Drosophila gene collection


Please note that the clone(s) being sent have tested negative in our T1 phage contamination assay. However these clones should still be handled with care as no phage assay can be guaranteed to be 100% reliable.

THE DISPATCH NOTE SHOWS THE ORIGINAL CLONE ID ORDERED AND ALSO THE ALIAS (PLATE AND WELL NUMBER ). THIS IS WHAT IS SHOWN ON THE CLONE LABEL. PLEASE KEEP THE DISPATCH NOTE FOR FUTURE REFERENCE.

What to do with your clones when you receive them

Plates- contain LB broth with 8% glycerol and antibiotic*. are sent on Dry Ice. These should be stored at -70°C

Individual clones have been streaked onto LB agar containing antibiotic*. Please store them at 4°C (not in a freezer).


As soon as possible, re-streak the clones onto the same medium and incubate overnight at 37°C to obtain single colonies.

*Antibiotic


DGCr1.0

Plates 1-4 Ampicillin 75µg/ml
Plates 5-17 Chloramphenicol 25µg/ml


DGCr2.0

Plates 1-10 Ampicillin 75µg/ml
Plates 11-16 Chloramphenicol 25µg/ml

 

A selection of at least 10 single colonies should be picked and grown in LB broth containing appropriate antibiotic + 8% glycerol for subsequent freezing at -70°C. These frozen stocks can then be re-grown for plasmid isolation and purification.

Streaking out for single colonies is essential in case of contamination or cross-contamination, or if modifications of the original clone have taken place as the library has been replicated. If there is a problem, the more single colonies you streak out, the more likely it is that you can retrieve the original construct. You can also isolate the original clone from a contaminated sample by following this procedure.

The Drosophila Gene Collection r1.0 is the first release of ~6,000 cDNA clones which has been produced by a consortium of Berkeley Drosophila Genome Project (http://www.fruitfly.org/). The cDNA libraries have been produced in pBlueScript and pOT2, pOTB7 and pFLC-1 vector systems originating from a variety of fly tissues/organs. Full list of cDNA libraries and mRNA sources can be found in Table 1.

DGCr3.0

Plates 1-3 Ampicillin 75µg/m
Plates 4-6 Chloramphenicol 25µg/ml

Table 1 : Description of cDNA libraries

µg/m

Library code mRNA source
CK Rough endoplasmic reticulum (ER) from 8-16 hr embryos
GH ZAPII Adult heads from an isogenic y; cn bw sp strain
GH pOT2 Adult heads from an isogenic y; cn bw sp strain (remade)
GM Ovaries, stage 1-6 of oogenesis
HL Adult heads from an isogenic y; cn bw sp strain
LD Embryos (0-22 hr)
LP ZAPII Varying stages of larvae and early pupae from an isogenic y; cn bw sp strain
LP pOT2 Varying stages of larvae and early pupae from an isogenic y; cn bw sp strain
SD pOT2 Schneider L2 tissue cultured cells
AT pOTB7 Adult male testes and seminal vesicles dissected from 0-3 day old Ore-R males
RE pFlc1 0-22 hr mixed stage isogenic y; cn bw sp strain embryos
RH pFlc1 Adult heads from an isogenic y; cn bw sp strain

The Drosophila Gene Collection releases 1.0 and 2.0 together consist of ~11,000 cDNA clones which have been produced by a consortium of Berkeley Drosophila Genome Project (http://www.fruitfly.org/). The cDNA libraries have been produced in pBlueScript and pOT2, pOTB7 and pFLC-1 vector systems originating from a variety of fly tissues/organs.

Vector information

Please click on the links below to view desired vector map

pOT2 http://www.fruitfly.org/about/methods/pOT2vector.html


pOTB7 http://www.fruitfly.org/about/methods/pOTB7vector.html

pFLC-1 http://www.fruitfly.org/about/methods/pFLC-Ivector.html


pBS Diagram, Sequence

 

Further information- http://www.fruitfly.org/EST/faq.html#cdna-6


Sizing cDNA inserts

Template: 3.0 µL from 1:50 dilution in water of frozen stock.

Use the following primer pairs:

pOT2 vector
PM001a: 5' GTCGACGTTAGAACGCGGCTAC 3'
PM002a: 5' GGGTTAAATTCCCGGGTACTGC 3'

BS vector


SK-30: 5' GGGTAACGCCAGGGTTTTCC 3'
SKMet: 5' ATGACCATGATTACGCCAAGC 3'

pFLC-1 vector


T7 primer: AAT ACG ACT CAC TAT AGG
T3 primer: AATTAACCCTCACTAAAGG

 

Sequencing of inserts

Sequencing Primers for BS and pOTB7
M13 forward (-21) 18-mer: TGTAA AACGA CGGCC AGT
M13 reverse 17-mer: CAGGA AACAG CTATG AC

 

Sequencing Primers for pOT2
T7 primer: AAT ACG ACT CAC TAT AGG
PM001 primer: CGT TAG AAC GCG GCT ACA AT

 

Sequencing Primers for pFLC-1
T7 primer: AAT ACG ACT CAC TAT AGG
T3 primer: AATTAACCCTCACTAAAGGG

 

Alternatively, the following primers can also be used
FLC2: ATTGGAGCTCCCCGCGGTGG
KST3: CGCAATTAACCCTCACTAAAGG

 


Citation in publications

Please cite the following paper for BDGP clones or sequence data.

Mark Stapleton*†, Joe Carlson*†, Peter Brokstein*†‡, Charles Yu*†,
Mark Champe*†§ Reed George*†, Hannibal Guarin*†, Brent Kronmiller*†,
Joanne Pacleb*†, Soo Park*†, Ken Wan*†, Gerald M Rubin*¥# and
Susan E Celniker* A Drosophila full-length cDNA resource. Genome Biology,
2002;3:research0080.1-0080.8

 

Stapleton M, Liao G, Brokstein P, Hong L, Carninci P, Shiraki T, Hayashizaki
Y, Champe M, Pacleb J, Wan K, Yu C, Carlson J, George R, Celniker S, Rubin
GM. The Drosophila Gene Collection: Identification of Putative Full-Length
cDNAs for 70% of D. melanogaster Genes. Genome Research. 2002; 12:1294-1300.

 

Rubin GM, Hong L, Brokstein P, Evans-Holm M, Frise E, Stapleton M, and Harvey DA:
A Drosophila complementary DNA resource. Science 2000,
287:2222-2224.