
143 G09 V   C37C3.3 CGATGTTAATAGATCGCCACTTC TTTAATGCATGCTTGGAAGATTT V-5N17
143 G10 V   C37C3.4 TGAGTACAAGCAAGCGATGG    TCTCCCATTCCGATTGAAAA    V-5N19
143 G11 V   C37C3.6 TTTGTCACTGGAGAATGGAACTT AACATCCGAATTGAGTCTCGTTA V-5N21
143 G12 V   C37C3.7 ACGGTGACGTTCCTCAATTC    CCCCTTTCAAGACGCAATAA    V-5N23
143 H01 V   C37C3.8 CCGATGATCGAACCTGAAAT    CTTGATCGGCAACTCACAAA    V-5P01
143 H02 V   C37C3.9 TGCACGATTTGCAGAGGTAG    CTACTCGGCGCTATGAGACC    V-5P03
143 H03 V   C37C3.10    GCCTTTGAAAGTATATGCACCAG TTTCGAATAGTTCTCAAGAAGCG V-5P05
143 H04 V   C37C3.11    AATTTCAAAACGCAAACTTCAAA ATCAAAAAGCGATCAAATAACGA V-5P07
143 H11 V   F40A3.7 ATGTTCAAGTGTGATATGGACCC CTCTCTAGCAAACTGGTGTTCGT V-5P21
143 H12 V   F26D11.1    AGTCTATTCGGCATCGGTTG    GAAAGCGATGGTTCCTTTGA    V-5P23
144 A02 V   F26D11.3    TCAATTTGCAGACAAGTTTTTCA TGAACAAGAAAAACACAGCAAAA V-5B04
144 A03 V   F26D11.4    CGTAACTCGATTCCAGCCAT    AAAAACGAGAATTCGGAGCA    V-5B06
144 A04 V   F26D11.5    TTTCTCAAACGGCTGATAAATGT ACATTCAATGAGCTCCAATCTGT V-5B08
144 A06 V   F26D11.9    AGAAAACTATTGCATTGTCGCAT AACCTGTTGTGGTATCCCTTTTT V-5B12
144 A07 V   F26D11.10   ATCGAAGGGATTGACTCGTG    TCGAGTCTGGCAACTTTCCT    V-5B14
144 A09 V   F43H9.1 GCAAAACGATTATTTTCAACTGC CTTTCAGCGAGCACTTTTGTACT V-5B18
144 A10 V   F43H9.2 CGACTTGTCCTTTTTCCAGG    TCCTTTGTTCCATCTTTGCC    V-5B20
144 A12 V   F43H9.4 GTTTTTCCGATTCGACCGTA    TTTGACGCCTGGGAATAAAC    V-5B24
144 B01 V   ZC513.1 TAAAGGTTCATCTCTCATTTGGC TGGACTTCCTAACTATTGCCTCA V-5D02
144 B02 V   ZC513.2 AACAAACGAGTTGATGAGTCGAT ATGTTTTTGGATTTCGCTGATTA V-5D04
144 B03 V   ZC513.3 GCATTCTGGTTGGACGATTT    ATTGCAAACGTTCTCCATCC    V-5D06
144 B04 V   ZC513.4 TTTGGGTTGCACGAATGATA    GGCAAGCCATGTGATCTTTT    V-5D08
144 B06 V   ZC513.6 GGGAATCAATTAACCGAGCA    AAACGGACTGATTGGACGAG    V-5D12
144 B07 V   ZC513.7 GGTCGACAGTTCATTTTGATCTC CAACAACAATAAGACCAAACCGT V-5D14
144 B08 V   ZC513.8 ACTTTGGACAGATTCCCTTCTCT ACTTCTTTGCAATGTTTTTCCAA V-5D16
144 B09 V   ZC513.9 GCATTCCAGTAACACTCGCA    AGGAGCCACTTGTTTTGCAT    V-5D18
144 B10 V   ZC513.10    TCAAGAATCTACCGTTGGGC    AGATATGGCGTGTAGGCACC    V-5D20
144 B11 V   ZC513.11    CATGTTTCGCAATACGTTGG    CCCCAAAATTTCACATCTGG    V-5D22
144 B12 V   C09H5.1 TTGAATGATTTTTGATTTTTGGG TGTTTTTAAGAATGGGAGCAAAA V-5D24
144 C02 V   C09H5.3 GGAGAGTGTTGCAACGGAAT    TATGAGGAGTTGGCTGGGAC    V-5F04
144 C03 V   C09H5.4 CAAAGAACCAACAGGGCAAT    ATGCAGGTTTCATAGTCGGG    V-5F06
144 C04 V   C09H5.5 TGTGCCACCTGAAAAGTGAG    CACTTCCCAGTTTTTGGCAT    V-5F08
144 C05 V   C09H5.6 CAGTGCTGGTTATTCTCGCA    CCTGATGCTTGCCTTTTCTC    V-5F10
144 C06 V   C09H5.7 TGAAATTCCTTTCCAAACCG    GACGAAAACGGTGAAAGAGC    V-5F12
144 C08 V   C09H5.9 GTTGATGAAAACCCTTCCGA    ATGCGATCATTTACGCAACA    V-5F16
144 C09 V   F58G4.1 AGCTCCGTCAAGACTTGGAA    AGACACCTCAATTTGGGCAC    V-5F18
144 C11 V   F58G4.3 TCTGGACAGCAGACAGGTACATA GGATTGGATCAACTGAAACAGAG V-5F22
144 C12 V   F58G4.4 ACAATCCCGCCTCTTTACCT    TTCCACCGAAAACTCTTTGC    V-5F24
144 D01 V   F58G4.5 TGTGGAAGTCTTTGGTGCAG    GTTCACCCACGAGGTGCTAT    V-5H02
144 D02 V   F58G4.6 CGACCTGGAAATGTGAATAAAAG ATGACTCGGTTTTTCAGTGTGTT V-5H04
144 D03 V   F58G4.7 AGTGAAATTGGCAATCCGTC    CCCGAAAATTGTTTGGAATG    V-5H06
144 D05 V   D1014.2 AACAATGGCTACATTGGAGAAGA ATCATTTAGCATTCTTAACGGCA V-5H10
144 D06 V   D1014.3 AAGTTTCTCGTGAGCCTGGA    TTGCCACACATTCGGTAAAA    V-5H12
144 D08 V   D1014.5 TCAGGCGATGCTGTCACTAC    CAGAGGAACGCAAACTGTCA    V-5H16
144 D09 V   D1014.6 TGGAACAATAACCGCACTGA    GATTTTCTCCGGTCGAATGA    V-5H18
144 D10 V   D1014.7 GATTCTATCCCAAACGCCAA    TTGTTCCCCTGAATAAACGG    V-5H20
144 D11 V   D1014.8 CAGAAACCAGGAACTGGGAA    AATAACGCGATGAATCGTCC    V-5H22
144 D12 V   D1014.9 CATGAAATTGCCTCTACTGCTTT ACCATAGAAGAAAATGTGCCAGA V-5H24
144 E02 V   F20D6.2 ACATCGCTAGATGGGTCCAC    AGTTGTTGGGCAATCCTTTG    V-5J04
144 E05 V   F20D6.5 TGCACCGCTTCTTGATGTAG    GATCGCTGCGTGTAGTTGAA    V-5J10
144 E06 V   F20D6.6 TCGTTACGGTGATGTTCTCG    TGGTTTTTGGTGCAAAATGA    V-5J12
144 E07 V   F20D6.8 GATGGACGTCTTCTTTCCGA    TCCAAATGGACATCGTCGTA    V-5J14
144 E09 V   F20D6.10    TCGAACCTCGTCGTTCTTCT    GCATATTCCGGGATTGTCTG    V-5J18
144 E10 V   F20D6.11    TCACCCATTGCGAAGATGTA    TATGTGGTAAGTGGCACCCA    V-5J20
144 E11 V   K07C11.1    CAACAACACCATCGTCTACTTCA TGTTACATGAACATTCGCTCATT V-5J22
144 E12 V   K07C11.2    ACGTGTCAGCAACGACACTC    GTCCCGAGGAGAAAAGGAAC    V-5J24
144 F01 V   K07C11.3    CGTTCTTCCAAAACAAAGACAAC TCACACAATTGACTTCGAAAATG V-5L02
144 F02 V   K07C11.4    TCCACAGGAGGATTCCAAAG    GGTGGGCGAGTGGTAATATG    V-5L04
144 F03 V   K07C11.5    ACGATCAGTCTTGGGTTGAACTA ATGTCTGTGGAACCTGGAAGTTA V-5L06
144 F06 V   K07C11.9    TTGCACTGAGTTGAACCGTC    TTGGTGCAGAAAACAGCAAG    V-5L12
144 F08 V   C16D9.1 CCAGGAGACAAATTCACGGT    GCAATCGGTTTTTGAGTGGT    V-5L16
144 F09 V   C16D9.2 CTTCCGCTTCACGTTTCTTC    GATCCTCATGCGATTCCAGT    V-5L18
144 F10 V   C16D9.3 TTTTCCCCCACCATTTTACA    ACTCGACATGCACAAACGAC    V-5L20
144 F11 V   C16D9.4 TTCATTCAGCATCAGTAGGTTGA TTTTTCAAAACCTGAAAAGTCCA V-5L22
144 F12 V   C16D9.5 ATACACTTGAGCACCTGGGG    CCGTAGCAATTCCTCGGTTA    V-5L24
144 G02 V   C16D9.7 GTTCCGAACAGATGTTGGCT    CGTCCGATTCTTGGAATCAT    V-5N04
144 G03 V   C16D9.8 GTTCCAACACGATTTCAGACTTC CCCAGTTTTCAAGTTCAGATCAC V-5N06
144 G04 V   F21F8.1 GGTTCGAATGGTGTCTCGTT    GCATCATCTCCTCAACAGCA    V-5N08
144 G05 V   F21F8.2 CTAAAGGTGGAGTAGCGGATTTT AAGTTCTGGGGTGGTACAGAAAT V-5N10
144 G06 V   F21F8.3 CAGCTGTGTATGCCAATGCT    TAGGAGTCGTCGTTGCTGTG    V-5N12
144 G07 V   F21F8.4 GAATCGCCAAAGATGCAAAT    GGATCTCCGAAAATCCATGA    V-5N14
144 G08 V   F21F8.5 TAAACAGAAGGTTTGCCCTACAA ATGAAACGCCTCAATCTTACTGA V-5N16
144 G09 V   F21F8.6 TTGCCTGATAAACGGGTCTC    GGTCAATGACTTTGCCGATT    V-5N18
144 G10 V   F21F8.7 GTTGACTGGCTGGATGGAAT    GAGCTGTGTCCCCAAATGTT    V-5N20
144 G11 V   F21F8.8 AAGTGTTGGAAGGACATCGG    CTGGTAGAGATCTTGGGGCA    V-5N22
144 G12 V   F21F8.9 TAGCTCTTCGAAATGCCGAT    ATGGCATATTCTTGGGTGGA    V-5N24
144 H04 V   W02D7.3 TGTTGTCATGTCTTTCCACAGTC ATTCGCTTCTCTTTTTCGTCTCT V-5P08
144 H05 V   W02D7.4 TTTTGGCAGGTGTTTATTTCAGT TGCGTGAACTGTCAAATAAAATG V-5P10
144 H06 V   W02D7.5 ATACCCGATGAGTTTTCAGTTCA CCGGTTGTTTGATTCCACTATTA V-5P12
144 H07 V   W02D7.6 TTTCGGGGTTAGAGTAGCCA    CACAAAGCGAACTCCACTCA    V-5P14
144 H10 V   W02D7.9 TTTCAGCCGAATTCTGATTGTAT GACTTCCAAATTCTCAAATGCAC V-5P20
144 H11 V   Y51B11A.a   AGCATTTTTGACGGATTTTGTAA AAGAAGAACTGCCTTTTCTTTCG V-5P22
145 A01 V   C08D8.1 TTTTCTGGATCGTGTGAGTTTTT CCTGCTGCTCACATTCTTTAACT V-6A01
145 A02 V   C08D8.2 GTGATGATATCCCCGGTTTG    AGCTTCTGAACATGCCGTCT    V-6A03
145 A03 V   F38E1.2 ATCGTGCTCCTTCTTGCACT    ATTGGTCTGAAGTCGGTTGG    V-6A05
145 A04 V   F38E1.3 AAAGCGCTGTAACAAAACGG    TACAGTTTGCCGTGCTTCTG    V-6A07
145 A05 V   F38E1.5 GCATTGCGATTTTGTGTTTG    TAAATGCGACTGTTTCAGCG    V-6A09
145 A06 V   F38E1.6 TCTCTTTTTCAGTTTACCCACCA ATGGAAGTTCTGCCAAAACATAA V-6A11
145 A07 V   F38E1.7 TGGAAGCTCACCGATTCTCT    GTTTGGTGAAGCATCCAGGT    V-6A13
145 A08 V   F38E1.8 GAATTGCAAAGTTACGCATTTTC TTGTATCCTTGAAGCTTCTTTCG V-6A15
145 A09 V   F38E1.9 AGGAGCATTTTTACCCGCTT    CATTCAAAGCCTCTTCCCAG    V-6A17
145 A10 V   F38E1.10    TCCTCATTTTCCTCGCTTGT    TGAATTGCAAATTCGTTCCA    V-6A19
145 A11 V   F38E1.11    CGTTTTGAAGTCTGACGGTAAAC TCCTTGTAACAATCCTTCTCAGG V-6A21
145 A12 V   F52E1.1 TTCCGCGAATTTTTGATAAGTAA CTCGAGAAGAAAAAGAACGACAA V-6A23
145 B01 V   F52E1.2 AACTTCACTCGCGTTTTTAATTG CGGTCCAATTAGTCAAATTATCG V-6C01
145 B02 V   F52E1.3 AGGAAGAGAGAGGCGAAAAATAA CCGAACTAGGAATCAAATCACTG V-6C03
145 B03 V   F52E1.4 TTGCCAGAATGAAAGAGGCT    AAAGCATTTGTGGACCATCC    V-6C05
145 B04 V   F52E1.5 TTAATCGGATTTTTGACTTTCCA ATGGCCTCTTCACTTTCACATAA V-6C07
145 B05 V   F52E1.6 TTTTGCTTCTTCTCCAATGTAGC TCATTTTATTCAACCCGAAAAGA V-6C09
145 B08 V   F52E1.9 TTTCAGGTTTCTTTAAACGTCCA AGAAACCATTTGGGAAACAATTT V-6C15
145 B09 V   F52E1.10    CAAGCCCAAGATCTTTCCAA    GCGAAGACGTCACAAGAACA    V-6C17
145 B10 V   F52E1.12    TGTATCGACCCCTAAGACTGAAA GCTACATTGGAGAAGAAGCAAAA V-6C19
145 B11 V   F52E1.13    TGAACTGCTGTTCCAACGAC    ACCACAATTTGCAGGGAAAG    V-6C21
145 B12 V   T23B12.1    TTGTTCAAAGTTCAATCCGTTCT ACAATTTTGTCGTTCTGTCTCGT V-6C23
145 C01 V   T23B12.2    ATTCTCATCGGCTGTTCAGG    GCCCTGTGCTACACAAGTGA    V-6E01
145 C02 V   T23B12.3    TTCCTTTCATAGCACACGAATTT GCAAATATTCAGTGGATTGTGGT V-6E03
145 C03 V   T23B12.4    AGAACCGAAAATGGACGTTG    GACCGAAAGTTCTCGCAAAG    V-6E05
145 C04 V   T23B12.5    TAGCGGTTGAAATAAACGAAAAA TTTTGAATGCCTACATATCGCTT V-6E07
145 C06 V   T23B12.7    AAACGAAATGAGGTTGTCGG    GGCATATCGTGCACAGTGTC    V-6E11
145 C07 V   T23B12.8    CAGAACATTCACAATCAGTTCCA CGATTCCAAATTAAATTCTTCCC V-6E13
145 C11 V   ZK994.1 CAAAGCCACGGTTCATTTTT    TCCGTGATGTTTCCACTCTG    V-6E21
145 D01 V   ZK994.4 TATCACTCTCCGTTGATTTTGGT TAGCTCAACGGGATTTGTACAGT V-6G01
145 D02 V   ZK994.5 AGTCATGCTCATTCTGCGTG    AGGGATTGACGTTGGAAGTG    V-6G03
145 D03 V   ZK994.6 AAACATCAAACCGAAACTGAAAA GAGAATAAACTGGCTGCTCAAGA V-6G05
145 D05 V   F45F2.2 CAGGTACACAGTTTCCTGGAGTT GCATCTGAATACAATTGAAAGCC V-6G09
145 D06 V   F45F2.3 CAATTGGAATCCGATAGAGACTG TCCTGAAAATAAAATGGCAAAGA V-6G11
145 D07 V   F45F2.4 GCACAGTTTTTCTTGGTCACTCT CCAAAATTTCTCACTTCATTTGC V-6G13
145 D08 V   F45F2.5 CTTTGGAATTGGCTGTCCAT    TATGTTTCCAAATCTCCGCC    V-6G15
145 D09 V   F45F2.6 CGCGGGACAATAAGAAGAAA    AACAGGAAGTTGGCAGCACT    V-6G17
145 D11 V   F45F2.9 AATACGACGTACGCATGAAGAAT TGAGTCTTGAGACCTTTCTGGAG V-6G21
145 D12 V   F45F2.10    ACGATTTTGTACAACCACCAATC ATTACGTGAAATCTGGAGCAAAA V-6G23
145 E01 V   F45F2.11    GCGTGGACTCGAGAAGAATC    CGTCACACCAAACGAAATTG    V-6I01
145 E02 V   F45F2.12    TGAATTGCCTCTGAAAACATTCT TACCATCAACCCATTCCTTACAC V-6I03
145 E03 V   F45F2.13    GAAATTGGTGACGTTTCTAATGC TTGTACTCACTCACTCTCACCCA V-6I05
145 E05 V   F25G6.2 AAATTGCCTGCATCTGTTCC    AGCATCTTGCACATTGCTTG    V-6I09
145 E06 V   F25G6.3 TCACAGATGTCCGTTTTCCA    GCCAAGACTTGTCAACCCAT    V-6I11
145 E07 V   F25G6.4 CCAGTGTCGATTCGGAGTTT    AATAGCCACGGTGACCACTC    V-6I13
145 E08 V   F25G6.5 TACCTTTCCATGATCCTTTCAGA CATTTCTACATCTCGGGAGTTTG V-6I15
145 E09 V   F25G6.6 TACAACTCAAATGGTGGGCA    TTTCAGCACGACGCTCATAC    V-6I17
145 E10 V   F25G6.7 GGAGCCACAGAAACAAGAGC    CCATTGTCTGCATGGTCAAC    V-6I19
145 E11 V   F25G6.8 GCTTTCGAGCTTTCAAATAGTCA TCGACTGGTGTCTCCTATTTTGT V-6I21
145 E12 V   F25G6.9 TCCTCCTTGCCAAAAATGTC    AAGGAGAAACGAGTTGCGAA    V-6I23
145 F01 V   H20H17.1    GGCATAGTGATTTGTCCGCT    CCTGTTTCGTCATCGGAGTT    V-6K01
145 F02 V   C10B5.1 CGCCCGTATCTTGGTTTTTA    AACGGTAGAATCCGATGACG    V-6K03
145 F03 V   C10B5.2 CGGTCTACAAGAGCAATACCAAC ACTGAATCCGACGAGATCATAAA V-6K05
145 F04 V   C10B5.3 GGACTTTTCAGGAAAACTTCGTT TTGTGTGTCCTGGAACAGTGTAG V-6K07
145 F06 V   F41E6.2 AACCTTGAGCCTTTTACCTATCG TGGAACCAGTAAAGAAAACGAAA V-6K11
145 F07 V   F41E6.3 GCCTAAGTACCAGCATCCCA    CCAGTCTTCCTCTGTCCAGC    V-6K13
145 F09 V   F41E6.5 CGGCGATCTTATAGGGGAAT    CACCAGCGGAACCCTTAATA    V-6K17
145 F10 V   F41E6.6 TCCGTCCAAGAGACTATGTCATT CTGTACAATTTGAAGTATCCGGC V-6K19
145 F11 V   F41E6.7 TTGAAGCGGACTACGATAGAAAG AAGACTAGTGATATGCATCCCGA V-6K21
145 F12 V   F41E6.8 GGCAATTATTTTGCTTTGAATTG TAACCAAGAATTTTCATCCGAGA V-6K23
145 G02 V   F41E6.10    TCACACTTGCATCATTTCATTTC AGCAATCAAGGTTACACCACAAT V-6M03
145 G06 V   F41E6.14    AGAATTCCAACCGTGTGAGG    TTTCCATTTTCTCGAATGCC    V-6M11
145 G08 V   F28A12.2    ACGTGACATCACCGACAGAA    ATAGCACCTGGACGTCGAAC    V-6M15
145 G09 V   F28A12.3    CCCAAGCAATTATTCTCAAGCTA CCTCGAAATGCCTTCTAATTTTT V-6M17
145 G10 V   F28A12.4    TTGTCAATTGCAGCTTGAGG    TCTTATTGGGTCTTCGACGG    V-6M19
145 H02 V   ZC190.5 CTCACCGATTTCCTGTTTATCTG TAATGCACCAAGTTTTCCAGAGT V-6O03
145 H03 V   ZC190.6 TTGTTTGTTTCGCCGTGATA    TCACGAGTTCGGTTATTCCC    V-6O05
145 H04 V   ZC190.7 ATAACCGGTTTACTTGCAAAACA CATTCTCATTATGCTCCTTACCG V-6O07
145 H06 V   ZC190.9 TGTGAGCATATCGATCAAAGAAA ATATTAAGAATTCCATGCGGGAT V-6O11
145 H09 V   ZC196.1 TCTGCAACAAATTCAGCGAC    TTACGAATTCTTCGCAGCCT    V-6O17
145 H10 V   ZC196.2 CTGAAACCTGGAGAAGCGAG    GTGGTCTGGCCCTTGAATAA    V-6O19
145 H11 V   ZC196.3 AAGAGTTCAGCTTCCTCCTGACT TAGCTATGTCATGTTGTTCACCG V-6O21
146 A01 V   ZC196.5 CAGGGCCTTCAAGTGGATTA    TCGGAGTGTTTTCTTCCGAC    V-6A02
146 A02 V   ZC196.6 CAGAATCATGAGTACGCCGA    ACCAGCATCATCTGGACACA    V-6A04
146 A03 V   ZC196.7 GCAGTTGCACCACTGACTGT    AATTCGATCTGTCCATTCGG    V-6A06
146 A04 V   ZC196.8 TAGTTTGTGTGTACGTGGGTGAG CTTCGCTCTCCAAAAGTGACTAA V-6A08
146 A05 V   ZC196.9 TTGAACTTCGGTAGGGGTTG    AATTAACGCTGGACGTGCTT    V-6A10
146 A06 V   B0507.1 GCGTCCCAGGTGTAGATGTT    TACGCCATTGAAAAGCACTG    V-6A12
146 A07 V   B0507.2 TGGGGTAACTCAATGCTTCC    GGAAATTGCATGTTTTCGCT    V-6A14
146 A08 V   B0507.3 GTTGAATTGCACGGAACCTT    TGGCGGATAACACCTTTCTC    V-6A16
146 A09 V   B0507.5 TGTTATCTTTTTCTTGCCTGAGC GCAATTGCTGTATTTTTGTGTGA V-6A18
146 A10 V   B0507.6 GTCACAGTTTGCACTCCGAA    AACATGCGCTCAAGCTCTTT    V-6A20
146 A11 V   B0507.7 GATCCATTTGACGAGAAAGTGTC CGGACTAAAAATGAAGTTGATGG V-6A22
146 B01 V   B0507.9 AAGTCCCATTGCTGATTTGG    TTTGACAAACGAACAGTCGC    V-6C02
146 B02 V   C01B7.1 TATCCAACCGATCCAACCAT    CAACGAGTCCAACAAGGGAT    V-6C04
146 B03 V   C01B7.2 CGAAGCAGTTTAAAAGCAAGAAA TAACTGGTCGGGAGAATTTGATA V-6C06
146 B04 V   C01B7.3 TTGAGCATCTTGAGGAAGAAAAG GGGAAGAGTAAAGGGAACAGAAA V-6C08
146 B05 V   C01B7.4 TCCTGCCAATGAATGTTGAA    ACGGAAAATGGAGCAACAAG    V-6C10
146 B06 V   C01B7.5 CTTTTCAAGAACATTGATTTGCC TATTTTCGCTTTCGTTGGAAATA V-6C12
146 B08 V   C01B7.7 GTTGTCAACTGCTGAAACATCTG CTCGTTCTAGAAAAATGCGAAGA V-6C16
146 B09 V   W09B7.a TCACATGCTCCAATTATTCTGTG ATATCCCGATCGATCTTAATCGT V-6C18
146 B10 V   W09B7.b CCACGGATTTTTGATTCATTTTA TGTTCTTGTTATTTTGAGGGAGC V-6C20
146 B11 V   W09B7.c TTGATTATTTTGCCACGGTTTAC TTAAAAATCAACAATGGGGTACG V-6C22
146 C01 V   ZC411.1 GACCAGCATAGTCGCTCCTC    CCGCTCCATTTCATCTGATT    V-6E02
146 C02 V   H14N18.1    GGACAACAGTTCGGAGGAGA    TGGGGAGGTTAGTGGAGATG    V-6E04
146 C03 V   H14N18.2    TCGCCGGTTTTCTGTATTTC    ATAGGCAACCAAATCGTTCG    V-6E06
146 C04 V   H14N18.3    GCTTTCATCGTTCTTACCAAATG ATTCCATTTCATTGTGCTTTGTT V-6E08
146 C05 V   H14N18.4    CTGGGCGGTATCCTTGATTA    TGAACCCACAATCATCTGGA    V-6E10
146 C06 V   T19A5.1 TTTGATCGAAAATCCGAAGG    ATTGATGGTTTTGGCAGCTC    V-6E12
146 C09 V   T19A5.4 ATTGGCCAAGAAGATTCCCT    ATAAAGCTGGGCTGGTGATG    V-6E18
146 C10 V   T19A5.5 TTTCCCCCATTATGGTCTGA    AACTGGAGCAGTGTGTTCCC    V-6E20
146 D01 V   F59E11.3    GTTCGTGTCGATATTCAAATGGT GATAGAAACAGCTGGCACAATTC V-6G02
146 D02 V   F59E11.4    CAACCAGACAAAAATGCCTACAT TGGTAGAAGTAAAGCTAGCACCG V-6G04
146 D03 V   F59E11.5    TCTGATCGGCACAAAAATAAACT CACCACAAAACATCCTACTGACA V-6G06
146 D04 V   F59E11.6    CTTCGCAATATCTTCATTTGACC AATAAAAACTCATTGCCCAACAA V-6G08
146 D05 V   F59E11.7    CCCTCCATTTTGAATACTTTTCC GGCCTCCTGAAATAGAAAGTGAT V-6G10
146 D06 V   F59E11.8    ATTAAAAACCAGGCCACACG    AGAATCGCCGGAAAGAAGTT    V-6G12
146 D07 V   F59E11.10   TCTCAAATCGGCTGTCATTG    CACCTCGTGAGGTTTGGTTT    V-6G14
146 D08 V   F59E11.11   TTGACCCAAAATGAATGCAA    AGATGGAAGGTGAGGCCTTT    V-6G16
146 D09 V   F59E11.12   CACCTGCCATTCCAAAAGAT    AATGTTCCTGTTTTCCGCAC    V-6G18
146 D10 V   F59E11.13   TCAAGTGGAGGATAAACCGC    TTTCCCTGGCATCTGAAATC    V-6G20
146 D11 V   F59E11.14   AACATATGGTCCCAACCCAA    CCTATCGCCGTTTGATGTTT    V-6G22
146 D12 V   F59E11.15   ATGTTGACATAAGGACCGGC    TGCAAAATGGATGTTGGCTA    V-6G24
146 E01 V   F59E11.16   GGACCAAATCCGACTCTGAA    CGTCTCTTTGCGAACAATCA    V-6I02
146 E03 V   R03H4.2 ATCTGCTCGTTGTCATTCCC    TTGTTGCGACAATGTTCCAT    V-6I06
146 E04 V   R03H4.3 TTGAAAAACATCGTGACTTCCTT CTGCAATTTCCACATCACTCATA V-6I08
146 E05 V   R03H4.4 AACCTCCTGGGCAATTTCTT    GCGTTTTGAATGAAGCATGA    V-6I10
146 E10 V   R03H4.9 AAGCCTTGATCGGAAACAAA    AAAAGCCGCTTGCTTATGAA    V-6I20
146 E11 V   C25E10.1    GGGGATGACTGCCGATAGTA    TCGAAACTTGTCACAAACGG    V-6I22
146 E12 V   C25E10.2    ACAAAATACGGGTCTGCGTC    TTGCACCGTCGATTTGTTTA    V-6I24
146 F01 V   C25E10.3    AATTTTTAGGTGGGGGAACG    CACCATGAGCAACAGATTGG    V-6K02
146 F02 V   C25E10.4    TTCAGTTGATCTTCAGTGGGATT CAGATCCAAAAACGTAAAATTGC V-6K04
146 F03 V   C25E10.5    GTAGCATTGCCTACCCAGGA    CCGCTATCAGCATAATGCAA    V-6K06
146 F06 V   C25E10.8    AACGAAAACTTTGTGTACTCCGA TTTTCTTTCTGTGATGGTTCGTT V-6K12
146 F07 V   C25E10.9    TAGCACACAACTCCAGTTTCCTT AGTGTTCCGGCACAATAAATAGA V-6K14
146 F09 V   C25E10.11   GCATCTGGTAGTTGTGAATGTGA CCAAGGTATCAATTGTTTTGGAA V-6K18
146 F11 V   T27E4.1 TTCACAAAACCGAATCACGA    CCGATGAACACGTGAAATTG    V-6K22
146 F12 V   T27E4.2 CTCAATGTTCTGAATGTGAGTCG GAAAACTGTTTGAACGTTCTGCT V-6K24
146 G02 V   T27E4.5 TTTACTGCCAAGGAAGATGAGAG TGTTTCAGGAAATGTTAATGGCT V-6M04
146 G03 V   T27E4.6 AAATTGGGATTTCAACGACG    CAAGGCCCTTATGATGCACT    V-6M06
146 G04 V   T27E4.7 ACTAGACACAGTGAGCGAGGTTC CAATCTAATTTCAGTGCACACCA V-6M08
146 G05 V   T27E4.8 TGTTGTATAGCATGACATCTGGC CTCAATGTTCTGAATGTGAGTCG V-6M10
146 G07 V   F21C10.1    AGACAACCAACACGCAGTTTATT TGATGTGTACAAGTTTCAGACCG V-6M14
146 G08 V   F21C10.2    TCAAACCAAGAAAACAACGATCT ATTCGAGAATGCAATCAGAAAAA V-6M16
146 G09 V   F21C10.3    TCCATTTTCGTCAGAAGTTTCAT TTAACCGGTTTTATATTCCCGAG V-6M18
146 G11 V   F21C10.5    TTCTTGCTGTCGATTTGTGTAGA AAAATAATTGCAAGCTGATTTCG V-6M22
146 G12 V   F21C10.6    TTAGGTCCAAACGAGAGTGAGAG GAGGGTTTGAACATTCTGATTTG V-6M24
146 H01 V   F21C10.7    TTTCTCCAGTTCCGCAAATC    TTGAACCCATCCTTCTCCAG    V-6O02
146 H02 V   F21C10.8    TGGCAACCGATCATTGAGTA    TTGCTTGCTGGAATTGTGAG    V-6O04
146 H03 V   F21C10.9    AGTCACAACCAACAACATCACAG TGTTTCTTTGCTCGACAAGTGTA V-6O06
146 H04 V   f21C10.10   CCAATTTCGTTCCTTCTAATCCT TTCCCAGAAACACGAACTAAAAA V-6O08
146 H05 V   B0222.1 CTACGCATGACACAAAGCGT    ATTGTTGTAAGGCGGTGGAG    V-6O10
146 H06 V   B0222.2 ACTTGCTGGATTGATTTCCG    CGCAGATGATCCAAAGGAAT    V-6O12
146 H08 V   B0222.4 TGCTTCACTTGTCTTGTCGG    ATGGAGGCTGAAGTTGTTCG    V-6O16
146 H10 V   B0222.6 CCTCCTACCGTCAGGACAAA    GAAGTCGAAAAAGGCACCTG    V-6O20
147 A01 V   B0222.9 TTTTGATCCAATTGTCCGGT    GGTTATGGGTCTCATGGTGG    V-6B01
147 A02 V   C24B5.1 AGTTGCATTTTCAACACGTTCTT GAAATACGTGAGCTCCAAGAGAA V-6B03
147 A03 V   C24B5.2 CTACAAGAGCCACAGCACCA    GTGATCAGCTCCTTCCTTGC    V-6B05
147 A04 V   C24B5.3 TTTCTTCGGAATTGTGACCC    CTATTGGTTGGCGTGGAACT    V-6B07
147 A05 V   C24B5.4 AAGGAAGTAAAAGGAAAGACGGA TAGAAACTTCCCCACAAACTCAA V-6B09
147 A07 V   T18H9.1 ACTCGTCCATACGTTGCTCC    TCTTGTGAAGGCACAGTTGG    V-6B13
147 A08 V   T18H9.2 AAACCGATTGATCCGTGAAG    CTCCAACAGCGTCAGCAATA    V-6B15
147 A10 V   T18H9.5 ATATGCAGGCCACCATTGTT    GGCTGGACATTCTGGTGAGT    V-6B19
147 A12 V   T18H9.7 GCGAATCCATTGAGTCCATT    CGACATCGATTCACCATACG    V-6B23
147 B01 V   F07C3.1 TCAATTGGAGCAGATGATGC    CCATCTCCTGGAATTACCGA    V-6D01
147 B02 V   F07C3.2 GTCAAGGTGTTCGTACCTTGTTC GTATGGGTTATCCGATGATCAAA V-6D03
147 B03 V   F07C3.3 TGTGAATCCAAAATGGCAAA    GGCCGAGACTAGAGAGGGAT    V-6D05
147 B04 V   F07C3.4 ATTCTGGTGGAGAACCAACG    TGGTCTTCGGGAAGTCAAAC    V-6D07
147 B06 V   F07C3.7 TGACGATTGAAGTTCCACCA    GTCTCTGCTCATTTGGCTCC    V-6D11
147 B07 V   F07C3.8 AATCATTCCTAGCTCAACACCAA CTGCATTTTCACTTTGGTACTCC V-6D13
147 B08 V   F07C3.9 TAATTTTCGGTCCTTTTTGGTCT GGACATCTTTGACAGAGGACATC V-6D15
147 B11 V   ZK682.2 TCTGCGTTGTGGTTTTTGAG    GCAACGCCTTTATGTCCATT    V-6D21
147 B12 V   ZK682.3 TAAGTCACGAAGAAAAAGAACGG TAATATCCATCCACCCTCACTTG V-6D23
147 C01 V   ZK682.4 TATAAACCGAAAAGCTGGAAACA CTTGTGATGCTTTTCTCACACAG V-6F01
147 C02 V   ZK682.5 CCTTCGAAAAAGTCTGCTCG    CTGCAATCCCGACAATACCT    V-6F03
147 C03 V   ZK682.7 TGACGAAGACGAAGACGATG    TTTCCGGAGAAAGACACCAC    V-6F05
147 C05 V   F44A2.2 TTCGCATGTGAGAAGTCTGG    ACCTGGCGAGCTTGAAGATA    V-6F09
147 C06 V   F44A2.3 CAATGTGAAGAAGCCAGCAA    AGTTGCAGAGCTGGCAAAAT    V-6F11
147 C07 V   F44A2.4 ACAATATGTTCCCGACCAGC    CAAGCCTCGGGTAGCTAGTG    V-6F13
147 C08 V   F44A2.5 GTCAAAAGCTGTCCTCCAGC    CGGGACATTCTCTCTCCAAA    V-6F15
147 C10 V   F44A2.7 GGATGGGCATTTCAGGTATG    TGGGGTTAAAACGAATGGAA    V-6F19
147 C11 V   K07B1.1 TTTAGCTCCATGGGCTGTTC    CATGATGTCGAAAGTGGGTG    V-6F21
147 D01 V   K07B1.3 TACAGCTGCATTAGTTGCCG    AGACATGGGATTGACGGAAG    V-6H01
147 D02 V   K07B1.4 CGTCTTCAAACTTTGGGAGC    CGCCGAGAACAGTGTTGATA    V-6H03
147 D03 V   K07B1.5 TTCTCATGTCAAATATCCCCATC CACATGATTCTTTGCGATTGATA V-6H05
147 D05 V   K07B1.7 CTTTTGCATCCATATCGCCT    AGAACCCGCTCAAACAAAGA    V-6H09
147 D07 V   E02C12.2    TCGGATAGCCTCTTTGTTGG    CCGAAGCATTGATTGTGCTA    V-6H13
147 D08 V   E02C12.3    CGCTTACTCGAAATCAAGCC    CAGTGCGTGGTCCAACTTTA    V-6H15
147 D09 V   E02C12.4    GTGGCAGTCCCAAAGTGAAT    CGTAACGGCCAATTTTTCAT    V-6H17
147 D12 V   E02C12.7    AGTATGTTGCCACGAACTTCAAT CATTTTGTTATGGGACCAACCTA V-6H23
147 E01 V   E02C12.8    GTATGGAATATCGGGATGATTGA GAGACGTTCTTGCATTCAACTTT V-6J01
147 E02 V   E02C12.9    ATCTCATCGATTTGCTTCGG    GATTCCTCTCGTTCGTGGAA    V-6J03
147 E03 V   E02C12.10   TTTTTCGACCTCCGAAATTG    ATGCGCCTTGCCTAATTAAA    V-6J05
147 E04 V   E02C12.11   ATCACTCAAAACAGGAACAAGGA CAAATTAGTATTGAACCATGGGG V-6J07
147 E06 V   F36D4.1 TGAGAATGAAATATTGCGAGGTT TTCAATCGATAAAGGGACAGAAA V-6J11
147 E08 V   F36D4.3 TCATGATGAAAAGCGAGACG    ATATGCAGGCAACTTGGGAG    V-6J15
147 E10 V   F36D4.5 TCCAATATTTGAGGCCGAAG    AGATCGTATCCCCTTTCGCT    V-6J19
147 E11 V   F36D4.6 CACGCTTTACAACAAAACAAACA CTGGATAACAGATTTTGAATCGC V-6J21
147 E12 V   H24G06.1    TCGAATCACCAAAGAAATGAAGT TTTGCAGTTGTTGTGGATCATAG V-6J23
147 F01 V   F07D3.1 TGCTCACTCTCGAATGATGG    CATGTGCCATTAGGAACCCT    V-6L01
147 F03 V   F07D3.3 GGACTGACGACATTCATTTTCTC CGTGTTCCAAAGTTCAGATTTTC V-6L05
147 F05 V   K06A4.2 AGGATCAACAAAATGTAGAGGCA TTTCAACTTTGGTACCTGGAAGA V-6L09
147 F06 V   K06A4.3 TTGTCCTATTTCCCTGACGG    GAAGAAGACCGCTTTCATCG    V-6L11
147 F08 V   K06A4.5 TGGCAGAACCACCTGTGATA    ATGGTCTCCGATTTCATTGC    V-6L15
147 F09 V   K06A4.6 GTAAGAAGACATCGGTCAACGAC ATGCTTCTCGGTGTTAAACAAAA V-6L17
147 F11 V   F11A3.2 ATAACCAGCAAGTGGTTCCG    TGAATTTTGCGAACAAGCAG    V-6L21
147 F12 V   C50F4.1 AAGCTTGCCGCCTACTACAA    GTTTGACGTCATCCGAACCT    V-6L23
147 G01 V   C50F4.2 TCAAACTTCTCACATGGGCA    GGCTTCTTGTGGCTTTTCTG    V-6N01
147 G02 V   C50F4.3 TTGCATACCCGAAAAGGTTC    AACCATCATCTCCCCAATCA    V-6N03
147 G03 V   C50F4.4 AAGTGTGTAGTCCTCTCCGACAA TTTCTGTTATTTAGAGCCCTCCC V-6N05
147 G04 V   C50F4.5 TGGAGGTGAAAGAGAAACAGAAA GGGAATAGGAGTGTTAATGGGAG V-6N07
147 G05 V   C50F4.6 CTCCCATTAACACTCCTATTCCC AGGGTTTTCCTTGAAATTCGTAG V-6N09
147 G06 V   C50F4.7 CCAAGTTTTTGACGTATTTTTCG TATGGTTGGTAGCCACTGCTTAT V-6N11
147 G07 V   C50F4.8 TTGATCAGCGACTGAATTGC    ACCAGTTGCACAACCAGACA    V-6N13
147 G08 V   C50F4.9 TGTCTCCGATTTTTATGCTCAAT TTGACAGCCCTACCTAAAACAAA V-6N15
147 G10 V   C50F4.11    CACGAGCGATTTCTCTTTCC    TCTTCGCAGTTTGTTTGGTG    V-6N19
147 G11 V   C50F4.12    TGTTGCTGTAACCATCCCAA    ATTTCGGCAACAAACGAGAG    V-6N21
147 H02 V   F25B3.1 CAAATGATTCCAGAGCAGCA    CCCTCGTCAAATCCTTCAAA    V-6P03
147 H03 V   F25B3.2 TTTGCCCTGTCATTTTGTCA    ATGTTCCGACAGGGATGAAG    V-6P05
147 H05 V   F25B3.4 AGCTCTTGGTCGGAATTCAA    ACTTGCGTGCCATAAAGGTC    V-6P09
147 H07 V   F25B3.6 CCCTTGTCCAAGTCGAACAT    ACAACCGTTTCTTCTCACCG    V-6P13
147 H09 V   K09G1.2 CTCACGTAACGAATTCGAAAAAC GAAGAGGAGAAGCTCATGTTTGA V-6P17
147 H10 V   K09G1.3 CTTGGAATGTTTGTTTTCTACGC TCCAGAGTTCGTTGAAATTTGTT V-6P19
147 H11 V   K09G1.4 AAAAGTCCCCGTTTATTCCG    AAGAATGGAACCCAGCACAC    V-6P21
147 H12 V   T06E4.1 TCCTTTGCACAGAAGGCTCT    CCCGGAAAGACATTCACAGT    V-6P23
148 A01 V   T06E4.3 AGCAAGGCAATCAGTGTGTG    CCCGAATCGAGCAGTTAGAC    V-6B02
148 A03 V   T06E4.5 AATTGCCTTCAGTTTTCAAACAA TTGTTGTAGCTTTTGTTTTCGGT V-6B06
148 A04 V   T06E4.6 GAGGGCAGACAAAGAAGCTG    CGGTGCTTGACAACTTGAGA    V-6B08
148 A05 V   T06E4.7 CGACCGGTCATGAAGGTACT    ATCATACCCGGATGGTTTCA    V-6B10
148 A06 V   T06E4.8 TAGCCGGATATGAGTAGGAACAA TTGATGTTCTGATCGATGAATTG V-6B12
148 A07 V   T06E4.9 TCTCTTCAGTTTCCATGCTTCTC CGTTTAATCTTGAGCTTTCATGG V-6B14
148 A08 V   T06E4.10    GATTTTCGTAGAAGTCACGCATC CTCCTTACATTCCTTTTCCGTTT V-6B16
148 A09 V   T06E4.11    AATTGCTGCAAATCCTTTGG    GTTTGGTGCTCTTGGTGGTT    V-6B18
148 A10 V   B0331.1 AGGCAAGATCAAAAGGAGCA    GAAATCCTGGAACTGGTGGA    V-6B20
148 A12 V   ZK287.1 ATCCTGCAAAACCAGCAAAG    TTCGTTGATGAAAAGTTGCG    V-6B24
148 B02 V   ZK287.3 TTCTATCTTTTCTCAATTGCCCA TCTCGATTCTCTTCACTTTCCTG V-6D04
148 B03 V   ZK287.4 ATGGCTCGTTTTTGGACAAC    CCTGCTTCCGCTTCAGTTAC    V-6D06
148 B04 V   ZK287.5 GAATTGCAAATAAATTACGCGAG CAATGCTACTTTTGCGCTCTTAT V-6D08
148 B05 V   ZK287.6 GAAAGAATCATCAAAAACGCTTG CAAAAACACACACACACACACAG V-6D10
148 B06 V   ZK287.7 AGCAGCCGAAGCTACCATAA    TCTAAAAACCCAGCGTCGTC    V-6D12
148 B07 V   ZK287.8 GAGACTTTCCCAAAAGAAATCGT CAGAATCCATACTTCAAACTCGG V-6D14
148 B08 V   F40F9.1 GTTAATGCGCAAGGTGGATT    CTTCCTTCGACAAGACAGCC    V-6D16
148 B09 V   F40F9.2 TCATCGATTCTCGATTCTTCAAT TCTTTTTCCCAAAAACAAAGACA V-6D18
148 B10 V   F40F9.3 CAAAACAATGCTGACGAGGA    GTCTTCTCGGTGGCTCTTTG    V-6D20
148 B11 V   F40F9.4 GGTGCATCGATGGCTCTATT    GGCCAACGTTTGATTCATTT    V-6D22
148 B12 V   F40F9.5 TCAATGAACACGAAAGCCAA    CGGTGAATGTGGAGCCTATT    V-6D24
148 C03 V   F40F9.8 GACGTCGTCTTTTCGATGTATTC CTCTTGGCTTTAGTTTCCAACAA V-6F06
148 C04 V   F40F9.9 TTCTGCCATTTGAAAGTGTTTTT TTAACCATTTAACGGAAACGAGA V-6F08
148 C05 V   F40F9.10    TGCATCTTGTTGACAGCACA    CAAGTTTTGCTACGATGCCA    V-6F10
148 C07 V   F58E6.1 GAAGGGGATTGGAAATTGGT    GCCAAATGATGTCTCCGATT    V-6F14
148 C08 V   F58E6.2 TGCACAGAAATGTCCCAGAG    TGCATGGAAAAGTGCTGAAG    V-6F16
148 C09 V   F58E6.3 TTGAGGCCTATGTACCCCTG    ACGTTTTCCAGCAAATCCAC    V-6F18
148 C10 V   F58E6.4 TATGTCTCCTGGGAAAAGTTGAA ACCGAGACTACCGTGTCAGTAAA V-6F20
148 C12 V   F58E6.6 ACTTGGGTTGCAATAATCGG    ACCTACAGATCGCCACATCC    V-6F24
148 D01 V   F58E6.7 AAGGATTTGGTTTCTTTCTCCTG TCATAGTGCTTTCTCATTGCTCA V-6H02
148 D02 V   F58E6.8 AAGGGAAAGGTACTCGATCAAAG TCCTCAGTTTCCATTTTCACCTA V-6H04
148 D03 V   F58E6.10    GCGTTAAACATTCCATTTCGTAG ATTACTAAATTGCGCCAAAATCA V-6H06
148 D04 V   F46B6.2 AAAGATGGAGTATGCCACGG    GTAACCCGTGTCAATTTGGG    V-6H08
148 D05 V   F46B6.3 TTTTCTTTTTGCGTCCTGCT    GTTGCGTCGTCTTCCAAAAT    V-6H10
148 D06 V   F46B6.4 GTAACTTTGCCAAGTGGCGT    GTTCGAACCCCTTCTGATGA    V-6H12
148 D07 V   F46B6.5 TGATCCTGCATCATCTCTCG    GTCCCCAGCAACATCAGAAT    V-6H14
148 D08 V   F46B6.6 ATCCGAATCGTTGTCCTCTG    AAACCTCGTTTCGTGAATGG    V-6H16
148 D10 V   F46B6.8 TGCCAGTGATTGGGTTGATA    TTACAGCCGGATTCAGTTCC    V-6H20
148 D11 V   F46B6.9 TGTATATCCTCCCGGCTCTG    CTGTTTCCGACGTGACTCAA    V-6H22
148 E01 V   F46B6.11    ACGTCAACCACACTTTTCATTCT GAAACAATATGAGCTCGGACATC V-6J02
148 E02 V   C50C10.1    TGGCTCCAAAACAATTCCTC    TTCGGTGTAGCTCGGAACTT    V-6J04
148 E03 V   C50C10.2    CGTTTCAAGGAATTCTCCCA    TACCAATATGGGCGGTTGAT    V-6J06
148 E04 V   C50C10.3    TTATTCCCCGCAAATCAGTC    TTGTGACGAACGTCTTGGAG    V-6J08
148 E05 V   C50C10.4    CTGCAGGCGTTTATTCCATT    CTTGATGCACCGCTAGGTTT    V-6J10
148 E07 V   C50C10.6    GGAAAAATGAATGCCATGCT    GCTCACTGAAGAGTGGCTCC    V-6J14
148 E08 V   C50C10.7    AATGGATCAATTGCGGGATA    TGATTAGCGAATCCCGTAGG    V-6J16
148 E09 V   R07B5.3 AAAATGGCCGCATAATCAAG    AGCCGTAACAATCAATTGGC    V-6J18
148 E10 V   R07B5.4 TGAGCTCGAGCATCTAAGCA    AGCCAGCACACGTTTTTCTT    V-6J20
148 E11 V   R07B5.5 GGGATTTTTGGAAACGTCAA    AAAATTCAGCTGCCTCCAGA    V-6J22
148 E12 V   R07B5.6 TCAATTCACGGAATGCAAGA    TGACGATTCTGCTCGTTTTG    V-6J24
148 F01 V   R07B5.7 TCTCCAAAATGGGATTCCTG    CCCTTGTGTTGCAGCAAGTA    V-6L02
148 F02 V   R07B5.8 TTATGGGAAAGAGGTGGTGC    AAAGCTTCGTTGTCAGCGTT    V-6L04
148 F03 V   T11A5.1 CGATTGGGTTAAATAACTCACCA GAAAAGACTTCGTGACAGCCTAA V-6L06
148 F04 V   T11A5.2 GGCGTACATATCAGGCGATT    GGCGGTGAAGTAACGTGTTT    V-6L08
148 F05 V   T11A5.3 AGACACAATAGCATACGAGGGAA TGGATTTATGTTGCACTGTTCTG V-6L10
148 F07 V   T11A5.5 GGATCCAATATATGGGCGTG    CTGTGTAACGTGGCTCCTCA    V-6L14
148 F08 V   T11A5.6 ATCCATCCAAAATGCTCCAG    CAATGCAACAAGCCTTCTGA    V-6L16
148 F09 V   C50H2.1 GTTCTTTGGATTTACGGCCA    GACCCGCAATCAAGAAATGT    V-6L18
148 F10 V   C50H2.2 CACCGATCAAGGAGCAAAGT    TCTCCAAACAGTCATTCCCC    V-6L20
148 F11 V   C50H2.3 CCAAATATGTTGGGATTTACACG TTCATGGAAACAACTGTGACAAG V-6L22
148 F12 V   C50H2.4 TTCTTGGTCGTGAAGCAATG    AGAACGTGCACCGCTATCTT    V-6L24
148 G04 V   T07C12.1    CCTACTGGGGGCTACATTGA    GTCGGCTCTCAAAAATCGAG    V-6N08
148 G05 V   T07C12.2    TTGAATTGAAAGGAGAAGCTGAG CTGGAAATTGGTAACAAAACTCG V-6N10
148 G06 V   T07C12.3    AACGGGCATTGTTTCTTTTG    GATGCACGTTTCTGCTTCAA    V-6N12
148 G07 V   T07C12.5    ACGGAGCCTGGAACTGACTA    TTTTACCATTTTTCGGGCAG    V-6N14
148 G08 V   T07C12.6    TAAAATCGCTCCGTTCTGCT    ATTCTTTCTTGAATCCGCGA    V-6N16
148 G09 V   T07C12.7    TATGAGCCGTAATGTTCAGTGTG AAACCCTTGTGTGCAGTATTGAG V-6N18
148 G10 V   T07C12.8    GGCAACACTTTGCGGTTAGT    CCTGCTACCTCTGCTTCACC    V-6N20
148 G11 V   T07C12.9    GCTGCACCATGTCTCTTCAA    CATTGTTTCTACGGCGGTTT    V-6N22
148 H01 V   T07C12.11   TCGATTTCAGAAAGTGGACGTAT CAACTTCATAGTTTAATTCGGCG V-6P02
148 H02 V   C27H6.1 ACAACGCTGGGTTGAAAAAC    GAGCCTATCGACCAGTCTGC    V-6P04
148 H03 V   C27H6.2 AACATCTCCTTTCGGCATTG    TTCCATTGCTGTTTGTCTGC    V-6P06
148 H04 V   C27H6.3 CTTCTTGATGCTCTTCTTGGAAA TCTGGAATCAAATTGCTTGTTTT V-6P08
148 H05 V   C27H6.4 TCTGGTGCAAAGTGACATCC    TCGATTTGTGATGCCAGGTA    V-6P10
148 H08 V   K08H10.3    AAATCGTGAAACATCAGAGCAAT TAAAGCTTTCATTTCAAATCCCA V-6P16
148 H09 V   K08H10.4    TCATAAGCCAGCAGCACATC    GCAATGCCGCAAAACTAAAT    V-6P18
148 H11 V   K08H10.7    CGACATCTGTTTCAGCAGGA    GAAAACAGAGGAGCGCAATC    V-6P22
148 H12 V   K08H10.8    AATGAATCCGGAAATGTGGA    CTCTGCAGGTGATTTCACGA    V-6P24
149 A02 V   T06E8.1 CAAATGAACAAATTGTGACGAGA TTCAGAACTTCGAAAATGGAGAA V-7A03
149 A03 V   T06E8.2 ATTGAGCCAGCTGACTGACTATC AATGGGTCTTATCAAGGAAGAGC V-7A05
149 A04 V   F57A8.1 ACATTTATTGGAAAGGCTGGATT TCAGGAAAAATGGAGAACAAAAA V-7A07
149 A05 V   F57A8.2 TATGTCGAATACGCCAACGA    GAAACGACTGGAACACGGAT    V-7A09
149 A06 V   F57A8.3 ATTTGGGCAACCATCACACT    CCTACCATACCCCCTCCAAT    V-7A11
149 A07 V   F57A8.4 AGGTGTTGCAATTCTGAGGC    AGTTTTTGCATGAAGGTGGG    V-7A13
149 A08 V   F57A8.5 CTTTCTGGAGCCGTTTGTTC    TAAATCTGAATTGGCCCTCG    V-7A15
149 A10 V   F57A8.7 ATGCTCATTTGCATGCTCAC    TAAGAGAATTGCCCCGTCAG    V-7A19
149 A11 V   R04B5.1 AATAACTTTTATTCCACGCGTCC ACAGAGTTCTTGCCTAACACTGC V-7A21
149 B03 V   R04B5.6 CTTTTTGACACACGGAGCAA    CTTCTCGTGTCGGTGATTGA    V-7C05
149 B04 V   R04B5.7 CAGTGGGAAATATTGATTTGGAA AAGGCGCACTATAACGAATATCA V-7C07
149 B05 V   R04B5.8 AAATATATGTGCCGCCCAAG    CCGAACTGCAGAATACCCAT    V-7C09
149 B06 V   R04B5.9 GATTTTTCCAGCCCACAAGA    CAAACTCCCGCGAATATGAT    V-7C11
149 B07 V   R04B5.10    CAATTCATCAGCAATCCTACCAT CGTCAAAGATATGTCAACGAACA V-7C13
149 B08 V   R04B5.11    GAATTTCAGAGTTGAGTCGGATG AATAGGCAAGTATGGAGTGAGCA V-7C15
149 B10 V   C08B6.2 ACTCGACTCGATCAGCCAAT    CGTTTGTTGCATTCAATTCG    V-7C19
149 B11 V   C08B6.3 GATCCCTGTAGTGCCGGATA    TCCGGGCAAATATAAGTTCG    V-7C21
149 B12 V   C08B6.4 CTGCAGGTGTATACTGCGGA    GCACAAGTGCATGGAACATC    V-7C23
149 C01 V   C08B6.5 ATATTGGATTGGCAATGGGA    GTCTTTTGTCCCAAACGCTC    V-7E01
149 C02 V   C08B6.6 CATGACCCATTTTGTGTATCCTT ACGTCACGATTTGAATGAGAGAT V-7E03
149 C03 V   C08B6.7 ATGCATTAACACCAGCACCA    CATCATCATCACCGTTCAGC    V-7E05
149 C04 V   C08B6.8 AGTGCATGCTAGGAGCTCTTTTA CAACTTGGACACATCAAAAATGA V-7E07
149 C06 V   C08B6.10    GAACTAATGGACAAACGAAGACG ATTTCTCAAAGTCCTCTCCATCC V-7E11
149 C07 V   C51E3.1 GCAGGTGGTCCATTGATTCT    GGAAAACGCGAATGAGAAAG    V-7E13
149 C08 V   C51E3.2 CTTATTCTCCCACTCGGTTTCTT ATCAAAAGTCATTGAATTGGCAG V-7E15
149 C10 V   C51E3.4 TACTGCGTGCATCTTTTTGG    CGAAACCATTGTGCTTGATG    V-7E19
149 C12 V   C51E3.6 TTCCTTCCGGTGTTAGGTTG    GTTTTCTGCCCCGTCATTTA    V-7E23
149 D01 V   C51E3.7 CATGAATGCATTACTCACTTGGA CATATCTACTCTGCTTCATGGGG V-7G01
149 D02 V   C51E3.8 ACGCTTCTGGTCGAATGTCT    TGATGCATCGTCAATGTGTG    V-7G03
149 D03 V   ZK856.1 AGCAGGGGAAGATCCACTTT    TGTTCCAGTTAGCGCCTTTT    V-7G05
149 D05 V   ZK856.3 GGCATATCTGAACAGCACGA    ATTGGCACTTATGGCTCCAG    V-7G09
149 D06 V   ZK856.4 TTTTATTATGCATCCTTGTTGCC TCCGTCCAGATACACTAATTGCT V-7G11
149 D07 V   ZK856.5 AATTTGCGTAACATTTCGCTTTA TAATCGAATCATTTGCAGGTTCT V-7G13
149 D08 V   ZK856.6 TAAGCTCCTCCTATTTTCCCATC ATTCACAGAGAATTGGAACCTGA V-7G15
149 D10 V   ZK856.8 ATGGCAAACTGAAAACGAGACTA TTATGCAAAACTGTTCATTCGTG V-7G19
149 D11 V   ZK856.9 TTGCCAGAATTGACATTCCA    TATGCGGGTTACTGGAGGAC    V-7G21
149 D12 V   ZK856.10    GGATAATCGATCTTTGCAAGCTA ATATCTGCTGATACTGATGCCGT V-7G23
149 E01 V   ZK856.11    TATCTTTATGAAATGGACGCGAT CGTCTCGTAACTCGTCTTCTGTT V-7I01
149 E02 V   ZK856.12    AGCTCAAGTCTTCTCGGCAG    CATCTGGAGCAACGCTGTTA    V-7I03
149 E03 V   C12D8.1 AACAAAACGAAAACAAGCAACAT TTATTGGAAAGCAAGGTGACACT V-7I05
149 E04 V   C12D8.4 CAAAGAAATGCAAAAGAAAATCG TCCATATCAATAAAATTCCACGC V-7I07
149 E06 V   C12D8.6 TCCCTGACAATTTGAAGATCAGT TCTCTCAACGTCGTCTCTTTTTC V-7I11
149 E07 V   C12D8.8 ATGCAATCCAGAAATCGAGG    TCGCCAAATGCACTGAATAA    V-7I13
149 E08 V   C12D8.9 CTAACATTTGCTCGACTTCGTCT AACAAAAATGCGTCTTGCATAAT V-7I15
149 E09 V   C12D8.10    GTAAGATGCCTTCAGTGGACAAC CTTCATCGTCGAACCTTCATATC V-7I17
149 E10 V   C12D8.11    GAGACCATCCCTCACGTTGT    TTGCCAAGTTATTCCGCTCT    V-7I19
149 E11 V   C12D8.12    CTCAACTCGACACGGTTCAA    ACTTCGTTCAGCGCTCATTT    V-7I21
149 E12 V   Y22F5A.1    TGCAGATATTGCCGTTACCA    ACATTCACCTGCTACCTGCC    V-7I23
149 F01 V   Y22F5A.2    AGTACACGTATCAGATCCCGAAA CAGCTGAGATCTACGGCTTTTTA V-7K01
149 F03 V   Y22F5A.4    CAACCTTTTCGTTGGCACTT    TTGTTGCTGCTGATGTCCTC    V-7K05
149 F04 V   Y22F5A.5    ACGTCACGATTCACAACCAA    TGAAGCCAAACCACTGTTGA    V-7K07
149 F05 V   Y22F5A.6    CAACACGAATCAATTTCTTCTCC CTACTCTTTCCCAGCTCCTCTTC V-7K09
149 F06 V   B0024.1 AGTTGGACAAGCGCAATAGG    GCAGGAGCGAGAAAGAGAGA    V-7K11
149 F07 V   B0024.2 AATTCGAGAATTGTCTGCCG    ATTGACCTTCCGTCGATGAG    V-7K13
149 F08 V   B0024.3 CGTGTGTATCCCACGACAAC    AGCTTCCTCCAACATTCGTG    V-7K15
149 F09 V   B0024.4 AAGGTTATTTATGCGGTGGAAAT AGCACTTTGAGCTTGATGAAATC V-7K17
149 F10 V   B0024.5 ACGGGAAGCACATTTGAAAG    TCCAGCATGGGAAAGAAAAG    V-7K19
149 F11 V   B0024.6 AACAAATCCATTTCTTGCCG    CCTCCTGGGAACGTATTTCA    V-7K21
149 F12 V   B0024.8 GGAAGGCAAGCTCATCTCAG    AAGCAGGAAGCGGTGTTCTA    V-7K23
149 G01 V   B0024.9 TAAGCTTGGATCATTCTTTGCTC TTGCTTCGGTGAATTTTTAATGT V-7M01
149 G02 V   B0024.10    CGACTGGGTCTTCTTCTTGC    TTCACGAGCGAGTTCAAAGA    V-7M03
149 G03 V   B0024.11    AATTGTTCCGAATCGTCAGG    CGAATTTGGATTGACCGAGT    V-7M05
149 G04 V   B0024.12    TGAAAGAAATCAGACCAAACGAT TTTCTTTTGATTTCACAGGTCGT V-7M07
149 G05 V   B0024.13    GCTTGGACTTGCCATTTCAT    ATTGAACCAACCACCAAAGC    V-7M09
149 G06 V   B0024.14    AGACAATGCTTGTGGCACTG    CAATCTGTCGTCCTGCTCAA    V-7M11
149 G07 V   K07C5.1 TCCGAAAAGAAGTTCCGAGA    TTTTCAGGCGAAATGGATTC    V-7M13
149 G10 V   K07C5.4 GCACCAACTTGTTCTCCGAT    GAGCTTGCTTCGTTTGATCC    V-7M19
149 G11 V   K07C5.5 AATTCCGGATTCCAGCTTTT    CTGAAAATTAGGCGCTTTGC    V-7M21
149 G12 V   K07C5.6 AAATGGATTTTCGCGCATAG    TCAGACATCTTCATGGCGTC    V-7M23
149 H01 V   K07C5.7 CAAATCGACCAATGATATGGACT TTAACAAGAGGATTTTGTTCGGA V-7O01
149 H07 V   AC3.5   TGGAAATCATTCGAAAAGGC    CCAACTGGACGGCTATTCAT    V-7O13
149 H09 V   AC3.7   TTCAGACTGCCACGTTTTATTTT AAAGATATCGTCTAGATTCCGCC V-7O17
149 H11 V   F15H10.1    TGTTCCCACCATTCCGTTAT    GACCGAAGATCCAAAGCAGA    V-7O21
150 A02 V   F15H10.4    CCACAGCAATTCGTTTGAGA    AATCAATTTCAGGTGGGCTG    V-7A04
150 A03 V   F15H10.5    TTCAATGCAATTGATTTCGC    TTGTGCTGTGTTGGGTTCAT    V-7A06
150 A04 V   F15H10.6    CTTAAATGTCGCTGTTGGCA    GAAACCGTGATTGCAGAGGT    V-7A08
150 A06 V   Y32F6A.1    ACCGTTCCTTTCAGGCTTTT    GAAGGGTCTCACCTCTTCCC    V-7A12
150 A07 V   Y32F6A.2    CCCACATCCATTTATCCTCG    GAATGGCGTCGTCTTCAGAT    V-7A14
150 A08 V   Y32F6A.3    CCTCAATTTTCAGATCCCGA    ATGTTCCGCGAATTCAAGAC    V-7A16
150 A09 V   F22E12.1    ACCATCAGGGTTTCGAACTG    CTCATGGTGGTCTGGTTGTG    V-7A18
150 A10 V   F22E12.2    CTTCTCCTCAACCCCCTAAAGTA GTTGTTATACGTGCTCTTCCTGG V-7A20
150 A11 V   F22E12.3    GTTTGTGTCAGAACACAGAGCAG TCCAGGGATAGGTCCTAGTTAGC V-7A22
150 A12 V   F22E12.4    GGGGCCCAATTATCAAGTTT    AGTGGATTGAAAGTCGGCAG    V-7A24
150 B01 V   Y32F6B.1    CTGACCTCACATCACATACAGGA TTTTGGTACTTGGAGTTGGAAGA V-7C02
150 B03 V   Y32F6B.3    TCTCATTTCCGAAAAACCAGTTA ATGGATAAAGCTGAGTGTGCAAT V-7C06
150 B04 V   C35A5.1 TTGCAAAATGTTTTCCAGCA    CGATGTTTGGAGACAGAGCA    V-7C08
150 B05 V   C35A5.2 AAATGAGCAGATGGATTGGG    TTGGCAGCTCTCCGTATTTT    V-7C10
150 B06 V   C35A5.3 TATCGGCATGTAAGTGGCAA    GCAAAGTTTTGCCTGGCTAC    V-7C12
150 B07 V   C35A5.4 AAGATAAAGCCACACCGTGC    GTTGGCGTTTTTGTTGGAGT    V-7C14
150 B08 V   C35A5.5 TCGGAAATTTGGAGGTCATC    GCCACATTTCTGGACCTGAT    V-7C16
150 B10 V   C35A5.7 ACTTCAACGTCCAGGAATGC    ACTATCATTCCCAAGCCACG    V-7C20
150 B12 V   C35A5.9 GTTGGAAATGCCAAAAATATCAA GGGCTAGACATATTTCATTCACG V-7C24
150 C01 V   F25D1.1 AGATTCCGTCACATGCAACA    CAGCGTCAACCTTTCTCTCC    V-7E02
150 C02 V   F25D1.2 TTGCATGGAAAAGTGAAAGAAAT GACATGCGTCTTGCTCTTATTCT V-7E04
150 C03 V   F25D1.3 AACCGTGTTCCGATTAATACCTT TGTCATCTCGTATTCAATCATGC V-7E06
150 C04 V   F25D1.4 CGGTTGTAAACATGACGCTG    CCACGGATGAATCGAGTTTT    V-7E08
150 C05 V   F25D1.5 TTGATCCTCCATCAGCAACA    TAATGGAATCGGAAGATCGG    V-7E10
150 C08 V   F32G8.3 ATCGAAACAAATGAGCAACAACT AACAGGTTGTCAAATAAGGGGAT V-7E16
150 C11 V   F32G8.6 AATGTCCAGAATTGAGAACGAAA TTACAGTATCCAGGCAATGAACA V-7E22
150 C12 V   T21C9.1 GTCAATGCTCCAAGACCGAT    CCATTTCACGCTGATGAAGA    V-7E24
150 D01 V   T21C9.2 GAGCAATGAGCAATCGTGAA    GATGGAAGATTGGCTGGAAA    V-7G02
150 D02 V   T21C9.4 AATATTTATTCATGTGGTTGCGG TAAAAATAAAAATTGCCCGAACA V-7G04
150 D03 V   T21C9.5 TTGCATAAATTGTGAAAATCGAA AAAATGGGCTCTTTCTTCCTATG V-7G06
150 D04 V   T21C9.6 CGGAAAGAAAAGCTCTGACG    CCTCCAATCTCGGTGACAAT    V-7G08
150 D05 V   T21C9.7 TCCTGAGACTGGGAAAATGG    AATTGGCTCATCGACCTTTG    V-7G10
150 D07 V   T21C9.9 GAGCTGGAGCAACAGTAGCC    ATCAATGGGCACTTCCTCAC    V-7G14
150 D09 V   T21C9.11    CGTCATTTTTCCTGAATTCTCAC TTCTCCAACTAACGAGGATGGTA V-7G18
150 D12 V   H27A22.1    CTTTCCTTGCTGCCAGAATC    TTGTGGAAACCACATAGGCA    V-7G24
150 E01 V   H09F14.1    GTATCTCCTGATGGGGGTGA    TGGTACAAACGCAAGAGCAG    V-7I02
150 E02 V   C32C4.1 CGACGATCACACATGATTCC    TTCAAATGTGAACCACCCAA    V-7I04
150 E03 V   C32C4.2 GCGGTGGTCACTCTTGATTT    CAAGGACACGGTAGTCACGA    V-7I06
150 E04 V   C32C4.3 AGTTGTGTTTCGGATTTGGC    TTGGAATACACCCCATTCGT    V-7I08
150 E05 V   F29F11.1    TGCCAATAATCAGCGACTTG    AGCTGGATACGTTGGTGGAC    V-7I10
150 E06 V   F29F11.2    TCATCGAGAACACACTTGGC    CAACGTCGAGTTTGCAGAAA    V-7I12
150 E07 V   F29F11.3    GACAAAGATGCCAAATTTACAGG TTTTAGCAGCTGTGCTTAGAACC V-7I14
150 E08 V   F29F11.4    TGCAGAACTGTTGGTCTTGG    CGTGGACATTGTGGATTGAG    V-7I16
150 E09 V   F29F11.5    GCATTTTCCAGACTCGAAGC    TTTCAAAAACCGGTAGTCCG    V-7I18
150 E11 V   C05A2.1 CCCGTACGACTGACGTTTTT    AGGGGAAGGAGGAAAACTGA    V-7I22
150 E12 V   T28B11.1    CCAGCCGATTGATTTCTCAT    TTCTCGTGTTCGAAGTCACG    V-7I24
150 F01 V   ZC302.1 GTGGTCGTCTCTTGGCTTTC    AGCCAGCTCATGACGAATCT    V-7K02
150 F02 V   ZC302.2 GGAATCACCAAAAAGCCTGA    AATTGGGGCTTTGTTGTACG    V-7K04
150 F03 V   ZC302.3 ATTCAGATCTCCTCCTCATCACA TATGCGTTATTCCAAAAGTTGCT V-7K06
150 F04 V   F28H7.1 CAACACTACAAATCCGTTGTTCA ACGCGATCCTTGTCTAAAATGTA V-7K08
150 F05 V   F28H7.2 TTCCGAAGGAGCAAAGGTTA    GATGCAAGCCACTGAAACAA    V-7K10
150 F07 V   F28H7.4 CTTCTTGAGTTGGTACACGCTCT CAGCATGTGTTCACAGTTTTTGT V-7K14
150 F08 V   F28H7.6 CCATGCTTTTGTTTCGGTTT    GGGGATATGCATTTCACAGG    V-7K16
150 F11 V   F28H7.9 TCAGGTTTTAGCGGTGTTCC    TTGCGTTACAGATGCTTTGC    V-7K22
150 F12 V   F28H7.10    GCAATTCCATTTGTTGGACC    CAACAGTTTGCTGCCTGAGA    V-7K24
150 G01 V   F28H7.11    GCCATCTGAGTTTGGTCGTT    TAATTCGACGCAAGCAACAC    V-7M02
150 G02 V   D1054.1 CGATACAAATTTCGTCTACTCGC AGGAGCAAATGAAAAAGAAAACC V-7M04
150 G07 V   D1054.7 ATTATTGGAAATACGCACACACC AACTGGATGAAAACAATTCGAGA V-7M14
150 G08 V   D1054.8 TTGATGGTTTTTAGGTTCTTCCA ATCGTGACATCAAGACGATTTTT V-7M16
150 G10 V   D1054.10    TCAAGAAATGTTTTGGTCACCTT TGTATCATGAGCCTAGAAACGCT V-7M20
150 G11 V   D1054.11    TCTTAGCCAATCGCAGTGTG    GGCGACCATTAAAAAGCTGA    V-7M22
150 H01 V   D1054.13    ATGAGCAGCACAAATTGCAG    CGTAGATTGCCAGTCTCGGT    V-7O02
150 H02 V   D1054.14    GATTTCGCGTTCTTCATCGT    CTGTTTTGCGCTCACAGGTA    V-7O04
150 H03 V   D1054.15    GAAAGGATGCCTTGGTGAAA    GGGGTATTGCAATTGTGTCC    V-7O06
150 H04 V   C29A12.1    ATACGCTTCTGCGGATTGTT    AATTTGTGCAAACACCGTCA    V-7O08
150 H05 V   C29A12.2    AATTGGTGAAAAATCATAAGGGG CTGCTGAGAAACCTGAAAACACT V-7O10
150 H06 V   C29A12.3    TTAATTTTCAGCGAATGCCC    TCCACTTGCAGCTTTGTGAC    V-7O12
150 H08 V   C29A12.5    CATTGCAAATAAGTTTGGCTTTC AAAATGAGAACCAATCGAAGTGA V-7O16
150 H09 V   C29A12.6    CAGATGCAGCTCTATTTCTGGTT AGCCAATGAGATATTTCTCCACA V-7O18
150 H10 V   F53H10.1    TTCTCAAATCACACGTTCGC    CGTCCGGAAGGTGAGATAAA    V-7O20
151 A01 V   F32D8.2 TGCCCGTTAAAGTTCCATTC    ATTGGTTGGATGGACGAAAA    V-7B01
151 A02 V   F32D8.3 CCTTGCCATTCCATTTGTCT    GTTGCGGTGGATTCTGTTTT    V-7B03
151 A04 V   F32D8.5 CGTGTACTCCTCTTGGACAACTT TACTGAAAAGATTTCCCGAATCA V-7B07
151 A06 V   F32D8.7 TGCGCAAAACTTTTTCTCCT    TTGTCCAGCTGCTTTTGATG    V-7B11
151 A07 V   F32D8.8 CTCCAGGTTTCAAGGCACAT    TTTCGCTCTAGCACCCATTT    V-7B13
151 A08 V   F32D8.9 TTGATCGAAGATAATAACGGGTG AGTTGATCAGCCACAATCAGTTT V-7B15
151 A09 V   F32D8.10    CCTTTCTCAGTAGCGGTTGG    ATAAAAACTCCCCACGGACC    V-7B17
151 A10 V   F58B4.1 CATCCAGCACAATCCACAAG    GTGGTTTTCCAAGTCCCAGA    V-7B19
151 A12 V   F58B4.3 CGATTGAGCCTCTCTTTCTGATA AGACTTGGGAACGGTACGATTAT V-7B23
151 B01 V   F58B4.4 CCGTTTGTAATGCTTCTCTGAAC GCTCCAAAAGCTCTTACTCAACA V-7D01
151 B02 V   F58B4.5 GGTTTACGCATCAAAGCCAT    TATCGGGAACGATGAAGAGG    V-7D03
151 B04 V   F17C11.2    TAGTATGCCGACTTGGGAAGTAA CAACAACAACAACATCACGACTT V-7D07
151 B05 V   F17C11.3    CGGCACTTCTTGCATTAACA    TTTAATATTCTCACCGCCGC    V-7D09
151 B07 V   F17C11.5    TCAAATTATGCAGTCATTCCACA AACCATTTCTTGTAAGCGATGAA V-7D13
151 B08 V   F17C11.6    ATTTCAAATGTCGAAAAAGGACA ATTGCATTGCTTCGTTATCAAAT V-7D15
151 B09 V   F17C11.7    GACTAGAGCAAAAGCGGTGG    CAACAAGAAGATGCCGATGA    V-7D17
151 B10 V   F17C11.8    CGGAATCTGATCCAACGAAT    ACTCCGATGAACCGATTGTC    V-7D19
151 B11 V   F17C11.9    GCTCTTCTCTTCGGAGCTGA    CGAAGTCTCCCTCCCACATA    V-7D21
151 B12 V   F17C11.10   AGCTCCAAGATCGGAAGACA    TGCGGTTAAATGCACGAATA    V-7D23
151 C02 V   F53B7.3 TCTGCAACACATCATCACGA    TTTAAAAATGGCCCGAAATG    V-7F03
151 C03 V   F53B7.4 GTGAGTCCAAATGGAAGACTTTG ATAGAAGACCACGGAATCCAAAT V-7F05
151 C07 V   C13G3.3 TCTTTCAAGGGAAGAGCGAA    TTTCCCCAACTTCACGAAAC    V-7F13
151 C08 V   C45B11.1    CGATGAGCATTATTCCAAAAGAC ATGATGCACCATCTCTTGAGTTT V-7F15
151 C09 V   C45B11.2    GCTCGGGTCAATCTTCTTTG    AATCCAGCAATTCTTGTCGG    V-7F17
151 C10 V   C45B11.3    ATAAGTGAGGATCCTGGAACACA TCAAAAACTCCCAATTTTCTTCA V-7F19
151 C11 V   C45B11.4    CGTGCCAAGTAATTCGCTTT    TGTAGCTCAATTGGCAAACG    V-7F21
151 D01 V   T04C12.2    AGTTTTCGAATGGCATACGTCTA CACGGACATTCCATATACCACTT V-7H01
151 D02 V   T04C12.3    CAAAAACCGCATAAGACATTTTC CTTCTTGTTTGTTGTTTTCCCAC V-7H03
151 D03 V   T04C12.4    TTTGTTATTGCCCCAAAAGG    GTCGGTATGGGACAGAAGGA    V-7H05
151 D04 V   T04C12.5    ATTTAAAATCGGGGTGTGAAAAT TTTGACCGATTGGAAATAGTTGT V-7H07
151 D05 V   T04C12.6    TCCCCACGTGTTCTGTGTTA    TAGATCCTCCGATCCAGACG    V-7H09
151 D06 V   Y42A5A.1    ATTTCTTCCTTGCGTTGCAC    AAAACGGCGTAGCTTCAAAA    V-7H11
151 D07 V   Y42A5A.2    TACCGTACCCGTTGGAAAAA    ATGGATCACAACTGGGAAGC    V-7H13
151 D08 V   Y42A5A.3    TTAACCGCCCTTATTCGTTTATT ACACATGGTTCGTATTCAATTCC V-7H15
151 D10 V   H19N07.1    GACGACACGTTCAGTCTCCA    TTTCAATTTTCAGCCAACCC    V-7H19
151 D11 V   H19N07.2    TCCAACTTCATCTGCTAAATGGT GGCTTTTTGTTGTAGAACGATTG V-7H21
151 D12 V   H19N07.3    ATAGCTGCATGCGAGAGATTAAG TGAAGTATCTTATGCTCCCGTTC V-7H23
151 E02 V   C06H2.1 AAAATGGTAGGAGAGCGATAAGG AAAAATCTGAAATCGGTTTTGGT V-7J03
151 E03 V   C06H2.2 ACCTGGAAAAGGATGGGAGT    TGAAGCAGTTGTGGAACGAG    V-7J05
151 E04 V   C06H2.3 ATCAAACAATCTTCTGGGGAACT TAGAGCCGTTCATTCTGAAATGT V-7J07
151 E06 V   C06H2.5 TGAGTCGAGCAACTGTTCATTTA AACATTCTCATGCATACGTTGTG V-7J11
151 E07 V   T19C4.1 TGCAGCTGGAACAATGACTC    AAGGCCAAAATTGTTTGCAG    V-7J13
151 E09 V   T19C4.3 ACGCTTGACGAACACAGTTG    GGGTGTGGCCATTAGTTCAC    V-7J17
151 E10 V   T19C4.4 AGTGCAGTTTTTGTACGAACCAT AGAGTTTGATTCCTCGTTTTTCC V-7J19
151 E11 V   T19C4.5 TGGACCCTTCTCCAAAACTG    GTCGTCGAACGATGATGATG    V-7J21
151 E12 V   T19C4.6 TGTTCTTCTCTTTGTTCTCTGCC ATGTTGTCTGTGCGAATACTGTG V-7J23
151 F01 V   K10D6.1 TCACAGGAATGTAGGTCCCC    CACAGACGGTCTTCGTTCAA    V-7L01
151 F03 V   K10D6.3 TGCTCAAATTGGATAGACTTGGT TGTCTCGCTGTGTTTTCTTTGTA V-7L05
151 F04 V   K10D6.4 TGCATATGCCTGCAGAACTC    TCAAGGGGTAAGACACGGAC    V-7L07
151 F05 V   T19B10.1    CATCCAATTTTCGGCAATCT    ATTCCAACAAGCCCATGAAG    V-7L09
151 F06 V   T19B10.2    GTTTCAAAGGCTATCGCTCG    CACCACAGAAGCGTCCACTA    V-7L11
151 F07 V   T19B10.3    ACAAAATCTCCAAATGAGGGAAT TTGGTTTGAAATTCTTCTTCCAA V-7L13
151 F08 V   T19B10.4    GGGATGAACAGAAGAGATCAGAA AACAAGAAAGCTGGAAACAACAG V-7L15
151 F09 V   T19B10.5    TGCCTCCAAAACCAAGAAAG    TGGAATTGGAAGATGGAAGC    V-7L17
151 F10 V   T19B10.6    GGTTCCCACCAGAGTTTTGA    TTCCACATCTCCATCGTTCA    V-7L19
151 F11 V   T19B10.7    CATGTGCTTCATTAGCGGAA    AAACGGTCTCGCAACAAATC    V-7L21
151 F12 V   T19B10.8    CGATGTGACAGCTCCCTGTA    CAAAACCGGCGTAGAAATGT    V-7L23
151 G01 V   T19B10.9    AGTCGATCCGGCTGTAATTG    AATTGCAAGCCATTTGAACC    V-7N01
151 G02 V   T19B10.10   CTCCCTTGTGAGAATTGGGA    ATTTTCACGCGTTTGAGCTT    V-7N03
151 G03 V   T19B10.11   TTACATGGTTCTCATGAGCCTTT TATTGAGCATGCATACACGGTAG V-7N05
151 G05 V   F07B10.2    TCTCATTATTCGCCCTCCAG    TGAAAACCCACGATGATTGA    V-7N09
151 G06 V   F07B10.3    TGGTTGAATGCCATTTTTCA    GGAATGCATCGGCTTTACAT    V-7N11
151 G07 V   C03E10.1    GAAAACAAGCCTTCAGGCAG    TTTGTTCCCATCCAGCTTTC    V-7N13
151 G08 V   C03E10.2    ACTCTGTTTGTTGCACTGGATTT AGGTTGCAAGGAAATGACAATTA V-7N15
151 G09 V   C03E10.3    GGCCAATTGGGTACAATCAG    AAACCGGATTACGTGCACTC    V-7N17
151 G10 V   C03E10.4    CGAAAAATCTACAGCCCTCG    TTGTCGGGAACAGAAGATCC    V-7N19
151 G12 V   C03E10.6    TGAACTTGGATATTGAGTGCAAA CGTAGATGTAATCTGGCGGATAG V-7N23
151 H02 V   T03F7.2 GTTTCACTACATTCGTCCTCGAC ATTGCATTATTTTTAAGACGCCA V-7P03
151 H03 V   T03F7.3 GATTAGAATTGTCAGCAGGGTTG AGGGGTCTTGTTGGTGATTTTAT V-7P05
151 H05 V   T03F7.5 AATCAAATTGAGTGGGCGTC    GTTCGTTGGAGGGAATTCAA    V-7P09
151 H06 V   T03F7.6 AGGTCTGGTGACTAAAACGATCA TTCTAAAACATGCGCGATAAACT V-7P11
151 H07 V   T03F7.7 AGATGTGGAAAAGACACGCC    CAACGTCTCCACTGGTTGTG    V-7P13
151 H09 V   F47G9.2 GCATGCAAAAATAGTAGGAAACG GACTTCATTCTCCACCAGTTCAC V-7P17
151 H11 V   F47G9.4 AGTTCCACCGGGACTTCTTT    TTGGATGTCCGGTTTAGTCC    V-7P21
152 A01 V   F47G9.6 TCGTGGATTCACAATGGAAA    ATTAGAGGCTGCTTGGCAGA    V-7B02
152 A02 V   T02E9.1 AAACTACTCGAGTCAGCGAATTG GCAATATGTCATCCGGAAATAAA V-7B04
152 A03 V   T02E9.2 ATTGCACTTGGAACACTGTTTTT AAAGTAATTGGCATTTGGGTTTT V-7B06
152 A04 V   T02E9.3 CGTGATCAAGTGCGAGAAAA    TCAGGGGAATGTCCTCCATA    V-7B08
152 A06 V   F55C10.2    TTGCATTCTCTGTTGTTGCC    ATTGCCAGAAACGATCCAAC    V-7B12
152 A07 V   F55C10.3    TTTGTTTTGAACATAGGTGGAGG TCGGTATGCATTACTCTTCCAAT V-7B14
152 A08 V   F55C10.4    TCTCATTCCAAACAATGCCA    TCCCTTGTTTCCTGAACAGC    V-7B16
152 A09 V   K03B8.1 GGAACCCGTCAGAAAAGACA    CTTGTTGGATGGGTCCACTT    V-7B18
152 A10 V   K03B8.2 CCGAAAAGATGTGGACGAGT    GCGCAGTGATCCACAAGTAA    V-7B20
152 A11 V   K03B8.3 GCTGCGAGTTTCCTAATGGA    AAATGCATTCCGAGCATTTC    V-7B22
152 A12 V   K03B8.4 AAGACAAATCGCAACTGAATCAT TATCGAACAGATCAACGAACTGA V-7B24
152 B01 V   K03B8.5 GGAACACCAGCATCCGTAGT    CCTTCTGGCGTTATGACACA    V-7D02
152 B02 V   K03B8.6 ATTTTTCCGTGCCCTCTCTT    CCAGTAGATCCCTTGGCAGA    V-7D04
152 B03 V   K03B8.7 AAAAGGGGTCAAACGGATTC    TTCCTTGTTCGCAGCTTTTT    V-7D06
152 B05 V   K03B8.9 CAGTTGCCAAAAACTCCCAT    CCCGTACGATCGACAAAACT    V-7D10
152 B06 V   K03B8.10    TGCTCTTTCTCAACGTGTGG    TCTCTATTGGAATCCGGACG    V-7D12
152 B07 V   T26H10.1    AGGTGTTAATGGAGGAGGAAGAG TTTTAGGTCTGCACAATGACCTT V-7D14
152 B08 V   F57B7.1 GTCATCCGAAACATTGGTCC    ATGAACAACATGAACCGCAA    V-7D16
152 B09 V   F57B7.2 TTCGGAATGTTCTTTTTCGG    TCATGTGAGACTGCTCTCGG    V-7D18
152 B10 V   F57B7.3 AAACAGTCAAGCCATGAAACAAT GCGCATTGTCGATATAAAAAGAG V-7D20
152 B11 V   F57B7.4 GCCCAGACATTTATGGCATT    ACTGGAATCACCATTTTCGC    V-7D22
152 B12 V   T11F9.1 GAAAAATCGGTGGCTTTCAA    TACAAGTCGCCGAAGAATCC    V-7D24
152 C01 V   T11F9.2 ATTGTTCCGTCTGAACCACC    CCAGAATACTCTCGGCCAAA    V-7F02
152 C02 V   T11F9.3 CGATGCGTGCTGTTATCTGT    AAATCATGCATGCACTTGGA    V-7F04
152 C03 V   T11F9.4 ACACTTGAATTGCCCGTTTC    GAATGACATGCATCGGAGTG    V-7F06
152 C04 V   T11F9.5 GCAAATCGGGTTAAGAAAAGTCT GAGAGGACAATTGCATTCAGAAC V-7F08
152 C06 V   T11F9.7 GTCAAGCGCCAAGTATCCAT    TTGCTGCAGATTGCATTAGG    V-7F12
152 C07 V   T11F9.8 AAAATTCTTGTCAATGCCTCAAA TCGAGAACATTCGGTTAAGATGT V-7F14
152 C08 V   T11F9.9 TTGCATTCTCTGTTGTTGCC    CCATGCTCTTTTGGTTGGTT    V-7F16
152 C09 V   T11F9.10    TAGGAAATTCGCCGTCAAAG    GAGCGGAAACCACAAAATGT    V-7F18
152 C10 V   T11F9.11    GGACTGCCAAAAACTCCAAA    TCAACAAGGATGGTGCAGAG    V-7F20
152 C11 V   T11F9.12    GGGAAATGAGTTAACGGCAA    ATCTGAGTTGGATCGATGGG    V-7F22
152 D03 V   C55A6.2 TCCAAGTCTTGCCTGTGATG    TGGTGGAAAATCAGTGGTGA    V-7H06
152 D06 V   C55A6.5 TGTCTTTGGGGAGAACTAATTGA GCTGTGGTCTCCTACATTTTGAC V-7H12
152 D07 V   C55A6.6 TACCGAAAATGATGGGGAGA    CAAATCGTGGAATCGGACTT    V-7H14
152 D09 V   C55A6.8 GAAACAAACAAAATGTCATCCGT GCACAATTTGTCCTTTTTCGTAG V-7H18
152 D10 V   C55A6.9 CTGCTGCCATTTATCGAGATTAC GTCTCCTGAAAAATTGCATGTTC V-7H20
152 D11 V   F38B7.1 AGCACCACCACCAAAGAATC    TGACCATTTTGATGGCAAGA    V-7H22
152 E04 V   F38B7.6 GCAAAAGAGAGTTCAACTGGAAA CACCAAAATTGCATTGTCAACTA V-7J08
152 E05 V   F38B7.7 TAAACCGGGATAATTTTTGTGTG CACAATGTTCACAGGATTCTCAA V-7J10
152 E06 V   H12C20.2    GTGGTTGAATTGACCAATGATTT AGGTCTGCAGTGTTATCAACGAT V-7J12
152 E07 V   H12C20.3    TAAATGTTTTATTGACAGCCGGT AATGGGGTACCTTGTAGGTTCAT V-7J14
152 E08 V   H12C20.4    TCGCCAGTTGTTGAGTCTTG    CGACGCTGTGCTAATTTCTG    V-7J16
152 E10 V   F43A11.1    CCATTTTTCGCACACTTTGA    GGGCTGTCATGATTGGAACT    V-7J20
152 E11 V   F35B12.1    TTGTCTGCCACGTCACAAAT    CGAAAGCAGCAATCAGAACA    V-7J22
152 E12 V   F35B12.2    TTGCATCCCATCCACAGTAA    TATTTCCAGGCAGCCAAAAC    V-7J24
152 F01 V   F35B12.3    CACAATTTGTCACTGGGTAAACA TATATTCTTGGCAAGGAACGAAA V-7L02
152 F02 V   F35B12.4    TGCCATACATGAGTTGTAGTTGG ACACAGATAGACAGCGAGACACA V-7L04
152 F03 V   F35B12.5    CAACGACTGAAGAACAGGCA    GAGTCTCAGGTACCGCTTGC    V-7L06
152 F04 V   F35B12.6    TATAAACTCTGCGATTTTTCCCA TTCGTTTCTCGAATGATGAGATT V-7L08
152 F05 V   F35B12.7    AAAAGCATAGAACACAAATCCGA AGAGTATCGAATTGATTCTGGCA V-7L10
152 F07 V   T27F2.1 CGTTCCCTGAAATTCACGTT    CGCGAACTTTGACTTGTTCA    V-7L14
152 F09 V   T27F2.3 GACGAATTTTACGACTGATACGC TAGATTTTGTTGTCGATGCTGTG V-7L18
152 F10 V   T27F2.4 TTGAAAAATTATGGCAAAGAGGA CATTTTCAGCGAAAAATTTCAAC V-7L20
152 F12 V   F46F3.2 TGACGAGCCATTCGATGATA    ATGACCTTGATGCTTGGGTC    V-7L24
152 G02 V   F46F3.4 TTTTTCACCACCACAACGAA    GCCAAACAGGAAATCGAAAA    V-7N04
152 G04 V   W05E10.2    GTGGGAAACCTCTCGTCTAGAAT ATGCAAAATAAGTTCAATCGGAA V-7N08
152 G05 V   W05E10.3    CCGGATTTGAGACGAACATT    CTCTTCCGACAAGGCAAGAC    V-7N10
152 G08 V   B0240.2 GCAAGGAAACAGCTTTCCAG    ATCGTGGATTGGTTTCAAGC    V-7N16
152 G09 V   B0240.3 GGGCCCAAGGTGATTTTACT    GAAAAATTATGCGGATCGGA    V-7N18
152 G10 V   T04F3.1 ACCATTTTCTGAACCAAGAGTCA TCTGGCATATCAGTTTCCTTCAT V-7N20
152 G11 V   T04F3.2 ATTCCTAAACCAGAAGAACACCC TTGAGGGGGAGGATTAAAACTTA V-7N22
152 G12 V   T04F3.3 TCGAACAAAATGGTTGGTGA    CACCAAATGATGACGAATGG    V-7N24
152 H02 V   F55A11.1    AACATTGAAAACTTTGGAAACGA CCCGTAAATCGACACAAATAAAA V-7P04
152 H03 V   F55A11.2    TTCAGCAGTTGCTCCGACTA    TGACAGAGCACCCATATCCA    V-7P06
152 H05 V   F55A11.4    ATGTTCCATTGGTTTTGGGA    TTGTGCGCGAAATGTATGAT    V-7P10
152 H06 V   F55A11.5    AGAAAGAGACACAGACGACAAGG CCTGTAGAGTCCTCACGAAGAAA V-7P12
152 H07 V   F55A11.6    AGTTTTTGGATCAGCATGGC    ACCATCATGTCAAATCCGGT    V-7P14
152 H08 V   F55A11.7    CGATAGTCGCAAACTCGACA    ACAACCGAAGAGGAGGTTCA    V-7P16
152 H09 V   F55A11.8    CGGGACCCAATCAAAGAGTA    CAGCTGTTTCATCCGATTCA    V-7P18
152 H10 V   D2023.1 GCGGAAGATCATTAGAACACAAC TTATGCTAACAAGGGTGTGAGGT V-7P20
152 H11 V   D2023.2 AGAGATTTTCCTTCGGCGAT    CCACCGATCTTCGCTAATGT    V-7P22
152 H12 V   D2023.3 TTACGTAGGTCGCCTTGAATAAA ACATAATGGAGACAGTCGGAGAA V-7P24
153 A02 V   D2023.5 CGAAATTTTCTTCGGTGCTC    GAACAAGAGGGTTATGGCGA    V-8A03
153 A03 V   D2023.6 AAGTTGCCGATGCAGTCTTT    ACTATCTGAACGGCGAATGG    V-8A05
153 A04 V   D2023.7 AAAGGCACACGTCGTTTTCT    TTTCCATAGCTGTTTTGGGC    V-8A07
153 A05 V   R13H4.1 TGGCTTCAAGGAGTCTGGTT    TGGATGGTTTTCAACGCATA    V-8A09
153 A07 V   R13H4.3 ACGGGCTATACCCAGCTTCT    GGAGTCCCGCATAACTGAAA    V-8A13
153 A10 V   R13H4.6 GTGCGCGTGTTAAGAGACAA    AGAACGAAGCGAAACGAAAA    V-8A19
153 A11 V   R13H4.7 GTACCGCCTACCCAATGAGA    ATTCTTTTGCAGGATGGACG    V-8A21
153 A12 V   K12G11.1    GCTGTGGGATTTCCATTGTT    TCTGCATCACGGAAGTCTTG    V-8A23
153 B01 V   K12G11.2    GCTTCTTCCCAACATTTCCA    GCACCGGTACTGCAAAAACT    V-8C01
153 B02 V   K12G11.3    ACGTATGGCTCGGAGATTTG    ACGGCACGAGAGTTGATCTT    V-8C03
153 B03 V   K12G11.4    GAGAATCCAGCAATTTCCGA    ATCGCCGTCTACATATTGCC    V-8C05
153 B04 V   K12G11.5    CTTTAGAACATGGCCCAATACAG TTACTATTGGTGCTCTTCTTGCC V-8C07
153 B05 V   R31.1   GCTGAAATCATTGCTAATGAACC AACTGCGAAGAGTTGTTCTCTTG V-8C09
153 B06 V   R31.2   GTTCAACGTCGTAGACCATTCTC CGTAGACGTAATAACCAAGACCG V-8C11
153 B07 V   R31.3   TTTCAATTGTGCCCACTAAAATC AAGACATCATTTGGAACTGGAGA V-8C13
153 B09 V   F58H1.2 AACAAAAGATTTGGAGGAAAAGC GAGTAGCTCTGAATGGAAGACGA V-8C17
153 B10 V   F58H1.3 AGACCAACAAGCGGAAAATG    TTTCTCGCTCTTCCTGCAAT    V-8C19
153 C02 V   F58H1.7 GGTTTATTCAGAAGCACACCAAC TCTATTCCACCTCTTCCCTTTTC V-8E03
153 C03 V   C52E4.1 GCACTGAGCACTGGTACGAA    ATTTCAGCTTGGATGGATGC    V-8E05
153 C04 V   C52E4.2 CCATCTGCCAAATAAAAATGTTC AACGCTATATTCCACGTTTTTCA V-8E07
153 C05 V   C52E4.3 CGTACTGATTGGGAGATTTTCTG TTTATTTTTACAGCCAAGCCAAA V-8E09
153 C06 V   C52E4.4 GCCACCTTTCTTCTAGCACG    TTATCACCAGCGACAAGCAC    V-8E11
153 C07 V   C52E4.5 CTGCAAACGTCAAATAGGCA    TGTATGCTTTGACGCAGGAG    V-8E13
153 C08 V   C52E4.6 AAGTGCCGAGCAATTATATACCA TGAGAGAAGTTTATCTTGCCTGC V-8E15
153 C09 V   C52E4.7 GGCACTGTAGAGCTCTGAAACAT TCCTTTTAGATCCTTTGGGTTTC V-8E17
153 C10 V   F57F5.1 CCGGAGCTAGTAGCGAAATG    GAGAGCATATCCAGCTTGGC    V-8E19
153 C11 V   F57F5.2 GTGATTGGACCACGGAGAGT    TGGAGTTCTCGCTGGAAGAT    V-8E21
153 D01 V   F57F5.4 ATGTGAGGAGATAGTGCCCG    CCGTCAACGATGAAATTGTG    V-8G01
153 D02 V   F57F5.5 TTGTCAGCTTCAAATGGTGG    CGCGGTGATTCAAATTAGGT    V-8G03
153 D03 V   F10C2.1 CAGATCTACCCAGATATCGTTCG AGTCCACAATTAGGATCGTTTGA V-8G05
153 D04 V   F10C2.2 TTGCAAAGAATTTCCCAGTTTTA CTTGAGTAGGCAAACAAGCAACT V-8G07
153 D05 V   F10C2.3 TGTGATTGTTCTCGACTCGG    TGTGTGCGGTTTCACAATTT    V-8G09
153 D06 V   F10C2.4 CGTGATAACTGCCCTCTGGT    AGCCGAGCAATTCACTTTGT    V-8G11
153 D07 V   F10C2.5 CAAGACACCTGGGGATCATT    TAGCCACATTTAGTTCGGGC    V-8G13
153 D09 V   F10C2.7 GGTAATGGTTGGCTCCAGAA    GCGGTTGAAGAGAAAACTCG    V-8G17
153 D11 V   R07B7.2 CACGAAACTGAACAGAGCCA    CATCACGCTCCAACAAGAGA    V-8G21
153 D12 V   R07B7.3 TGACGTATTGGACTGGACGA    AAAAAGTGAAGTCCGAGCGA    V-8G23
153 E02 V   R07B7.5 AAAGGAACCATTGCATGAGC    AAAACGTACAGCAGGCAACC    V-8I03
153 E03 V   R07B7.6 TCCATTTGTCCTTCCAAACC    CTCGGTCTCAAGAAAAACCG    V-8I05
153 E04 V   R07B7.7 TAAACTGGTCGAAAAATGAGGAA CAATTTTTGTTTTGGAAGCTTGT V-8I07
153 E05 V   R07B7.8 GTGTTGCGGAAATGAAGGTT    AGCCGCATCATATTCGAGTT    V-8I09
153 E07 V   R07B7.10    AATACCACCTGCGTCTCCAC    AGCCGCATTTTTCAAAGCTA    V-8I13
153 E09 V   R07B7.12    TGACTTGTCCCTTTGGGAAC    ATCGGTAAGTGGATTGGTGC    V-8I17
153 E10 V   R07B7.13    GCGGCAAAATTCTCAAAGAC    ATGTCCTTCAAAAGCCAACG    V-8I19
153 E11 V   R07B7.14    CGAAGATTTGCAAACATTTTCTC ATTGATCTGAATGAACCAGCAAT V-8I21
153 E12 V   R07B7.15    GGAAATCCAGCAATCGGATA    GCAAAAAGATCGGAGACAGC    V-8I23
153 F02 V   C13C4.1 AATCCAATGGCAATTCAAGC    CGGAACAAACACTGAGCGTA    V-8K03
153 F03 V   C13C4.2 AATCCAATGGCAATTCAAGC    CATTGCGAGAATAGTTGCGA    V-8K05
153 F04 V   C13C4.3 ATCAAAAGGCGATGATGAGC    TGCCAGAGTTCTTTGCATTG    V-8K07
153 F06 V   C13C4.5 AAGCTGAACGTGAAAAGGGA    GTAGGGGAAGAGGGGTTGAG    V-8K11
153 F07 V   C13C4.6 TCTCGAAAATTGCGGAAAGT    GGCTCACCCGAAAGTATTCA    V-8K13
153 F08 V   C27A7.1 CAGCTTGGACCAACACTTGA    CCAACAACTCCCTTTGCAGT    V-8K15
153 F09 V   C27A7.2 GCAGGAGCTTTATCGGATTG    CGTTCAATGCTCCCATTCTT    V-8K17
153 F10 V   C27A7.3 ACTGAACGCCCTGCACTTAT    AGATTCGATCACACCCTTGC    V-8K19
153 F11 V   C27A7.4 CCAAAGCTCCCATCGATTTA    AGTTGGTGGGGAGCCTACTT    V-8K21
153 F12 V   C27A7.5 TCATTCGTCTTAGCAGCATTACA AGTACGTTCTGATGGAATGGAGA V-8K23
153 G01 V   C27A7.6 TTTTGTCGGCAATATGACCA    TTGCTCTTTCAAACGCAATG    V-8M01
153 G02 V   C27A7.7 TTGTGTCCGATGCATGTTTT    TTGCTTGTGCGTAACCAAAC    V-8M03
153 G03 V   VC27A7L.1   CAATAATTTTTGGCATTCTCTCG CTGTTGGAACTTTCTCTTGCTGT V-8M05
153 G07 V   ZK863.4 CTTGCTCATTCGGACAGACA    TCCACTAACCAAATCGGAGC    V-8M13
153 G08 V   ZK863.5 ATTCTGATTGCTGGGATTCG    GAACCAAAACGGCAAAAAGA    V-8M15
153 G09 V   ZK863.6 GTCTCTTCGTCTCAACAATGCTT GTGGCAGATTAAATTTGAAGGAA V-8M17
153 H01 V   ZK836.3 GCGAACGATTCCGAAAGTAA    TCCATCGACAACTGGTTCAA    V-8O01
153 H02 V   K12F2.1 TTCGAGAGAGCGGTTCAAAT    GTAACGAGGATCTTGCTCGC    V-8O03
153 H03 V   K12F2.2 TATCACCATGTCGTGGAGGA    AGAACACCTGGTTGATTCGG    V-8O05
153 H04 V   T04H1.1 CGGATAATCCAGCGACTCAT    TGCAACATTGTTCTGCATCA    V-8O07
153 H05 V   T04H1.2 ACAAGATAATTGGGAGGGGG    GAAAGCAGGGATGACAGCTC    V-8O09
153 H06 V   T04H1.3 ATTTCTACCGTTGTGAGCATCAT TCTTCCTAGATGTCCCATTTCAA V-8O11
153 H07 V   T04H1.4 CTCACCGAGTTTCTTTGGGA    AGCAACGAAGCAAGCATTTT    V-8O13
153 H08 V   T04H1.5 CATGCTGAGCGAGGTTTGTA    CAAGTGTCGTGTGTGCACTG    V-8O15
153 H10 V   T04H1.7 GGGGCCACAATGTTGTAAGT    GGCATCAAAAACGAAGGTGT    V-8O19
153 H11 V   T04H1.8 TCGTCTTCAATGCACTCACC    CATTCGGTTCCAGTCCTGTT    V-8O21
153 H12 V   T04H1.9 ATGGAAAGCTGTTTGATCCG    ACTTTGTTCTCGGCGTCAGT    V-8O23
154 A01 V   T04H1.10    TTGATCCATGCGTGTTCAAT    AGATTCCGCATGGTTGAGAG    V-8A02
154 A02 V   F55C5.1 GGGAAACCACATCAGATAATGAA CATTACTGTAAACCTGAGTGCCC V-8A04
154 A03 V   F55C5.2 GCGGCCCTTATAAAACATGA    CGGCGTTTCTGAAAATTGAT    V-8A06
154 A04 V   F55C5.3 GCCTTGCTAGAACGGACATC    CCAAAACCTTTGGCTGAAAA    V-8A08
154 A05 V   F55C5.4 ATGGATGTCTTTACCGAGCG    CCAGTCTTGCGAGAACATCA    V-8A10
154 A06 V   F55C5.5 CATTTGGATCATGCCCTTCT    CAGGCTCTAATGGCTCTTCG    V-8A12
154 A07 V   F55C5.6 TTCGTTCGAAAAATGCACTG    CTGGAAGCAATGGGGTAAAA    V-8A14
154 A08 V   F55C5.7 GATGGGCTGTGGTTTTGATT    TCGGAAAACTGCCAAATACC    V-8A16
154 A09 V   F55C5.8 TCCTTCTCCCATTTGCATTC    TTCTGCCGATGTGTCCAATA    V-8A18
154 A10 V   F55C5.9 ATACACCTCCTCGTGCTCTGTAA TCGCGATAAGAAATTTATGGAAA V-8A20
154 A12 V   C51F7.2 TTATGGTATTCCATCCGTAGCAC GGAGAATCGTTGCTTTAGGTTTT V-8A24
154 B01 V   R04F11.1    AACAAACGTCGTGTGCATGT    TCCGTTCATTCCTCCAATTC    V-8C02
154 B02 V   R04F11.2    CGTTTCAGCTGTAGCATTTTCTT CCTGGGTCTGATAGTGTGTCTTC V-8C04
154 B03 V   R04F11.3    GGAAAGCGAAACTTTTATTCGAT GGCACTTTATGAAATCAGTGGAG V-8C06
154 B04 V   R04F11.4    AGCATGATGGGAAACAGTAAAAA AAGGTGGTGAGAATGAGAATGAA V-8C08
154 B05 V   F23H12.1    GTTGTACCCTACAAAAGTGACGC CATGTGTCACGATGTTTTCTCAT V-8C10
154 B06 V   F23H12.2    GTTGGTGAACGAAAAATACGAAG CATGAAAAGTCTATCGATGTCCC V-8C12
154 B08 V   F23H12.4    GTCGATATCTTCGTACGGACAAC TATGTTTATCGTCTGGTTCCGTC V-8C16
154 B09 V   F23H12.5    AAAATTGTCGATCACGAGGC    ATTTGGTCCAAGCCAACAAC    V-8C18
154 B12 V   K01D12.1    GGCAATAGGGGAAATTCCAT    TTCTTATCGGCCAACAGCTT    V-8C24
154 C01 V   K01D12.2    CTCGGGATTGATTGCAGTTT    GGAATTGAAATTGTCCACCG    V-8E02
154 C02 V   K01D12.3    TTGATGAGTTCGTTGGCTTG    CCAAGGACCCAGGGATAACT    V-8E04
154 C03 V   K01D12.4    CGTAATCAACCGACGACCTT    AGTGGCTCAGTGATCGCTTT    V-8E06
154 C04 V   K01D12.5    CCAAATCAACGACACTCCCT    GTGTCATCGACAGAGGCTGA    V-8E08
154 C05 V   K01D12.6    TCATCAGTTCCCAAAAAGCC    TCAAGGAGAACGCTCCAGTT    V-8E10
154 C06 V   K01D12.7    CCAAAGATTCACCAAATTGAGAG ACTGGATGCACAAACTTTTCCTA V-8E12
154 C07 V   K01D12.8    GAATAGTTCATGCCAACAGGAAG ACTGGTAAAATATAGCCCGTGGT V-8E14
154 C08 V   K01D12.9    TTAATCGCAATACCCGAGTAAGA TTTGATCATTCAATGCTTGTGAC V-8E16
154 C09 V   K01D12.10   CAGTAACCTAACCAGTTGATCCG CGTCTGACCCATTTTCAATTCTA V-8E18
154 C10 V   K01D12.11   AAGCACCTTGGGGAAATCTT    ATGGTTTGTTGTTGCCCAGT    V-8E20
154 C11 V   K01D12.12   AGCAAAATAATGCCATTCTCAAA AATGAAAAGTGGCTCAACGAATA V-8E22
154 C12 V   K01D12.13   CCCGGATATCAAAAACTGGA    TTTTGCTTCTGCTGCTGCTA    V-8E24
154 D01 V   K01D12.14   TTTGTGCCAATGCAACGTAT    TATGCTCTTCCTGCGAGACA    V-8G02
154 D02 V   K01D12.15   AGAACATGGACTTTGATTCTGGA ACTTTAGTTTCGTGGGTGTTTGA V-8G04
154 D03 V   C54D10.1    AATCATTTTCAAGGGCATCG    TGGTCTTTGTCCCATCCAAT    V-8G06
154 D04 V   C54D10.2    AATCTCTTTGCGAACACGCT    ATTCGTGCAAAACCAGAACC    V-8G08
154 D07 V   C54D10.5    TGATGGCTCGAATCACTCAG    GTTGAAAATGCCAACGGAAT    V-8G14
154 D08 V   C54D10.6    CCATGAGTCGCTATCAAGCA    GGCGCATTTCAAATACCATT    V-8G16
154 D09 V   C54D10.7    GGAACACAAACCACCGAGAT    GCTAAACGTAGCGAACAGGC    V-8G18
154 D10 V   C54D10.8    TGTAAGCCCTTTCAACGTCC    TGTGATGAACGTGGGTGTTT    V-8G20
154 D11 V   C54D10.9    CTTTACCGAAATTCGAAACATTG TGATCGATTATGTCGAATCCTTT V-8G22
154 D12 V   C54D10.10   AATACAATTCTTGAGTCCCGGTT TCAACTTGAGGGTCGTGATCTAT V-8G24
154 E01 V   F28C1.1 ACGCTCGATCGCATCTATCT    TTCTTGAACGGCTTCTCGAT    V-8I02
154 E03 V   F28C1.3 GAGTTCGAGCGATACTTCCG    CCTGCTGGAACACTTCCAAT    V-8I06
154 E04 V   W04D2.1 AGATGCTGATCGCGAGTTTT    GGAGTAGGCGTGAGTTGCTC    V-8I08
154 E06 V   W04D2.3 TTCTCTGTGCTCATCTCATTCAA GTGTACTCACCAAAACCACAACA V-8I12
154 E08 V   W04D2.5 ATTAAATTGTTCAAGGCAATCCA GAATGGTTTTTATTCCCCGTATC V-8I16
154 E10 V   T28H10.1    TCATCATAAATTCCAGCGCA    TTCTGAAGCAACAGCGACAC    V-8I20
154 E11 V   T28H10.2    GAAGGTAACCATTATCCAGGGTC TCCGTCTTTTACTAATGCCGATA V-8I22
154 E12 V   T28H10.3    CGTCCACATGGAAAAGACCT    AAGAACATCCCCATGTCAGC    V-8I24
154 F01 V   C13C12.1    CGAGAAGTTAAGCGAAAACAAAA CTTTTCGCATGTCTGTTCTTCTT V-8K02
154 F02 V   C13C12.2    TTTGTGAAGGCATTGCAGAG    ATGCTGAAACTGGCTTGGTT    V-8K04
154 F03 V   F45D3.1 AAAGTGTTCTGAAAAATCGGTCA TTCCTGCCATACAACATCTTCTT V-8K06
154 F04 V   F45D3.2 TTTTTGTTTTCGACACTGCG    ATGCAGTTCTGTCAAGCACG    V-8K08
154 F05 V   F45D3.3 GGGAGAGGAGAAATCCTAATGAA TCAACATAATCGCATGATCTCAC V-8K10
154 F06 V   F45D3.4 TGGAAACATTTCGACTTCTGATT TATTTAATGGCTGACGAGGAAGA V-8K12
154 F08 V   E02A10.1    TCACTTTTGCCATTTGTCCA    TCAGTCTGGGATGGCATGTA    V-8K16
154 F10 V   E02A10.3    ACGAATTTGGAGAAATCATGCTA CTACATCTCGTTGGTAGGAGTGG V-8K20
154 F11 V   C14C10.1    ACTGGACTTGTTCCGTTTGG    TACTCGTCAACGTGGCATTC    V-8K22
154 F12 V   C14C10.2    TTTCCGGTGCCTTTACATTC    CGTTTCGGGTTACTGCTCAT    V-8K24
154 G01 V   C14C10.3    CATTCGATTCGGACGAAGTT    TTTTTCCCTCGACGATTTTG    V-8M02
154 G02 V   C14C10.4    TGATGGAGCAAACATAACAGATG ATCGTCAATTGGCAGTTCTTTTA V-8M04
154 G03 V   C14C10.5    AGCAACGGAACCAGCTCTAA    AATAGAACGGGGGAGGAAGA    V-8M06
154 G04 V   ZC116.1 AATGTATTGCTTTAATCTCGCCA ATAAAGGCAGTGTGAGGAATGAA V-8M08
154 G05 V   ZC116.2 ACAGATGTTTCCAAACTTCCAGA TTACTCGTAATCCACGTTTCGTT V-8M10
154 G09 V   F56H9.3 TCACATTCCTGTGGACCTGA    TTCAGAATCATCCACGACGA    V-8M18
154 G10 V   F56H9.4 GGGAAGGCGCTTAGAAAGAT    TTCTTCATCGGCCAAAAATC    V-8M20
154 G11 V   F56H9.5 TTGTGAGCCAGAATCAGGTG    CCCATAAATGTTTGCGCTTT    V-8M22
154 G12 V   W05B10.1    TCGATAGAAAACAGGGATGAGAA TCTTAATCGCGCATTTTGTTATT V-8M24
154 H01 V   W05B10.3    CTTGCTCAAAATATGGCAAAATC TACAGTATCCTGGCTCGAAATGT V-8O02
154 H02 V   W05B10.4    CATCGAGAACGTCTTCGTCA    TGAGCATGTTTTCCGAAATG    V-8O04
154 H03 V   W05B10.5    TTCAGCTAAATCCAATCGCC    CCTTCAACGGTCCGAATAAA    V-8O06
154 H04 V   K10C8.1 TTCCGCCCAAATATTTCAAG    ATCAAGTCTTCATGGACGGC    V-8O08
154 H05 V   K10C8.2 TTCCTTCTCCGACCTTTTGA    TTTTCGAATAACGCTCGCTT    V-8O10
154 H07 V   R11D1.1 GGCAAATGCCCATTGTACTT    CAGAACTTTCCTCGCGAAAC    V-8O14
154 H08 V   R11D1.2 CGGGTGTGAAACGCTTTTAT    GTTGAGGCAACAACACATGC    V-8O16
154 H09 V   R11D1.3 AGATTTCATTCGACTGACCCATA ATGAACACTTTTTAATCTCGCCA V-8O18
154 H10 V   R11D1.4 TTTAATTGAAAAAGTTGGGGACC GAGTTCAAAGCGTCACGACTAAT V-8O20
154 H12 V   R11D1.6 TCGGAAAATACTGAGACGCTTTA ATTTTGTTCCAGAATGCTTCAAA V-8O24
155 A01 V   R11D1.7 TGTCGAATCTGGGCTCTCTT    ACTCATTTGAGATGCCCTGG    V-8B01
155 A02 V   R11D1.8 TAACCGGTTTCAACTGAACCTAA GCGAATTTTTATGCATTTCAGTC V-8B03
155 A04 V   R11D1.10    TTCAGCCAAATTATCCGACC    CTTCTGAATTTTCGGCTTCG    V-8B07
155 A05 V   R11D1.11    TTCGAAAATCCTCCATCGAC    GTGCCAACTTATTGCCCAAC    V-8B09
155 A06 V   C15C8.1 TCCCGGGTCTTCCTTTACTT    GTTCGGCGATTTTCACATCT    V-8B11
155 A09 V   C15C8.4 TTTTGCAGTTATCTTCGGTCATT ACCTCTTCCCATTTCTCTTCATC V-8B17
155 A10 V   C15C8.5 TGTGTCGTTTGGAAATGGAA    TCAATGAAGCCAACACCAAA    V-8B19
155 A11 V   C15C8.6 CTGTTGGCTGATTGTGGTTG    TTTTAGCGACCTCGGTTTTG    V-8B21
155 B01 V   F18E2.1 CTTTGCTCCTGGATTTGCTC    ACAAATAATGGGCAAGTCGG    V-8D01
155 B03 V   F18E2.3 CACAAAGTTCAGCTCGGACA    CAGTGGATCCGTTCCTTGAT    V-8D05
155 B04 V   F18E2.4 CGAGGGCATTCCCTACTACA    AAGGGGAGGTTAATTGGTGG    V-8D07
155 B05 V   F18E2.5 TAATGGAATGACGCTGAGTTTTT CCATCTATTTCTCCACAAGTTGC V-8D09
155 B07 V   ZC455.3 CATTCTGCGAAATGCTTCAA    CCTTGCTGATGCTGGACATA    V-8D13
155 B10 V   ZC455.6 CTGGTTTCGCAGAGTATGCTAGT TATTTCCACGATGAAGAAGGAAA V-8D19
155 B11 V   ZC455.7 GATTCGATAATCTTCCACAGCAC TCGCAAAATGAGTATGACTGAAA V-8D21
155 B12 V   ZC455.8 GAGTTCGGCTTGATCCATGT    ATCCTTTTTGCAACCTGCTG    V-8D23
155 C02 V   ZC455.10    ATTAACAGAGAACGTTCAACGGA ATTTGTAACCGCTCATCCACTTA V-8F03
155 C03 V   ZC455.11    CTCTACGGTAACGCTCCAGG    GTTGAACGAAGTGTCCCGAT    V-8F05
155 C05 V   ZC443.2 GGTCTTTTTCCATCTTCTCCAGT TATTCTTTTGCATACGATTGGCT V-8F09
155 C06 V   ZC443.3 GTTCACAAACAACCGACACG    GCCCAGTCAACCAAAGTCAT    V-8F11
155 C08 V   ZC443.5 GCCCATTTGGTCAGTTTTTG    CTGATCAGCCATAAGGGGAA    V-8F15
155 C09 V   ZC443.6 AACATCAATGTTTGGGGTAAGTG AAACTCACAACAACTGCTGGTTT V-8F17
155 C10 V   C44H9.1 ACCTTTAACTGCCCGAGGTT    CACCGTGTCTTGTGAGCATT    V-8F19
155 C12 V   C44H9.4 AACCAACTGAAGGACGTTGG    GAATCCGCAGTTGAAACGAT    V-8F23
155 D01 V   C44H9.5 TGCAAAATTTGAGATTTGTGTTG CGCATTATTGGATAGTGGAACAT V-8H01
155 D04 V   C44H9.8 TCGTTGCTATTATTGAGATCCGT GGTACATTGGAACTGAATTTGGA V-8H07
155 D05 V   T07F10.1    ATTCTTTTGCACTGGCTCGT    TTTTGGAGCTTTCTTTCGGA    V-8H09
155 D06 V   T07F10.2    CTTATGATGCGATTCCAAAACTC GTGGGAAGATTTCCTCGTATTTT V-8H11
155 D07 V   T07F10.3    CGATTTGAATTGCCTCGATT    ACAACGGACAGTCGGAAAAC    V-8H13
155 D11 V   R90.1   TTCTCGTCTCCGTTCTCGTT    AATATCGAGGTGGAACAGCG    V-8H21
155 D12 V   R90.2   ATATTGCCATTCGGTTTTGTATG CAGCAAACACCTACCGTTTCTAC V-8H23
155 E01 V   R90.3   CAATTAAAGTTTTCGGTGGTTTG TTACCATGTGTTGCTCACTCATC V-8J01
155 E02 V   R90.4   ATGGAAATTGCAAACAACTCACT TTTTGCCAAGAAGACAATGAAAT V-8J03
155 E03 V   F54F3.1 CCGTTGTGAATGTGAACCTG    CAGCTGAGGAACTGAAAGGG    V-8J05
155 E04 V   F54F3.3 CCACGGTAAGTAGAAGGAAGGAT ACATTTGCTTGTCCGTAATGTTT V-8J07
155 E05 V   F54F3.4 TTTGTTTCAAAATGGTCGCA    CGCGAACCCGTAATCTAGTC    V-8J09
155 E06 V   T16G1.1 TGGTGAAGAGGATGAAGGAAATA GAAACACGTACGTTTCCGACTAC V-8J11
155 E07 V   T16G1.2 AAATTTCTTGACCAAACCCTAGC GCGAAGAGAGAATTACAAAACCA V-8J13
155 E08 V   T16G1.3 TGTAAACTTTGCAAACAAGCGTA ACTTCAAAACCTGGATGCTGTTA V-8J15
155 E09 V   T16G1.4 TACAGACAATACCTGTGCAATCG CTGAAAATCACATCATGTCTCCA V-8J17
155 E10 V   T16G1.5 ACTCCTCCACGTTCTCATTATCA TTCACTGAACAACAAGAAGCTGA V-8J19
155 E11 V   T16G1.6 CCTGATCAAGAGTGTACGGAATC GTTGTTGGAGACGGAAATGTAAG V-8J21
155 E12 V   T16G1.7 TCCATTAAGTGCTCAGCTTTCTC GGGAATATTAGGAATGGAGTTCG V-8J23
155 F01 V   T16G1.8 TTCCTTCGCCATTTTATCAAGTA ATTGTTCCTTCTTTCGCTTTTTC V-8L01
155 F02 V   T16G1.9 TTAGGATCTGAAATAGGTTGGCA ACGCCACAAACAAAGAATACACT V-8L03
155 F03 V   T16G1.10    GCATCCACTTTCTACAATCAAGG CGTAATATGAGGTTTTGCCAGAG V-8L05
155 F05 V   R186.1  GGCATCGTGCCAAGTAGATT    TGACGCAATTTTGTGGTCAT    V-8L09
155 F06 V   R186.2  AACGTGGATGAAGATCCGAG    AAGCTATGCGAATGGTGCTT    V-8L11
155 F07 V   R186.3  TCTGACGAAGGAAGCGATCT    CATGGGAGCCAAATCAAAGT    V-8L13
155 F08 V   R186.4  CCAAAACATGGCGTTTTCTT    GGCGTACTGGATCAATGCTT    V-8L15
155 F09 V   R186.5  ATGTTTAGAAGTGGGCACGC    ACAAACGATTTGGTTGGGAG    V-8L17
155 F10 V   R186.6  AGCGCTTCATGTGTTACCATACT ACGGTTTGGTAAGTGTTTGTTTG V-8L19
155 F11 V   F15B9.1 ACTTCGTTCAAATCACTATCGGA TCTTTGGCGAAAATAGTATGGAA V-8L21
155 F12 V   F15B9.2 TTTTGACAGCCTGATAGAACGAT TGAATAGGAATGAGCGAACAAAT V-8L23
155 G03 V   F15B9.5 ATTGCAGCTTTTTAAGCCCA    TGCAAAATGAGAACGACAGC    V-8N05
155 G05 V   F15B9.7 GATGGGAGAAAAAGGGGGTA    CTGCGATCGTCGTTGAAGTA    V-8N09
155 G06 V   F15B9.8 TGTTGTTGATTCCCTTGAGAGAT AAGCATTTTAGGGGTTCAAACAT V-8N11
155 G07 V   W07G4.1 AAATTTGCTTCGTCAAATTGAAA CGATGTCATCTAAACTCGATTCC V-8N13
155 G08 V   W07G4.2 ATATGGGCTCAGCTCTCCAA    CCACCAACACCCTCACTTCT    V-8N15
155 G09 V   W07G4.3 CCGAGGCAAATGGTAGTGTT    ACACGAACGGATTTTTCAGC    V-8N17
155 G10 V   W07G4.4 TTCTTCGTTGTTGGAAAGGG    GGGGCGAATGATAAGAAACA    V-8N19
155 G11 V   W07G4.5 TTCAGCGGAGTAAGCCATCT    AATCTTCTGTGATTTGCGGC    V-8N21
155 G12 V   W07G4.6 CATCTTTGGCATTCTGAGCA    ACACAACTACCATCTCCGCC    V-8N23
155 H01 V   F42E8.1 GGACACCTGGAAGGATCTGA    AAACCACCACTTGAGGTTGC    V-8P01
155 H03 V   C34B4.1 TCCATTGTCTCCCTAGACGG    TGGACTGACTTCAGACGACG    V-8P05
155 H05 V   B0365.1 ATTGAACTATGCTGGCGTCC    GTCTGACTGCCCTCTGCTTC    V-8P09
155 H07 V   B0365.3 CCATTCCTCCCAACTCAAGA    TGTTCCAGCTGATCTTCGTG    V-8P13
155 H08 V   B0365.5 CTTTATGGGCTTGCTTACATTTG TAAAAAGGATGCCTCAGTGTGAT V-8P15
155 H09 V   B0365.6 CATGGGCGGAACACTACTTT    AACCACCAGCTTTCGAGCTA    V-8P17
155 H10 V   B0365.7 GCAGCGGAAGGCTTATGTAG    TTCATTTTCGGTGTCTGCAA    V-8P19
155 H11 V   K03H4.1 AATCTGAGCCAAAACAACCG    CTCGAGACTCAAAGGAACCG    V-8P21
155 H12 V   K03H4.2 GCTCGTCTTTGTCTTGTCTCACT AACACTTTAAGCTTCCCGTTTTC V-8P23
156 A01 V   T09E8.1 CGCCGCGTAAGAGAAAGTAG    GAGCGCAAAATTCGAAAAAC    V-8B02
156 A02 V   T09E8.2 CGGAACGGCGACTTATGTAT    GCGTAATGCAGTGTTGGAAA    V-8B04
156 A03 V   T09E8.3 TCGTGTATCAATTACACCCGAAT GATTTAAGTTGGAAGCATCATCG V-8B06
156 A04 V   T09E8.4 CAGCTGAAAAATTCGGAAGG    GTCATAAATGTTCCCGCCAC    V-8B08
156 A05 V   T09E8.5 TCCTGGAAGTTGAATGCATAGAT GCATGAAATTGGTTTGTTTCATT V-8B10
156 A06 V   F57B1.1 TTTGCGAAGAGTTTGTTCTCATT AATTCGTTCAATCCGGTAACTTT V-8B12
156 A07 V   F57B1.2 TTTTGCAGAAACTGGACGTG    AATTACAATTCCGCACAGGC    V-8B14
156 A08 V   F57B1.3 CCTGAGCACGTTATTGCCTT    CAATCTTCCCTTCAATCCGA    V-8B16
156 A09 V   F57B1.4 CCGAAAACAATAAAAGGGCA    ATCAAACGGACTCTGGGATG    V-8B18
156 A10 V   F57B1.5 CCTTCTTTCCGTCTGACACATAC GTGTTTTTCTTTTCAATTGCGAC V-8B20
156 A12 V   F57B1.7 GTGGGTGGAAGAATCGAAGA    CAGAAGCTCATGGCAGATCA    V-8B24
156 B01 V   C34D1.1 TCTGCTGAGCATTGAGCATATAA CTAGGATCTCTTCGGTGGTTTTT V-8D02
156 B02 V   C34D1.2 AACTTTCTATCAAAGGGATTCGC ATTTTTCCGGATTTACTAGCTGC V-8D04
156 B03 V   C34D1.3 ATGCGTTTGCTCTCTCAGGT    CTCATGCCAGAGCAATGAAA    V-8D06
156 B05 V   C34D1.5 TGGAGATTATGATTTACCATCCG AGTCATTTTGGCAGTGTTTCATT V-8D10
156 B06 V   F32F2.1 GAAGTTTTGCTGCCTCCAAG    GGATGCTGCAGATTTGGATT    V-8D12
156 B07 V   C26E1.1 GCTGAAATGAATTTTGGTGAAAG GTGGTTATGTCAACGTGAAGTGA V-8D14
156 B08 V   C26E1.2 CCAAATTCCGATGAGGTGAT    AATTCTGCAGACGGAGCAGT    V-8D16
156 B09 V   C26E1.3 TTGCCCTGGACCGACTATAC    TGTTGTCTCCCTCGAGTCCT    V-8D18
156 B11 V   C50B6.2 GAGCATCAACGATGAAAGCA    CTTCCTCTATGGAAAGGCCC    V-8D22
156 B12 V   C50B6.3 TGAAGTTAGCTCCAGGCGAT    GACCTTGGCGAAATGTTGTT    V-8D24
156 C01 V   C50B6.4 ACATGAAGGGATTCAGTGAGAAA CACTGTCACCTAAAATGTCAGCA V-8F02
156 C02 V   C50B6.5 TGCACTTACCATATCCGCTG    ACACCTACGAAAATCCACGC    V-8F04
156 C03 V   C50B6.6 ACATTGGGGTAAGTGCAACC    TCCCTTTGTTTTGTGGAAGC    V-8F06
156 C04 V   C50B6.7 TATCCAGGTCCAAGGTTTGC    GGTACGGTGCGGTACAAGTT    V-8F08
156 C05 V   C50B6.8 CTGTCTCCGCGTAAACCATT    TTGTTCACGTTCAGGTTCCA    V-8F10
156 C06 V   C50B6.9 CACCAAATTTGAAAAATGGAAAA ATTACATCCATCAATTGTCCGAG V-8F12
156 C07 V   C50B6.10    CCGGGTTCAACGAAATTTTA    GTTTTGGATTTTCCTCGCAA    V-8F14
156 C08 V   C50B6.11    TGGACGGATCCGAGTTTAAG    ACCCCACAATAGCCAATTCA    V-8F16
156 C09 V   C50B6.12    TATCACATGCATCCGAGGAA    AAACGGGCCAAGCTTAAAGT    V-8F18
156 C10 V   F32H5.1 GCCAAAACTTGATGCTCGAT    GTCAGAAATGGCCTTCGTGT    V-8F20
156 C11 V   F32H5.2 TTAGGTTACGGAAACGTGGC    CGACAAATTTAGCGAGGTCC    V-8F22
156 C12 V   F32H5.3 ACGAAATAGAAAAGAAATTCCGC AAAATTCCCGTGTTTTATCCTGT V-8F24
156 D01 V   F32H5.4 ATGGAACACGTACCACGTCA    AACAAGCAAAATCCCGTCAG    V-8H02
156 D02 V   F32H5.5 TCCCGGTTAGAGCCCTAGTT    TCTGAACGCCGCTAAAACTT    V-8H04
156 D04 V   M04G12.1    TGGGACCGAAGAGAGAGAGA    GGATAAGCCCACAAAGGACA    V-8H08
156 D05 V   M04G12.2    TCTCGATTCCCCATTTGAAC    AACTCCCCATCCAGTGAGTG    V-8H10
156 D06 V   M04G12.3    GGAGTTCCAGGTTGCAGAAG    TGGATTTGAAAACGGGAAAG    V-8H12
156 D07 V   M04G12.4    TAACCGTTTGGGTCGATCTC    CAGTTCTTTTCGAGCAACCC    V-8H14
156 D09 V   F53F1.2 AAAATGTCGGATTCGTTTGC    GTCACCGACTTCGGTACGAT    V-8H18
156 D10 V   F53F1.3 AGAAATTGGAGACGCATTGG    AAACGGAAATTGCTTTGTGG    V-8H20
156 D11 V   F53F1.4 TAATCACTTTTGCCTTCGATTGT AATTGCTGAACAGGTGACAAAAT V-8H22
156 E01 V   F53F1.6 TGAACATTGGAATCTGGCAA    TGCATTGAAGGAACTGGTGA    V-8J02
156 E02 V   F53F1.7 GCAAGGATACGGGATTTCAA    TATGGAGGTCGTTGTGTCCA    V-8J04
156 E03 V   F53F1.8 GAAGCATCCAGGCTGAGAAC    TCGTGCTCGAAGGGATAACT    V-8J06
156 E04 V   F53F1.9 TTTGGCAACTTACTTTTCCCATA TAGACAAGTTCGAGGAAGCAAAC V-8J08
156 E05 V   F53F1.10    GTGCTAAAATGGCAACAGCA    TTGAAATTTGGCACTGGTCA    V-8J10
156 E06 V   F53F1.11    CTATCACGGGCTTGGAAAAA    ACTTACAGGTTTCCGCGATG    V-8J12
156 E07 V   Y2H9A.1 ATTCGAAGATTTCTCACATCCAA GTGACTCCAGCAAAGAGAACTGT V-8J14
156 E08 V   Y2H9A.2 ATGGACAGAATGGTTCTTTCAGA GTGCCGCACTAATAAAACATCTC V-8J16
156 E09 V   Y2H9A.3 AGAAGTTCGATTGGCAAAATGTA ACATGAAGGGATTCAGTGAGAAA V-8J18
156 E10 V   Y2H9A.4 ACAAAACAGATAGGGACTGACCA TACAAAACCACATCCTCTCACCT V-8J20
156 E11 V   F25H9.1 TTATTGGTGCAAAAATGCCA    TCAGATTGCAAAAATCCGTG    V-8J22
156 E12 V   F25H9.2 AGGCGGAAAATGTGTACTGG    TGAGAAACGGGGATGAAAAG    V-8J24
156 F02 V   F25H9.4 TCCGAATAATTCAAGTCCCG    TTCCAGTAGGGCATCGTAGG    V-8L04
156 F03 V   F25H9.5 CGAAATGCTTCTTCTCGGAC    CATTTGCCGTCCTTGAATTT    V-8L06
156 F04 V   F25H9.6 TAAAAGATCTCACTCGTTTTCGC ATTGAGGAAATTATGCCTGAGGT V-8L08
156 F05 V   F25H9.7 TAACCGAACAAGTTTTGAGGAGA GGCAAGGATCTTCTATATTGGCT V-8L10
156 F06 V   F25H9.8 TGTGCAAATTTATCCTGCCA    GCACATTGGCCTTTGAAGTT    V-8L12
156 F09 V   T10G3.3 ATGCAAAATTCAGAAATCAGGAA CAACCTTGTCAACCTCGATACTC V-8L18
156 F10 V   T10G3.4 TATGCTGTTTCACAACGAGAAGA TTCGTTTTCTAAAACAATTCCGA V-8L20
156 F11 V   T10G3.5 CGAGCCTTTTAACGTTTTGC    TTTCCAGAACACATGCTTCG    V-8L22
156 F12 V   T10G3.6 GATTCCCTCTGATTTCTTTTCGT GTGGATTTACTGTTTTGCCTTTG V-8L24
156 G02 V   R11G10.1    AAAAGTGAGAAGACGTCATCGAG TCTGATCTTTCGCTTGAATTAGC V-8N04
156 G03 V   R11G10.2    GTTGGCTCACTTTTCTTCCG    GCATTCTTCCCCATCAAAGA    V-8N06
156 G05 V   C56A3.2 TTGTCACATAACAAAAGACCACG TTTTGTTTTAGAAAACGCACGAT V-8N10
156 G06 V   C56A3.3 ACCTGCAAAACTGGCTTGAT    GTTCGTCGAGCCAAACAAAT    V-8N12
156 G08 V   C56A3.5 ACATGGGATGCAATGTTCAA    TTCAGTCAGTGGGGCTTTCT    V-8N16
156 G09 V   C56A3.6 TTAGGCACGGGATACTTCACTTA AGTTTCAGTGCGATGAAAACATT V-8N18
156 G10 V   C56A3.7 GATATTGATGAGCTAACCGATGC TCAAAAATGCAAATAAAGCGAAT V-8N20
156 G11 V   C56A3.8 CTCGCGTCTCCATCATTTTT    TTCCGACTATGTGCCAATCA    V-8N22
156 H01 V   C50B8.2 CGTACATATCAGCTGCCGAA    ACGGATGTTAAACAGGTCGG    V-8P02
156 H02 V   C50B8.3 CTCGAGTCGGAAATCACCAT    CTCTCGAACAAAAATTCCGC    V-8P04
156 H03 V   C50B8.4 CTATTGTCATGTGGCAGAATCAA CGTTACGAAAGTGTGTGTGGTAA V-8P06
156 H04 V   C50B8.5 TGCATTTTCCATATGTCTCACTG GAACTTGGTCTCCCAAAAGAGAT V-8P08
156 H05 V   F53F4.1 GGTCGATTTGCATACTATTCTCG ATCACAAATGTACACACCTTCCC V-8P10
156 H08 V   F53F4.4 TCTTCATTCGTTCGATTCCC    TGACGCTTCAATTTGCTGAG    V-8P16
156 H09 V   F53F4.5 ATGCTTCATTGGCGGTAAAC    TGTCAGCTTGCAAAATGGAG    V-8P18
156 H10 V   F53F4.6 TGACCCCTTCCTTGAAAATG    TTCGTCCCCATAAGACTTGC    V-8P20
156 H11 V   F53F4.7 AATCACATGAATAATCTCCACGG TGTTCAAAACCTGACCACCTACT V-8P22
156 H12 V   F53F4.8 ACTGCTGGATCGAAAATTGG    CCTGAACCATCTGCAAGTCA    V-8P24
157 A01 V   F53F4.9 AGCCACTCATCTGGAATTGG    TGGTCATTGCTAATGGGGTT    V-9A01
157 A02 V   F53F4.10    CCAAGGATCTGATAAAGATGGAA GAGCTACTGGATTGATGGTTCAC V-9A03
157 A03 V   F53F4.11    ATTTAGGCACTTTTTCGGCA    GATGAGCTGCAGGTTGTGAA    V-9A05
157 A05 V   F53F4.13    TGATTGGGACTGTTTTCTCTCAT AATCAAATGCCCTCTAGGAATGT V-9A09
157 A06 V   F53F4.14    ATTCGATGTGTGAAGAGTTCGAT GCTCTTTTGATTTCCTCGAATTT V-9A11
157 A07 V   H37A05.1    TTTCTCCTTTTCCTTCTGCTCTT CTTTCAGGTTTGTATTCCGTGTC V-9A13
157 A09 V   F58G11.1    TCTAGATGGTGCATTCGCTG    CTAGGCTGATTTCGAGTCGG    V-9A17
157 A10 V   F58G11.2    CTTTGACCTTCCTGACGGAG    TACGGGGATACGGTGGAATA    V-9A19
157 A11 V   F58G11.3    CATGAACTCCGTGATGGTTG    CCTGCGAATTGGACTGAACT    V-9A21
157 A12 V   F58G11.4    GCTGATCATGTTCCAGCAGA    ACCGCTTGAGATGTTTTTGG    V-9A23
157 B04 V   T01D3.2 ATCATTCGATAGTACGGGGTTTT ATTCTCACAGCTAGCCAATGAAC V-9C07
157 B05 V   T01D3.3 TTATGATCTGACGATTCGTTGTG CTCGGGAGGACATTCTTCTATTT V-9C09
157 B06 V   T01D3.4 GGATTTCACGTTTTGTGCCT    TCCGCGTTTCATTGTGATTA    V-9C11
157 B07 V   T01D3.5 GGGTGCTTTGTGAAGCATTATAG TCATCTCTATTCGTTTTGCCAAT V-9C13
157 B08 V   T01D3.6 ATGGATACCGTGGAGATGGA    AGTTGGCAGCTCCACAAAGT    V-9C15
157 B09 V   F35E12.1    AATCGGCGTTCAGTCTGTCT    GCAAAGGTGGGTTCAGTTGT    V-9C17
157 B10 V   F35E12.2    TGACAATCCGAGCATATCCA    TCATAAAGTGGCCCATCTCC    V-9C19
157 B11 V   F35E12.3    TTTCCACTTGCGCTACTCCT    GCGGCAATCAGTTTTGAAAT    V-9C21
157 B12 V   F35E12.4    TGAAAGTGCATGGTCGAAAG    TCTTCAAGTTTTGCTGCCCT    V-9C23
157 C01 V   F35E12.5    GCTTCTGTGTTGGGGACAAT    CTGGAGCTGCATCAATGGTA    V-9E01
157 C02 V   F35E12.6    AAATCTCATCGACGTTTGGC    GTTAAATCGCCGCTTTTCAG    V-9E03
157 C03 V   F35E12.7    AAAAGCAATGAATCCGATGG    AATTTTCAGACCATGTCGGC    V-9E05
157 C04 V   F35E12.8    ACAGCTGAGTAGAAGGCCGA    CTGGTACCTTCTTTGCTCCG    V-9E07
157 C05 V   F35E12.9    TGATTTGTGAAATTACGCCTTCT GATTTTCAGTTCAACATTCCTGC V-9E09
157 C06 V   F35E12.10   TGGAACTAGCGGTGAGTCCT    TGATAAATCAAGCTGCCACG    V-9E11
157 C07 V   F20G2.1 CGATTGCAATTCGGAAAGAT    TAAAACCGGGAACTTTCGTG    V-9E13
157 C08 V   F20G2.2 AGTGAGGTCTGCGTTGAGGT    CGCTTAAAGATGTCCCCAAA    V-9E15
157 C09 V   F20G2.3 TTCCCAGGATAGCGTTTGAC    TTTCAACCTTCTTCGTTGGC    V-9E17
157 C10 V   F20G2.4 ACACATTGGCAACGTTTGAA    AAAAACTCACACTGGGCTGG    V-9E19
157 C11 V   F20G2.5 TGGAGTTCCCCTAATTGCAC    TCATCCACAATTACCACGGA    V-9E21
157 C12 V   F53C11.1    TGCACAAAGCAAATAAAGCG    ACGAAGAAACGCTCGAAAAA    V-9E23
157 D01 V   F53C11.2    ACCATATGCATGCTCGTTCA    GTGGCAATGTCGACAAAATG    V-9G01
157 D02 V   F53C11.3    TCTGCGTCTCTCCATCTCTTTAC GACATGAAATCAGACGACATGAA V-9G03
157 D03 V   F53C11.4    CGTGTGAACCATCAATGGAG    TTTCGTCTTCAGGACCCATC    V-9G05
157 D04 V   F53C11.5    TCAAGCACTGACGTCTCCAC    GCACATTGCTTCGTTCTTGA    V-9G07
157 D05 V   F53C11.6    TTTTGCACGGAACTGATGAA    AAGCAAGCTGTTCACCGTCT    V-9G09
157 D06 V   F53C11.7    GATAGTCCGTTGATTGTTGCTTC AATCACAGTAACATGGGTCATCC V-9G11
157 D07 V   F53C11.8    GTTCAAATTCAAATGCTCACCTC TAGAAAAACTGGAAATCGGAACA V-9G13
157 D08 V   F55B12.1    CTTTCAAATACGCCATTTTTCAG GAATTTAAAATCATCACCAACGC V-9G15
157 D09 V   F55B12.2    TTAAGTTTTCAAGGCGACGG    CGAAAATCGATGTCCCAACT    V-9G17
157 D10 V   F55B12.3    TCACAATTTAACCGGATATGACC GGGTATACAGCATCAAAGTCGAG V-9G19
157 D11 V   F55B12.4    AGAACAAGGATGGTATGGCG    ATGATTTTGCATCACCACGA    V-9G21
157 D12 V   F55B12.5    ACTTGAGCCCTCCCGATATT    TTGGGGATGTACTCGGAGAG    V-9G23
157 E01 V   F55B12.6    CGCAATTCACTTCGTCTTCA    TTGCTAAACGCATGCTCAAC    V-9I01
157 E03 V   F55B12.8    TCAAGCCGTATGCAATACCA    GATAACCCGACGGAAACTGA    V-9I05
157 E04 V   F09F3.1 CTTTCAGCTGGGTTTCTTCG    CGATACCAAGCAGCGTCATA    V-9I07
157 E06 V   F09F3.3 GAGTTTGCATCATTTTCACTTCC CTTTTCAAAATTGCAACACTTCC V-9I11
157 E07 V   F09F3.4 CAATGCAAAACAACTGAGATTGA TCAATGCAAACGATAGACTCAAA V-9I13
157 E08 V   F09F3.5 GCAGCATTCAGATTTGGACA    TGCCATTGGTTCATTTCTCA    V-9I15
157 E09 V   F09F3.6 GTGGAAAACATTTGAACGTAAGC AAGAAATTATCCATGCGGGTATT V-9I17
157 E10 V   F09F3.7 CATCACAACGTTTTTCGTGC    AAAGAAGAGCGCGGTTACAA    V-9I19
157 E11 V   F09F3.9 ACCGACAAGACAAGGCAGAT    ACAGCTCCAAATGAACCACC    V-9I21
157 E12 V   F09F3.10    AGTTGGAATGAAGCAGTCGG    CCGAATATTTCCCAAGAGCA    V-9I23
157 F02 V   F09F3.12    TCAACTCTTGGCCCTGATCT    TCACCCATCGAAACAGTGAA    V-9K03
157 F03 V   F09F3.13    CTCTTCCCTTTTTGTGTCCG    TCCATAGCCTCCCAGTTTTG    V-9K05
157 F04 V   T22G5.1 GTTTTTCAGGCCAAAATGGA    TTGTCGGTAAGGAACGGAAC    V-9K07
157 F05 V   T22G5.2 TTCTGATATTTGCAATCGTTGTG GTATGTTTCTCTGCTGCCTCCTA V-9K09
157 F06 V   T22G5.3 CGTCACACTGAAAGACACAGTTC TGAAAATTCCTAGGGTTGCTGTA V-9K11
157 F08 V   T22G5.5 TCGGCCAATTAGTGGAGTTC    TGGATTGCATCCCCAATACT    V-9K15
157 F09 V   T22G5.6 AATCATCGCATTTTGCTACAGAT CATAGATCTACCACCCTTCAACG V-9K17
157 F10 V   T22G5.7 GACATCATGGAGCCTACAAAAAC ATCTGTAGCAAAATGCGATGATT V-9K19
157 F11 V   C06B3.1 CAGGAAAAGAAATATGGCAATGA ACGATTGAGATGAAAACCAGAAA V-9K21
157 F12 V   C06B3.2 TGCAAAGATTCCATCAGCAG    AATCGGACGTAACGGTGAAC    V-9K23
157 G01 V   C06B3.3 CCATGACTTGGGGATTGTTC    ATGCCGATAAGCATGTTTCC    V-9M01
157 G02 V   C06B3.4 TCTCGGTTGAACCTTCGTTT    TTCATTCTTTGCCAGAGCCT    V-9M03
157 G03 V   C06B3.5 AAAAGAAGGCTGGTGCTTCA    ATTCTGGAAACAATGCCAGC    V-9M05
157 G04 V   C06B3.6 TTTTTGCTACAAAATGCTCGTCT TAAATCTGCTGAAACCCAAGAAG V-9M07
157 G05 V   C06B3.7 ACCAAAAACCAAGCAACGTC    CTCATCGCAATCCGAAAAGT    V-9M09
157 G06 V   C06B3.8 CTTCTTGCCTCCCACATCAT    TCCAGCAATCACATTCCAAA    V-9M11
157 G09 V   C06B3.11    TACGTTGTGGGTGTTTTCCA    TGGCTCTGACGTGTTCTCAG    V-9M17
157 G10 V   R10D12.1    TTGTCACTCGAATGTCCTGC    TGGCAATTCCAGACACAAAA    V-9M19
157 G11 V   R10D12.2    CGAACCTGTCGTAGTCAGCA    GGCCTGCAGATTTGATGTTT    V-9M21
157 G12 V   R10D12.3    TCACATTAAGGGGTTTTCGC    GCTGAAAAAGAATTGCCTGC    V-9M23
157 H02 V   R10D12.5    ACTTAACTGCCTTACATTTGCCA AATTCAAAAATTAAGCTCCCAGC V-9O03
157 H03 V   R10D12.6    GATAGAAAAGCGTCACTTCAGGA ACGGAAGACCGAAATGTTAGTTT V-9O05
157 H04 V   R10D12.7    TGGACGATTTTCTGAATGAAGTT TTAAAATTTAGGCCCCGAATAAA V-9O07
157 H05 V   R10D12.8    TCTTTGTTGACGCTACTGCATAA CATGAATGGAATTTCACAGGTTT V-9O09
157 H07 V   R10D12.10   TTTCCTCTGCATAAAACGGC    TCTGCCCATATCATCGAACA    V-9O13
157 H08 V   R10D12.11   GTCCCGTGTAAACCGAACAT    GTCGGTCAGAATGGGAAAAA    V-9O15
157 H09 V   R10D12.12   TGCAATCGTGCACTTTTGTATTA TTTTCAGATTTCTCGCAGTTCTC V-9O17
157 H10 V   R10D12.13   AAAACGCTGTCGAAGGAGAA    GGAAAATTGGATGGTCGAGA    V-9O19
157 H11 V   R10D12.14   GACATCAAAATACCGACGGC    AAATGGGGGAAAATGTGTGA    V-9O21
158 A03 V   F58E10.1    TATTGTGAAAGCCTCCGTAAAAA TCGTTTCAAACAACAATGACATC V-9A06
158 A04 V   F58E10.2    ACCTTAAATATAGGCGGAGCTTG AGAAATCCCCAGAGACAGAAAAC V-9A08
158 A06 V   F58E10.4    CGTTTCCTATCAATATCGTTTGC CTAAATTGGATGCTATGAGACGG V-9A12
158 A07 V   F58E10.5    ATCTTCATCTTCCAACTCACCAA AACCGAAAGGTCATGTTTGATTA V-9A14
158 A08 V   F58E10.6    CCTCTGCTGGTTTCCATAATAAA TTTTGTGATGTCTTTGGCTTTTT V-9A16
158 A09 V   F58E10.7    TTTTCTTTTCCACCTCCTTTTTC ATCAGAAATGGTCATTATCACGG V-9A18
158 A10 V   T08G5.1 ATCCCACGTTTGTTTCGTTC    ATAATTTTTGGGATTCCCCG    V-9A20
158 A11 V   T08G5.2 ACACTTCACAGGAATCGTTGACT GGTGAGATTATTGCAGTTTGAGG V-9A22
158 A12 V   T08G5.3 TTTGGCAAAATAAAACTTCCAGA AATCAACCACTAAAATCTCGCAA V-9A24
158 B01 V   T08G5.5 ATCGAGTGCAGTTGTTGCTG    TGCCTGCTAACGACAGAATG    V-9C02
158 B02 V   T08G5.7 CTTGCCTCCCTCTTGAATCTTAT AATAAAAACTTGTTCGCCATTGA V-9C04
158 B03 V   T08G5.8 AAAACGCACTCACTTCGGAT    TGAAGAGCCAGACGATGATG    V-9C06
158 B04 V   T08G5.9 TGGAACAGAACAGAACAGTAGCA GCATTCAATTCACATGTCGTCTA V-9C08
158 B05 V   T08G5.10    GAAAAGGAACAAATCGTGTGAAG TTGTGACGGAAAATTCAACTTCT V-9C10
158 B06 V   F58D12.1    TGCTTCTGGTTCATATGGTTCTT TTAAAAACCTAGGGAAGGCTGAC V-9C12
158 B07 V   F58D12.3    AGGCGGTTTTCAGGATTTTT    TTGATTCGCATCGTCCAATA    V-9C14
158 B08 V   D1086.1 AAGAGGGAAACAACAACAAAACA TCAAAGAAACCAAGCTTCAAGAG V-9C16
158 B09 V   D1086.2 AAAACAACATTTCGGTAAACCCT TGTCAGCTGTCATCTTTTGTCAT V-9C18
158 B10 V   D1086.3 ACAAACACACCTACAATATCCCG TATTGCAGTTTTGCAGGGTTACT V-9C20
158 B11 V   D1086.4 CAAAGCAAGTCGTTGCGATA    CGAATTATTGAGCGCGTTTT    V-9C22
158 B12 V   D1086.5 AAAGAAAGCCGACAAGAAAGAGT TGACGTCACATCCACAATCTTAG V-9C24
158 C02 V   D1086.7 AAAGGACGCAATTCTGATGATTA CACTACAGAAAGAAAAGCCGAGA V-9E04
158 C03 V   H39E23.1    TGACAAGGTGCTCCAAAACA    CTAATTTTCAGCCATCCCGA    V-9E06
158 C05 V   AH10.2  CAACACAGAATTCCAGTCATTCA CTTCCGTATATCTTGGGCTTTCT V-9E10
158 C06 V   AH10.3  GACGTGAATACATGCACACAGTT AAAAACAGGTGGTTTTTGGAAAT V-9E12
158 C07 V   AH10.4  ATTTGATACAAATTTGGTCACGG TTCAAAATGGAACAATTATTGGC V-9E14
158 C08 V   AH10.5a TTGAGACAAACTGCAGTGAGAAA CTTTGAAACCGAAACACTTATCG V-9E16
158 C09 V   T02B5.1 AGTGGAGATATTACAAGGGCACA TCGAATTTCAAAGGAATGACAGT V-9E18
158 C10 V   T02B5.2 AGAAGTACCACGGCACTATTTCA TACGCTAATTTTGGTTTTCGTGT V-9E20
158 C11 V   T02B5.3 CGCATGTGCATCTGCTAAGT    GCCTGGAAAATGTAAGCTGC    V-9E22
158 C12 V   T02B5.4 AAAATGGTGAGCAGATTGGG    TACACCGCCACACATCTCAT    V-9E24
158 D01 V   ZC376.1 CTCCTCCACTTGTCCCTTGA    TTACTTTGGATCCCCTCGTG    V-9G02
158 D03 V   ZC376.3 TGGAGGACCCATAATTGAGC    TTGGGTTTTTGGGTATTCCA    V-9G06
158 D04 V   ZC376.4 CCACTAAATGAGACAATTTTCCG TCACTGTACAGAAAATGCGAGAA V-9G08
158 D09 V   T16A9.1 CATCATTTGGAGCATCATCG    CCCAGTGGAGAAATCGACAT    V-9G18
158 D10 V   T16A9.2 TCATCATTTGGGGGATTTGT    AATTTGCAGGAACGCAAAAC    V-9G20
158 D11 V   T16A9.3 GGGACAAACATGCTATGCCT    TCACCAATAACCGGAAGGAC    V-9G22
158 D12 V   T16A9.4 GCCAGAACACGTTTTGGAGT    TGAACAAAAATCTCCCAGCC    V-9G24
158 E01 V   T16A9.5 TTGGGGCAAAATCAAAGTTC    CAATCGCGAAGAGTCCATTT    V-9I02
158 E03 V   K02E11.2    AGCTGGCTCGAATTCCTGTA    TTGTTGAATCGCATTTTTCG    V-9I06
158 E04 V   K02E11.4    TGTTGGCTCAAAAATCTCAAAAT AAGACCACGAAAAAGTTTGAACA V-9I08
158 E05 V   K02E11.5    AAATGGTCAAGGTTTGTCTGCTA CCACAAAACATCTAAATATCGGC V-9I10
158 E07 V   K02E11.7    TAAAAATTTCGAAGTTCTCGGTG CTACATTCTTCATCGTCGGTTTC V-9I14
158 E08 V   F40G12.1    TCTATCAGCAACTGGGAAATGAT GTTGGTTTCCATGTAATGTTGGT V-9I16
158 E09 V   F40G12.2    TGATCACACGAGTCCGCTAC    TTAGCATTTGGCCATTCCTC    V-9I18
158 E10 V   F40G12.3    AAAACCATCGACAGCAAACC    TGCACAATTTGCTCTCCAAC    V-9I20
158 E11 V   F40G12.4    GTGTGGCAGTCTCGAGTTGA    ACCCAGATCACCGAACAAAC    V-9I22
158 E12 V   F40G12.5    TCGTCGCTCTTCATCACATC    CGGGACACTCATTCCAAAAT    V-9I24
158 F01 V   F40G12.6    TCTTCAGCGGTTTCATTTCC    TGTAGGCACAAGACAGGCAG    V-9K02
158 F02 V   F40G12.7    AAGCGATGTCGATCATGATACTT GCATGATAGAAAGCCAAAGTGAC V-9K04
158 F04 V   F40G12.9    ACCCAACTGGTTAAATACCGTCT TTTTTGCAGGCTCACGTATATTT V-9K08
158 F05 V   F40G12.10   GAAAGTGCAACTCCATCGGT    TCCGCAAACTTCTTTTTGCT    V-9K10
158 F07 V   F14D7.1 GAGCATCTTACAACTTTCGGAGA GGAGCAACAGAGCCTTATTACAA V-9K14
158 F09 V   F14D7.3 GAAAGCTCGAGTCATACTTCCAA TGCTCACTCTGTGCAGAATATGT V-9K18
158 F10 V   F14D7.4 CAGAGAATTTGAACCAACTGGAC GCTGGCTCATTGGACAATTATAG V-9K20
158 F11 V   F14D7.5 TATTTTGAAAAGGGTAGCGACAA AACCCAAATTCCAGTTGAAAAAT V-9K22
158 F12 V   F14D7.6 GTATTTGCCCACATTTGTATGCT GGCACCAATCTCTTGTAGAACAC V-9K24
158 G01 V   F14D7.7 GGGTGTAAACGAGATAGCAAAAA ACAGAAAGGGCACAATTAACAAA V-9M02
158 G03 V   F47B8.1 ATTCAATCTCCGAGAACAAACAA TTATTCTCAACCAAGTCCTTCCA V-9M06
158 G04 V   F47B8.2 TATGGGACGATGTACTGATTTCC GTTTCAGTCGATAAATGGCAAAG V-9M08
158 G06 V   F47B8.4 AAATCGATGAAATTCGATAGCAA AGAAAGCACATTTTCAGAGATGC V-9M12
158 G07 V   F47B8.5 AAACAGCACATGCGAAATGA    ATTTGCAATCTTTCGAACCG    V-9M14
158 G08 V   F47B8.6 GATTTACCAACAACCAAAAACCA TTTCGGAAACTAGCAACTTCTTG V-9M16
158 G09 V   F47B8.7 CACATCAATTTCGGTCGATG    GCCAATTTGTGAGCACTTCA    V-9M18
158 G10 V   F47B8.8 AAATATGTCGGAACTTCTCACCA TCGAATAATCTGGTGTTTGCTTT V-9M20
158 G11 V   F47B8.9 TTTCAATGCCAGCTGTTCTG    CACCCCTGAGAAAGGATTGA    V-9M22
158 G12 V   F47B8.10    GCAATGATGCTTCTCGGAAT    CACCAGGGGAAAGAATTTGA    V-9M24
158 H01 V   F47B8.11    TCACTGTCTACACTGCTTTTGGA TCTTTCATTCCAACTTTATCGGA V-9O02
158 H02 V   Y49A3A.1    GCTGTGTATGAAGAAGTTTTGGG GGCGCGTTATGAATAAACAGTAG V-9O04
158 H03 V   Y49A3A.2    CTCGTGAAGCTTCCATCTACACT AAAAAGTACACGCTCAGCAAAAC V-9O06
158 H04 V   Y49A3A.3    GTGTAAGATGCTGGTGAAAAAGG GTCTTGAATCCAACACTTTCCAG V-9O08
158 H05 V   Y49A3A.4    AAAAGTGAAAAGCAAAAGCAATG ACTCTGGACAAACAAAAATGGAA V-9O10
158 H06 V   F56A12.1    TTCTCACATCTCGGATCAATTTT TTTGCGGAGTTATTATTGGAAGA V-9O12
158 H07 V   F56A12.2    TGTTGTCATGGTAAGGGCAA    GGGAAACGCTTTTTAGGGAC    V-9O14
158 H09 V   C15H11.2    TCCGTTATCCTCTTTGGGTG    TTTGTCCCACTCCATTCCTC    V-9O18
159 A01 V   C15H11.6    GGCAGGAAGTCTCGAAAGTG    CAGCCTTTCATCCCATTCAT    V-9B01
159 A03 V   C15H11.8    TCAACCATTAATTTGAAAACCGA TGTTCCCATTTACTCAGCAATCT V-9B05
159 A04 V   C15H11.9    CAGTACCCTTCTTCTTGCCG    CTGACAAATCGACGGAGGTT    V-9B07
159 A05 V   F23B12.1    TTCGAGGACTTGATGGCTCT    TGTCGCCTTGTCTTGACTTG    V-9B09
159 A06 V   F23B12.2    AGGTGCGCAATCAGAAGACT    GGCCTCAGAAGAAATGCAAG    V-9B11
159 A07 V   F23B12.3    TTCCAAAAGGAATTTCAACTCAA ACGTTTCCATTTTGAATTGTTTG V-9B13
159 A08 V   F23B12.4    CAAATCTGTGTCCCTTTGAGAAC TAGTGTGTTTGGAAAAGCCTAGC V-9B15
159 A09 V   F23B12.5    AATTTCTGAGGCAATCGTGG    CTCGCCAATATCCAAATGCT    V-9B17
159 A10 V   F23B12.6    GACCAGGACAATTGGCTCAT    TGGTCACGTTGAAAACTGGA    V-9B19
159 A11 V   F23B12.7    GCCAGCATTCTGATCCTCAT    ATACTCCCAATCATCGTCGC    V-9B21
159 A12 V   F23B12.8    AAGCTTTCCTTGCTTCACCA    TCAATCTTGTGCTACTGCCG    V-9B23
159 B01 V   F08H9.1 TTCACTTCAAAGACCCGGAG    TGAACATGAGAGCCACGAAG    V-9D01
159 B02 V   F08H9.2 CTAGAGTTGCCGTAAAGCAAGAA AGGATTTCAAAAGCAAAACACAA V-9D03
159 B03 V   F08H9.3 GTGAAATCATTTGCTCTCCATTC CCTTTTAACTGGCATTTTGAGAA V-9D05
159 B04 V   F08H9.4 TTTAGCGTACGTGAACTCCAAAT GTCTCGTATAAAAAGGGCGAGAT V-9D07
159 B05 V   F08H9.5 TTCGAGAACTCACCTGGCTT    CGGAGAAAGCCAAGAATACG    V-9D09
159 B06 V   F08H9.6 TCCAGCTGCAAGTGAATGTC    GTTGGGTGAAACCATTGTCC    V-9D11
159 B07 V   F08H9.7 TTTCCAGCTGAGCGATTCTT    GTGTTTACGGCTTGGCAAAT    V-9D13
159 B09 V   F08H9.9 TTGTTGCACGAAACTAGAATGAA TTTCCACTTTGGTTTACATTTGG V-9D17
159 B10 V   R02D5.1 AATCTTCAGAAATGAAATCGCAA GCTGATGGGAGCAAAATACATAG V-9D19
159 B11 V   R02D5.2 TATTTGAGCCTCTCGATTAGCTG ATAGTGGTCGACCGTGAATAAAA V-9D21
159 B12 V   R02D5.3 GAGCAGGAGGAGCAAGAAGA    TTGTTTCGTCATCCACTCCA    V-9D23
159 C01 V   R02D5.4 CTCTTTCTGCCTTCTTCCTCTTC GCTTAGCACCTCAGCTTATCAAA V-9F01
159 C02 V   R02D5.6 TAGCTCTTTTCGAAACCGGA    CTTTCCTTGCACTCCTAGCG    V-9F03
159 C03 V   R02D5.7 AATAACTAGCAGCGGTAGCAGTG AGGGACGGATATAACGAGACATT V-9F05
159 C04 V   C53A5.1 TTAGTTTTGGATGTGCCGTTACT ACGCTCTCACGATGTTGAATTAT V-9F07
159 C05 V   C53A5.2 GGAAGAACGGGATATGGGAT    CAAAGACTGCCTCAGCTTCC    V-9F09
159 C06 V   C53A5.3 AGGAGCTGGAAAAGGAAAGC    GGGACGACAAGAGAAATGGA    V-9F11
159 C07 V   C53A5.4 CCTGCAACAAAAAGTGCAGA    GTAGCTTCTGACAGGCTGGG    V-9F13
159 C09 V   C53A5.6 TGGTCCATCCTTCCACTCTC    TGAGTGCACCCTACATTCCA    V-9F17
159 C10 V   C53A5.7 CACAGATTGCAGATGTTTGGTAA TTGAATTCTCGTCGTTCAATTTT V-9F19
159 C11 V   C53A5.8 ACAGTAAGCTTTGCCCGAGA    GGCGTGACTTATTGGCATTT    V-9F21
159 C12 V   C53A5.9 CTCTCCATAGCACGCAACAA    GGGACGTTTGTGATCAACCT    V-9F23
159 D02 V   C53A5.11    CGAGCCACTTTTCATTGGAT    AAGTCGCCCATGTCAAAGTC    V-9H03
159 D03 V   C53A5.12    CAATGATTCGGTGAGAAGAATGT AGAAATTGCACTGGAAAATCAAA V-9H05
159 D04 V   C53A5.13    CTTCTCTCGTTTTCAAAGACCAA TCAAATTTTGTGCAGTTTGACAG V-9H07
159 D05 V   Y40H4A.1    TCATTGGTGCTACTCCACTTTTT TTGCAGGAAAATAAATGAGGAAA V-9H09
159 D06 V   Y40H4A.2    AGATCAAGACCATTATCTTGGCA AAATGATCCAAGAATCTGAACGA V-9H11
159 D07 V   R11H6.1 GACTCCTCCGAACACTCCAG    TTACTGGAAGTTTCCCCGTG    V-9H13
159 D08 V   R11H6.2 CGCTCTATCGCAATCTACTTGTT AGCGGACCATGTCAAATAAATAA V-9H15
159 D10 V   R11H6.4 AAAGCTTCAAAATATCGTCGTCA CTATGGGAAACCGGAAATTATTC V-9H19
159 D11 V   R11H6.5 AATCCAATGCGATAGTTGGC    TTATAAACGTTCCGCGTTCC    V-9H21
159 D12 V   R11H6.6 TAAATCCAAGTGGGCTTTCTGTA CTCTGTATGTTCCCTACCGTCTG V-9H23
159 E01 V   F43D2.1 CAATTGCGGACTTGACATTG    GTCCGACACGGAGTTGTCTT    V-9J01
159 E05 V   C54G10.2    GACATCCATGGAGCTGGTTT    ATATGCCATTCACCCAGGAA    V-9J09
159 E06 V   C54G10.3    TCGAACCGCCAATACTCTTC    TGACGTGGATTCATCAAGGA    V-9J11
159 E07 V   C54G10.4    GTTGGCTTTCAGCGCATATT    CGATCTGGGGTCCTCTATCA    V-9J13
159 E08 V   C47E8.1 ATTTCTTAACGTTTTTCTTCGGC CTTCTTTGCGAGGTAATAGAGCA V-9J15
159 E10 V   C47E8.3 TCGGTATGGTGTCAGTGCAT    ACAACCGCCACTCTTGAAGT    V-9J19
159 E11 V   C47E8.4 ACGACCGTATTTCTTGCTGG    GAAAAATTGAGGGCAGGTGA    V-9J21
159 F01 V   C47E8.6 ATGCCGTCGATAGCTCAGTT    AGTTCTCGCTGTGGAGGAAA    V-9L01
159 F02 V   C47E8.7 AACTTCACATCCCTTCAATGAGA AGCAACTAGGGAAAATCTATGCC V-9L03
159 F03 V   C47E8.8 CCCGACAATCCGAAGAGATA    AATTTGCTCCAATTTCACCG    V-9L05
159 F05 V   Y50E8.b TACTGACTGCTTCCCATTGATTT AGAGCCCGTAAGTGTATGTTTCA V-9L09
159 F06 V   Y50E8.c TATTTCCTCCATCACTGTTTGCT CAACAATGCTTGATTTTGTGTGT V-9L11
159 F09 V   Y50E8.f CCAATTCAACTCCACTATGCTCT GCCAAAATTCATTCCTTACATCA V-9L17
159 F11 V   Y50E8.h TGTGAAAGCACGATTACTTGCTA AGAGTAAAATATGGTGGGAAGCC V-9L21
159 G02 V   Y50E8.k CCAATTATCTTCGTCACTTCGTC ATGTAAAAGAGCGATCCATGTGT V-9N03
159 G03 V   Y50E8.l CCAAAATTTGTAATGTTTCCCAA AGTACTTGTTGTGGCGTCTTCTC V-9N05
159 G05 V   Y50E8.n CCATGATTCTTTCGAAACTTGAC CTCATGACAATGGAAACAAAACA V-9N09
159 G07 V   Y50E8.p ATCTTGTCCTTTTTCCAATGGTT CTTCCGATTCTCCTGGTTATTTT V-9N13
159 G08 V   Y50E8.q CAACCACAAACACCACTTTCTTT ACCTCGTAAGGTCATCTGAACAA V-9N15
159 G09 V   Y50E8.r TTGGTTTAGCACAGATAAAGGGA CACGTGCTCTTTCAAGATTCTCT V-9N17
159 G10 V   C48G7.1 ATGGAGTACCGTCCATAAGGATT TGTGATCTACGCAAATGTTTCAC V-9N19
159 G11 V   C48G7.2 CCACCACTAGCAGAAAAGCTAAA ATGAATAAAATGGCAAATTGGTG V-9N21
159 H02 V   W06A7.3 ATGTTTTGATTTCTTTGCTGGAA TCAGGTTATATTTGTTGGGGATG V-9P03
159 H04 V   W06A7.5 TGTGCTCCCTGATGATTCTAAGT ATAACTCTCCCAACAACACCTCA V-9P07
159 H07 V   ZC412.3 TGATGCCTGCTTGCTACTTG    TGCCAAGATTAATTGGCCTC    V-9P13
159 H08 V   ZC412.4 TGAAGCTGAAACAAACAGCAATA ATTTCAGAAGCCAGAAGTGTACG V-9P15
159 H09 V   ZC412.5 TTTTGTTCTCAATATCGATGCCT TTTAAATACGTGAATCCAACGCT V-9P17
159 H11 V   ZC412.7 CATTGCAAATCTGATCAGGTACA ATTACCTGAAACATGCCCCTATT V-9P21
159 H12 V   ZC412.8 ACAGCAACCTGAAATGTGTTTTT TGTACCTGATCAGATTTGCAATG V-9P23
160 A01 V   ZC412.9 AATCTTTGCTCAGATCCACTCAG ATGATGTGTGAGTGAAGTTGGTG V-9B02
160 A02 V   H12D21.1    CATTGCAAATCTGATCAGGTACA ATTACCTGAAACATGCCCCTATT V-9B04
160 A03 V   H12D21.2    AATAGGGGCATGTTTCAGGTAAT CCAATAAAATGCTCAATTCGTTC V-9B06
160 A04 V   H12D21.3    TTCGAGACTCGTAAAATTGCTTC TGTACCTGATCAGATTTGCAATG V-9B08
160 A05 V   H12D21.4    ACTAAATCCCAGTTGCGTTTACA CGAACCATCATCAAAGTTCTAGG V-9B10
160 A06 V   H12D21.5    TGTTTTATCTACCGGATCGAAGA TCCGTAACATTTGGTCTTGAACT V-9B12
160 A07 V   H12D21.7    TAATGAGAGAGCGTTGGAAAAAG CATGAACAGGGAAAGTTTTCAAG V-9B14
160 A08 V   H12D21.8    ATGATGTTTTACCGGAATGTTTG TCATCGTAGACGAGAAGATAGGC V-9B16
160 A10 V   H12D21.10   TGACAAAATGTGTGATCCTCTTG TACCCGGAGTAAGCATTAAAACA V-9B20
160 A11 V   W09D12.1    GTTGGTTCGGAATGTGACCT    TTTCATCCGTCGATCATTCA    V-9B22
160 B01 V   C30G7.1 AAGTGAGATGGGGGAGTATCAAT TTTCCTCTCTCTGTTTTCTCACG V-9D02
160 B02 V   F02D8.1 ATGTCAACATACAGGTGGGTTTC ACCATGACAACAAACGCTTTAAT V-9D04
160 B03 V   F02D8.2 TGCAACGCTCTTTAGGGTTT    ATGTCCATCATGCACTCCAA    V-9D06
160 B05 V   F02D8.4 ACAAACCCCGATGGATATGA    CTTCTACCTCCCACGACCAA    V-9D10
160 B06 V   T01C3.1 AAACAGACTCCGATGGAACG    GATCCGCGAAAAATGTGAAT    V-9D12
160 B07 V   T01C3.2 CGGATCTTACGACACTCCACTAT AGAATCATGTTGCGTTCAATTTT V-9D14
160 B08 V   T01C3.3 TTCAATGTAGAAATGGGAGCAGT TTCAAATCTGCGTTTTGATTTTT V-9D16
160 B09 V   T01C3.4 ATGTGAGCTCCGCTGCTACT    TTTCCTCCCCAGTTCAACAC    V-9D18
160 B10 V   T01C3.5 CAAATTTTTGGCATTTGGCT    GAAACGTGGAAGATCCGAAA    V-9D20
160 B11 V   T01C3.6 TGCCAATATTTCAGGCAGACTAT TCTCAACCTTGCCGATATTTCTA V-9D22
160 B12 V   T01C3.7 CTCATACGGCTCCAGGGTTA    TGTTCGCCATCAAAACGATA    V-9D24
160 C01 V   T01C3.8 GCTGCAAATAACGAGGAAGC    TTCCGTCGTTCGTGTTATGA    V-9F02
160 C02 V   T01C3.9 GACTCCAGATGGAAGTTCACAAG AAAAATGGGGATAAAATGTGCTT V-9F04
160 C08 V   F14H8.6 ATCCGCAAATCTTGCAATTC    CCAAATCTTCTCCGCAAAAA    V-9F16
160 C09 V   F14H8.7 AGGTTTTTGGTGCAGTTAACAAA TTAAAACGTTTGCGGTTTTTCTA V-9F18
160 C10 V   C25D7.1 GAATCCAGGGAAATATCCAGAAG TAAGGTTTTTCGGAATAGTGCAA V-9F20
160 C11 V   C25D7.2 ATGGAATGACGGTAAGCTCG    TGGTTTCTTTGATTGCCACA    V-9F22
160 C12 V   C25D7.3 TGGCGCCTTGAGCTATACTT    TGACCCTGATGCAAGTACCA    V-9F24
160 D01 V   C25D7.4 GAAAAAGCCTTGCAACTTCG    GCACCGGTAGGAAATGGTAA    V-9H02
160 D02 V   C25D7.5 TGGTTAGGTTGGTTGGTAATCAG TAACAGTTTGCATTTGTCCTGTG V-9H04
160 D05 V   C25D7.8 CGGTGCAATTTGTCGTAATG    AGAGAGAGCACATCGGGAGA    V-9H10
160 D06 V   C25D7.9 GCCGAATTTGAGATTTTAGTTGA AATTTTGTGCTCTTCGTCTCAAG V-9H12
160 D07 V   C25D7.10    CTATCTCTGCGTCCCTTTGC    CAACAATGCAGACATTCGCT    V-9H14
160 D09 V   C01G10.1    TTGGCACAATTTCACTGCTC    TTTTGAGGCATCATCGAACA    V-9H18
160 D10 V   C01G10.2    TGACTTGCAAGAAAGAGCGA    TCGTAATACATTGTGCCCGA    V-9H20
160 D11 V   C01G10.3    CAATGTTATTTCCATTGCGATTT TTATGATATTGGAGTAGGCGGTG V-9H22
160 D12 V   C01G10.4    AGGAGTCGTGGGATTTGTAGTTT GGTCGTAGAAATGTGAACGGTTA V-9H24
160 E01 V   C01G10.5    CCTCCTCATTGTTTTGAACTACG TTTGATCGCTACTCTTTTGGTTC V-9J02
160 E02 V   C01G10.6    AGAGCATCATAACGATCAACGAT GGCGTGTTCTTCACTTTAATCAC V-9J04
160 E03 V   C01G10.7    TGGAGCTAGAAGATGGCGTT    TGCTCACTGTAAGCGTGGAC    V-9J06
160 E04 V   C01G10.8    TCTCGAATGTTCCAGTCACG    GAGATCCACGCTGGATTGTT    V-9J08
160 E05 V   C01G10.9    CCAAAAGGCTTCTGAGCTTG    GTTTCCGAAATCCGTCAAAA    V-9J10
160 E06 V   C01G10.10   CACACCTGAAGGCTAGCACA    ATCCGACAACCGTGTACTCC    V-9J12
160 E07 V   C01G10.11   ACTCTCACTGACACCCACATTTT ACAATTTTCAAAAACAGAACGGA V-9J14
160 E08 V   C01G10.12   CGCATCATACATCATCAGAAAAA AAGAACAAGGGAGAAATTTTTGG V-9J16
160 E09 V   C01G10.13   TTTTTAATTGGCAAACCCTTTTT AAAGGCCAAAATTTAAACCATGT V-9J18
160 E10 V   C01G10.14   AAATTGAAGCAGCCAAATACAAA GAGGCAAACTCAGAATCTTCAAA V-9J20
160 E11 V   Y75B12A.1   ATTTTCAGCCAAACGACCTG    AAAGGTACATGGCTTCGGTG    V-9J22
160 E12 V   Y75B12A.2   GCAAACTATCCACCCTGGAA    CTATGTGGCTCTGCGGTGTA    V-9J24
160 F02 V   T01G5.2 GTTTTCCACTGAACGCCAAT    TGAAGGCAAGGAACTTCGAT    V-9L04
160 F03 V   T01G5.3 AAACATGGTGTAAAGCAGACGAT GGCTCATCACTACATTCCAAAAG V-9L06
160 F04 V   T01G5.4 AATGTCGTCAAATCTTCCCG    AGGAAAAGCGGAGTGACTGA    V-9L08
160 F05 V   T01G5.5 TCACGGTCCCTTCTAACCAG    AATGGCTGGTTGTTTTGGAG    V-9L10
160 F06 V   T01G5.7 CAATTTGGGACATGGGTTTC    AGCTGGTATGGGTCAAGTGG    V-9L12
160 F08 V   K08F9.2 TCACTAATATGGCCTTCCGC    CTACGCGGGAAAACGAAATA    V-9L16
160 F09 V   K08F9.3 AATTTTTCAAAGGAGGAGGTGAG CTTGAGGAAAGGATATGTGCAAG V-9L18
160 F10 V   K08F9.4 GCAGCGAGAGTTAGTTTGCC    GTATCGCGCAGTTGTCAAGA    V-9L20
160 F11 V   T09F5.1 AGGATAGGGCCGTTAGGAAA    AATGTATTGTGCCACGCAAA    V-9L22
160 F12 V   T09F5.2 AAAAATTGTTCATTTGTGCAACC ATTGAGAAACTGGAGACATGGAA V-9L24
160 G01 V   T09F5.3 ATTTGCAGGATGGGAGACTG    GAGTAAAGGGCGTGGTTCAA    V-9N02
160 G02 V   T09F5.5 TCTTCGATGCCCGTTTATTC    GTCGATTCTCAAAGAAGGCG    V-9N04
160 G03 V   T09F5.6 CAGACTGCATTTTTCGAAACTCT GAAAGCTTTTTAACGTGATGGTG V-9N06
160 G04 V   T09F5.7 AAACAGGTGAATTTTGTGCATTT ACCAAACCAAAACACCAGTTAGA V-9N08
160 G06 V   T09F5.9 ATCACCAAATTTTTGTATGCACC CAATTTGTTGTCCGAGTACATGA V-9N12
160 G07 V   T09F5.10    GTCATCGCAGTCGGTCACTA    GGCATTCGGTGCTTAACAAT    V-9N14
160 G08 V   T09F5.11    AAATTGGAGTGGCTTCCCTT    AGTTTTCCATTGGGGGATTC    V-9N16
160 G12 V   Y75B12B.4   GCATTGCTCAGCTTAAATTGTTT TTCAACAAAGCTTGGAGCTAATC V-9N24
160 H01 V   Y75B12B.5   GTCTCACAAATTATCAACGGAGC GGTGCAATTAATTTATGCCTTGA V-9P02
160 H02 V   Y75B12B.6   AAACGAGGCTAATTTCAGATTCC CACAACCTCCATTTCTCTCAAAC V-9P04
160 H04 V   Y75B12B.8   ATCATCAACTGGCTTCCAAGTAA CACATCAAAAAGTGATGCCAGTA V-9P08
160 H05 V   Y75B12B.9   CTGCATTGAATATGCAGTAACGA GTAGGTGGAAGGCAGAAGTAGGT V-9P10
160 H06 V   C41G6.1 TCCCAAAGCAATCAATTTTTAGA GATCTCTGGTTTGATTCCAACTG V-9P12
160 H07 V   C41G6.2 AAAACTGCCATGAATCGAGTAAA ACTACAACTCAGCTGCACTTTCC V-9P14
160 H08 V   C41G6.3 ATGCTGAGCGGCTTTAGTGT    TGCAACCAACAGCGAAATAG    V-9P16
160 H11 V   C41G6.7 GCAATGGTGATGGCCTTATT    GTTTAGCAATTTTGCCCCAA    V-9P22
161 A01 V   C41G6.9 ATGTCACTGACGCAAAACCA    ATGTGCTTCTTTGCGAGGTT    V-10A01
161 A02 V   C41G6.10    GCGAAATGGGGAAAAACATA    GTATTGCGACGGGAGTTGTT    V-10A03
161 A03 V   C41G6.11    TTCTTGTCAATTGTCATCCTCCT CTACCTCATTCAACAATTCCAGC V-10A05
161 A04 V   C41G6.12    AGGCACAATTCCAAATAGTCTCA TGCATTGAATATGCAGTAACGAC V-10A07
161 A05 V   C41G6.13    TAATGCAAAAATTGCACATTGAG TCTCCGTCCTTTCATATGTCTGT V-10A09
161 A06 V   M01B2.1 ACCGTACCCCACCGTATGTA    AGGGTCGGAAACTAAAGCGT    V-10A11
161 A07 V   M01B2.2 CATGATGTATCTGGCTCTCACAA GATCATTTGAAAAGTGTGCTTCC V-10A13
161 A08 V   M01B2.3 TCACACAACTTGATTCCCCA    CGTGCATCTCCAAATCTGTG    V-10A15
161 A09 V   M01B2.4 TTGATTAATTTTCTCGGCTTCAA ATTGCGTGTTCAGCTTAATGTTT V-10A17
161 A11 V   M01B2.6 ACCAGTGGTGAGAAACCAGG    TTGCCAAATCCAAACTCCTC    V-10A21
161 A12 V   M01B2.7 TCTGTTAAGGCCTGACGCTT    CCAAGCATCGGTTTGAATCT    V-10A23
161 B02 V   M01B2.9 GCAAACAATGTCAATGAGTTGAA AATGGAGCCTCTTCTTATCATCC V-10C03
161 B03 V   M01B2.10    CCCATACCGTCCGATTATTG    CAATGCAAAATGTGATTGCC    V-10C05
161 B04 V   T10H4.2 CATAGCATGCGAGTCCTTGA    TCTTTTTCTTTGCGGCTCAT    V-10C07
161 B05 V   T10H4.3 CCAGGTGTAATGCGGTTTTT    GTTGGTATGATTCCCGATGC    V-10C09
161 B06 V   T10H4.4 TCCACGGAATAAAGCTGTCC    AACCGGCTAAAGCTCCACTT    V-10C11
161 B07 V   T10H4.5 GAAGCGAACCGAAAGATGAG    AAGCAATTTGGAATTCACGC    V-10C13
161 B09 V   T10H4.7 TGCAATTCCCAAAGTTCCTC    AATGGCCGAATACTACGACG    V-10C17
161 B10 V   T10H4.8 AGAGTTGGTGTGGTTGAGATGTT TGGCAATCAGCTAACCAATTTAT V-10C19
161 B11 V   T10H4.9 TCAGCTCCATTGGTGTCTTG    TCTTTTGGTGGGGAACTTTG    V-10C21
161 B12 V   T10H4.10    CATCCAACCGTGTTCAAGTG    TCGATTTTTGAAATGGAGGC    V-10C23
161 C01 V   T10H4.11    CATGAACCAGCTCTTCACGA    TGCCAACAGTCTTCATCTCG    V-10E01
161 C02 V   T10H4.12    TTGAAAAAGTCCCAGAACCG    TGGATGTGAAGTTCGCAGAG    V-10E03
161 C03 V   T26H8.1 GGCGTCCAAGGTTCTAACAA    TTGGTCATTCAGCAATGGAA    V-10E05
161 C04 V   T26H8.2 CAAACAAATACAAAAGCCTGGAG TGTGATGCTGATATTAAACGACG V-10E07
161 C05 V   T26H8.3 AAAATATCACCTGGCCAAAATCT TTTTCAAGGAGACTTACGCTTTG V-10E09
161 C06 V   ZK1037.1    CGTGAAGCATTTAGTTGGCA    AAATTCGCTGAAATGTTGGC    V-10E11
161 C07 V   ZK1037.2    AGATAATGCACACGGAGCCT    CGAAACTCATCGTCAAAGCA    V-10E13
161 C08 V   ZK1037.3    TGGTGGAAGCATTGAACAGA    CCGGCTTACAAAGCAATGTT    V-10E15
161 C09 V   ZK1037.4    AATCAGAAGCACCTTTGTGTCAT CAAATCTCTCATCTCCATTGTCC V-10E17
161 C10 V   ZK1037.5    GACAAGTTCTGAGCCTTCGG    TAACTTTTACCGGCCTGTGG    V-10E19
161 C11 V   ZK1037.6    CTTTTCTTCGCCTGTTCTTATCA CTTCTGTCACAATTACACCACCA V-10E21
161 D03 V   ZK1037.10   CTTTGTCAAGGCCTGAAAGC    ATCGGGGAATGACTCTTGTG    V-10G05
161 D04 V   ZK1037.11   CAGCTATTGATAGAGGCGGC    ACCTCTTTCGGACCAACTCA    V-10G07
161 D06 V   C29F3.1 ACTGCTTGCGTAGCATTGTG    TTTGGCTTTGGAAAACATCC    V-10G11
161 D07 V   C29F3.2 GGATCCAAGCATGCAAATCT    AAACACATCCAGATAGCCGC    V-10G13
161 D09 V   C29F3.4 ACCACAACATTTTCTGCTCACTT CTTTGGCAGAAGCTTTATTCTGA V-10G17
161 D10 V   C29F3.5 GATATAAGTTGTCATCGCGAACC CCCTTGATTCATAACCCACAATA V-10G19
161 D11 V   C29F3.6 GGCGGATGTGCTCATAATTT    AATTGGGTGCGAACTTTTTG    V-10G21
161 E01 V   R08H2.1 GCGCAGAGGGAGTAACAGAC    TTTGCATTCCCATGACAAGA    V-10I01
161 E02 V   R08H2.2 CCCGATATGGAAAATTGGTG    TGTGGGCCTAAATCAGTTCC    V-10I03
161 E04 V   R08H2.4 ACAATCAGTGATGCAGAGAGGTT TTCAGTCCTAATGACATCCCAGT V-10I07
161 E05 V   R08H2.5 TGTGAAAACTTGAAAAATTGGCT CTGAAAGTATTGTTTTTGGTGGC V-10I09
161 E06 V   R08H2.6 GACATAGATCAGTAACGCGGAAG AGCCAATTTTTCAAGTTTTCACA V-10I11
161 E07 V   R08H2.7 CATGCAACTGATTCCCAAGA    GGGTTCTGGAAAATGGGATT    V-10I13
161 E08 V   R08H2.8 CTAAGTCATCCAAATTTTCGCAC TGATATCCAGAAACCGTATCACC V-10I15
161 E09 V   R08H2.9 ATTCGTCGGAAACCACTTTG    ATTTGATTGGCCCACGTAAG    V-10I17
161 E10 V   R08H2.10    TGGAACTAAGCATTTGGAACCTA TTTGATCTACCAAAATTGCTCGT V-10I19
161 E11 V   R08H2.11    ACTTTTGAAGTGAATTCGGTGAA CACTTTCAAGCTTGTTCGTTTTT V-10I21
161 E12 V   R08H2.12    TCGGATTATGAAGTCAGAGAAGC CCGAATTCACTTCAAAAGTAGGA V-10I23
161 F01 V   R08H2.13    TAAAAATTTGATTTCGCGGC    TTCAAATCACCGGAACAACA    V-10K01
161 F02 V   T06E6.1 ATAGATCCGGCTTGTCCCTT    AAATCGCATTCAAATCTGCC    V-10K03
161 F03 V   T06E6.2 TGGGAAAGTCGAGAACGAGT    GGTGAACAGTTGAGAGGGGA    V-10K05
161 F06 V   T06E6.5 GGGGTGCTTCTGATCCATTA    GCCTTCAACTACGCCTTCTG    V-10K11
161 F08 V   T06E6.7 TGTTAAATGCTCGAATTTGGACT AGGGGGTCTGTTTAACATTTTGT V-10K15
161 F09 V   T06E6.8 CTATGGGAGCTGTAGCCTGC    TTGTTTGCAATGGGGTTGTA    V-10K17
161 F11 V   T06E6.10    TCTTCAACGAGTGATGTTTCTGA TTTTCTTAACGAAACTGGCAAAG V-10K21
161 F12 V   T06E6.11    GGCCGTTCAAACGAATAGAA    TTCGAGCGTTGCTTTTTCTT    V-10K23
161 G01 V   T06E6.12    TTCTCGGAGCAGTCCCTTTA    GATTCGATTTGCAACTGGCT    V-10M01
161 G02 V   T06E6.13    ACCAATTTTCGAAACGTAAGACA TCCCAGAGACACAAGAATTTGAT V-10M03
161 G04 V   T26H5.1 CTGTCTCACCTGCGCATAAA    TGGGTGCACCTAAACATTGA    V-10M07
161 G05 V   T26H5.2 TCTAGGAACCGGAATATGGAAAT ATCGACAATCACAAAAATGAAGG V-10M09
161 G06 V   T26H5.3 TGGCAGGCTATGGACTAGGT    AACACGGGGAGCACATCTAC    V-10M11
161 G08 V   T26H5.5 CGTGCCTTCGAAACTTCTTC    CTATTCGCCTTAATCAGCGG    V-10M15
161 G09 V   T26H5.8 ATCCAGATTACAAGAGTGACCGA TTTAATTTCAGAATTGGAAGCCA V-10M17
161 G10 V   T23F1.1 GGTGACTCTAGAACTGGTCGAAA ATACTTTTGGCCACCACTGTAAA V-10M19
161 G11 V   T23F1.3 TGGTCCGATGCACTGAAATA    CTTCCCCAAATTCCCAAAAT    V-10M21
161 G12 V   T23F1.4 ACCGCTTGGTACAAACAAATAGA CATGTTTTCTATAGATGAGCGGG V-10M23
161 H03 V   T23F1.7 TTGTTTCATGCAAAGGACCA    TTGCACTGTTTTGGAAGTGC    V-10O05
161 H04 V   C06B8.1 CATGAATCCTGGGTCGATTT    GATAACCGGAGTCATTGCGT    V-10O07
161 H07 V   C06B8.4 ATCCTGATGGGATGAGCAAG    CCCCCAAAAATTAGCTGTCA    V-10O13
161 H08 V   C06B8.5 AACACCCGAGCATGAAAAAC    TTGGTCATTCAGCAATGGAA    V-10O15
161 H10 V   C06B8.7 TGGATGTGTATGGACTCGGA    TGAGCAATAGAGTTGGCACG    V-10O19
161 H11 V   C06B8.8 GATGCCAAGTCCGTCAAGAT    TGGAATCCGTGATAAGGCTC    V-10O21
161 H12 V   F21A3.1 ATGTATGCACCTGTCCCTCC    CTGCGCGTTCTCTCTCTCTT    V-10O23
162 A01 V   F21A3.2 TAATCAGTGGATCTTACGGCACT AAGGAAGGTGTGCTGTGTTTTTA V-10A02
162 A03 V   F21A3.4 ATGTGGAACCTATTCGACATTTG TAGCTGACGCAACTTTCGTTATT V-10A06
162 A06 V   F21A3.7 GTGTTCGAATCGGAGTAAATCAG AACTACACGGGACAGGTCAGATA V-10A12
162 A07 V   F28F8.1 TGTGAATGCGGCCATAAATA    TTTCAGCGCTAACATGAACG    V-10A14
162 A08 V   F28F8.2 TGAGAAATGCACCACGATGT    TTGTGAGAGGGAATTCGGAC    V-10A16
162 A09 V   F28F8.3 AATTTTACCCGATTTTCTTTCCA CAGGGACGATCTGAACAATTAAG V-10A18
162 A10 V   F28F8.4 TGATCCCGGCTTTAAGAATG    GACATGGAATTTCTTGCCGT    V-10A20
162 A11 V   F28F8.5 TCTGAATCCGAGAGTTCAACATT AAAAATTATTTGATGGCACCCTT V-10A22
162 B01 V   F28F8.7 TTGGATCGTAATACTTCAACGCT CGAGGAAAATGTAGACAATCCAC V-10C02
162 B02 V   B0391.1 AATTTGATCGGAGGTGCTTG    CGTCACGGAGCTGTATGAGA    V-10C04
162 B04 V   B0391.4 AATTAGAATTCAGACGGCAACAA TTGAATCTTGCAGTGTTTTCAGA V-10C08
162 B05 V   B0391.5 ATACCCCACTCCTGAAACAATTT ACTTTAGAAGCAATTTATCGCCC V-10C10
162 B06 V   B0391.6 CGAAATATGAGCAGCCAAAATAC AGACCCCGTAAAGTAATCCACAT V-10C12
162 B09 V   B0391.10    GGCCACAATCAATAAATTCGTTA GAGTGGCAGTTCATACAAAAACC V-10C18
162 B10 V   C55A1.1 ACTCAATCTCCACTGGGACG    ATGAAAATTGTTGGAAGCGG    V-10C20
162 B12 V   C55A1.3 CATGGAGAAGAGGAATCCCA    CTGCTTGATTTTTCCACGGT    V-10C24
162 C01 V   C55A1.4 CGAGAATTTTTACCCCTTTCAAT GAAATCCAACAACAGAGAGTTGG V-10E02
162 C02 V   C55A1.5 TTCTACAGTACCCAACGCCC    GACATGCCGCATAGATCAAA    V-10E04
162 C03 V   C55A1.6 TTATTAGTCACCCCAATTTCCCT TGATTTTAAGTGTGCCAGGAAGT V-10E06
162 C04 V   C55A1.7 ATGGGAGTCATTCTAGTCCCAAT TGAAACTTGCACCAAACACATAC V-10E08
162 C05 V   C55A1.8 CATTGACTTCCAACTTTTTGAGG AAATAATCATAGTCCGGGAGAGC V-10E10
162 C06 V   C55A1.9 CAAATAGTTAATCGTGCTCTCCG TGGTGAATATTGTAACGTGGTGA V-10E12
162 C07 V   C55A1.10    TCTTCGACAGAAAAGTTGAGAGC TCTCCACAAGAGTAAAGCTGACC V-10E14
162 C09 V   K06B4.1 GCTTGCGAACAGGAGTTTTC    AGCTGCCTACGATTCCTTCA    V-10E18
162 C11 V   K06B4.3 AGCAGTTTCACAAAGTTTTCAGC GCACGGGCTCTATTTTTCTTTAT V-10E22
162 C12 V   K06B4.4 CTGTATCTCTGGAAGACGATGCT ATTGTCCTCAACTTTCAAACGAA V-10E24
162 D01 V   K06B4.5 AAAACGAGTCTTCCCGACCT    CAACCGTGTTGCCTTTTTCT    V-10G02
162 D02 V   K06B4.6 TTCCGTAACTGGAGTTTGGC    GAACCGAGTTGGTGCAGATT    V-10G04
162 D03 V   K06B4.7 AGGCGATGTCTTGTTTTGCT    TTTGTGGTCTCAGATGCCTG    V-10G06
162 D04 V   K06B4.8 ATTACCCTGGGAAAGTTGGG    AAAAATATGGCCGGGAAGTC    V-10G08
162 D05 V   K06B4.9 TTACAAAACCGACACCCTCC    AATTTGTCGTCTCCGCAATC    V-10G10
162 D06 V   K06B4.10    TCCAAGAGAATGATACCCGC    CAGGTGCAGTTGCAGATGAT    V-10G12
162 D08 V   K06B4.12    CCAGCAGAAGAAAGGTGAGG    TGACGGGGACAAAAATGAAT    V-10G16
162 D09 V   K06B4.13    GTGCAACCAATAGAAACTATGGC GTTTTCAATAGCACCCCAGTATG V-10G18
162 D10 V   Y6E2A.1 TTTTCATCTTTCCCCTACTGACA TTTAAAAACAAGCAAGCCATGAT V-10G20
162 D11 V   Y6E2A.2 CACCAATAATTCTGTACCGGAAA CCTCCAAAACATACCTGTACGAC V-10G22
162 D12 V   Y6E2A.3 ATGGATCAGCTGAGTGACAGATT GAAAGCAGGAAGAGGAAGAGTTC V-10G24
162 E03 V   Y6E2A.6 TTTCATATCGGGCAGGTCTC    AAATCCACCGTTGGTCAAAA    V-10I06
162 E06 V   Y6E2A.9 CACTCTTCACCTCATCCAATACC AACCTCCAACTTTCTCACATGAA V-10I12
162 E07 V   T23D5.1 CGATTTTCCGCTGTTTGATT    ATCGGTTTTGCAGTTTTTGG    V-10I14
162 E08 V   T23D5.2 ATCATGAAAGCAATCGTCTCAAT TTTTCTTGTCTCGAAGTACTGGC V-10I16
162 E09 V   T23D5.3 CATTGAACTCAGTTTCCAACACA ACAAACACGCCGATAACAAGTAT V-10I18
162 E10 V   T23D5.6 CACGTGATGATACCCGAGTG    AGGCAGGTAATGCGACACTT    V-10I20
162 E11 V   T23D5.7 GGCGCCTCTTTAAGTGTCTG    TTGCGTTTGCGAGTATTGAG    V-10I22
162 F01 V   T23D5.9 ATGCGGACACCGAAATAAAG    TTTTCCGTTGTCGGTTTTTC    V-10K02
162 F03 V   T23D5.11    GCAGTTCCTGCACACCTACA    TTCGAGAGCAGGAAGTTGGT    V-10K06
162 F04 V   T23D5.12    ACAGCTACAACTCTGGTTTCGTC AAAATTTTGCAAAGACTGGAACA V-10K08
162 F06 V   F57A10.2    TCAATTGGACC